Overview

Brief Summary

Biology

Klipspringers are monogamous animals that are nearly always seen in pairs, usually with one offspring. The bond between a male and female is strong and enduring; they spend most of their time within a few metres of each other with one being look-out while the other feeds, and this relationship usually lasts until one dies (3). Together the pair defends a territory in which they feed on herbs and low foliage, sometimes seeds, fruits, buds, twigs and bark, and grasses in the wet season (2) (3). Occasionally groups of eight or more klipspringers may be seen, but these quickly split back into family groups when disturbed (3). Like many animals that live in Africa's hot climate, klipspringers generally rest during the heat of the day, and are also generally inactive after midnight (2). The gestation period of the klipspringer is 210 days (4), after which a well-developed young is born. The young hides in vegetation for up to three months, while its mother visits three or four times a day for suckling (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This fascinating small antelope has a number of distinct features that make it well adapted to its rugged, rocky habitat (3). It is unique amongst the antelope for walking on the tips of its hooves and it has a remarkable dense, coarse coat consisting of hollow hairs that rustle when shaken or touched (2) (3). When the klipspringer is hot or sick its fur stands erect, giving the illusion of being much larger than it actually is (2). The coat varies in colour from yellow-brown to grey-yellow, with whitish underparts, chin and lips (4). In most areas only the males have horns, which are short, widely-spaced apart and ringed near the base; in the Ethiopian, Ugandan and Tanzanian populations some females may have horns too (4) (pers). The black-edged ears have white parts that catch attention when flicked (2). Numerous subspecies of the klipspringer have been described, but only one is recognised as valid for the purpose of assessing its conservation status: the western klipspringer (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

MammalMAP

MAD MAMMAL MONDAY

Today’s Monday post is about klipspringer also known as one of the tiny ten antelope’s in Southern Africa. The name Klipspringer is the Afrikaans for ‘rock jumper’ and alludes to the animal’s ability in rocky territory where it can be seen moving freely, seemingly on tiptoe. It can be found in the following areas in Southern Africa, Zoutpansberg and Lebombo mountain ranges and foothills, along the Kuiseb River in the Namib Desert, lower Orange River, and common in the mountain areas of the Western Cape. Less common in the Drakensberg mountain range. The klipspringer is a small species of African antelope and its scientific name is Oreotragus oreotragus.

Its appearance is about 11 – 13 kg with the females being slightly larger than the males. Males have horns, they standing 500 – 600mm high at shoulders this is the small and stocky antelopes. Known for their remarkable jumping ability, klipspringers live singly or in life-long monogamous relationships in which pairs spend most of their time within a few meters of each other. The males are fiercely territorial. Diet consists of the selective browsing of flowers, tender green shoots and fruits of a wide variety of shrubs and herbs. Hardly ever feeds on grass. Not dependent on drinking water.

Klipspringers have specially adapted hoofs for living in their rocky territories. They stand, walk, leap, and land on their tiny hoof tips like ballerinas constantly on tip toe. Their hooves are the consistency of hard rubber, absorbing the shock of their huge leaps. Klipspringers have remarkable dense, coarse coats consisting of hollow hairs that rustle when shaken or touched. This unique quality hair helps to cushion their bodies from any abrasion from sharp rocks.

The klipspringer is mainly active during the early morning and late afternoon, resting during the hottest part of the day among rocks or beneath overhangs. Their remarkable agility among the steep rocks of native kopjes can be attributed to a set of unique feet. The strong back legs can project the klipspringer up a smooth wall, and they can jump onto a projection the size of a silver dollar with all four feet. Pairs have exclusive territories of 8-49 hectares in size, which they defend fiercely, and rarely leave. Both sexes are involved in marking with their preorbital glands. A sentinel, or watcher, is posted at all times within the group, and this animal is responsible for the safety of the group. When alarmed, the sentinel emits a shrill whistle to alert the other animals, at which they head for cover.
For more info go to www.krugerpark.co.za/africa_klipspringer.htm or http://www.sanbona.com/propertyblogarticle.asp?id=156 and don't forget to check our blog at www.mammalmap.blog.com

  • Marco Fitchet
Creative Commons Attribution 3.0 (CC BY 3.0)

© MammalMAP

Supplier: MammalMAP

Unreviewed

Article rating from 1 person

Average rating: 1.0 of 5

Distribution

Range Description

The Klipspringer has a wide distribution from north-eastern Sudan, Eritrea, northern Somalia and the Ethiopian Highlands southwards through East and southern Africa to South Africa, and along the west coast in Namibia and south-western Angola. Isolated populations occur in the Central African Republic (two separate areas in the northern and western uplands) and south-eastern DR Congo (East 1999; Roberts in press). In Nigeria, they occur in and around the Jos Plateau (East 1999), and also in the east in the Gashaka-Gumpti N. P. (Nicholas 2004). The only country in which they formerly occurred, but are now probably extinct, is Burundi.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The klipspringer occurs in isolated populations from Ethiopia to the tip of South Africa.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs from north-east to southern Africa, with a few isolated populations in central Africa. The western klipspringer is found in Nigeria and the Central African Republic (6)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Klipspringers are small, stocky bovids. The males have wide-set, spike-like horns averaging 10cm long. Males and females have preorbital glands, males have preputial glands, and neither sex has hoof glands. The coat is thick and dense; the individual hairs are loosely connected to the skin and are hollow. This hair type is unique among bovids and otherwise found only in pronghorns and the white tailed deer. Females are slightly larger than males (Female height: 50-53cm; Male height: 49-52cm).

Range mass: 8.9 to 18 kg.

Average mass: 11 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Klipspringers are dependent on rocky and mountainous terrain, occurring up to 4,380 m in the Ethiopian Highlands (Yalden et al. 1996). The Rift Valleys and the Southern African escarpments provide extensive suitable habitat and are central to its distribution. Klipspringers are primarily browsers.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Klipspringers live in steep, rocky terrain and are most common in mountain ranges and gorges of major rivers. They are abundant in suitable habitat (as many as 45 animals per square kilometer), but they are patchily distributed among outcroppings of rock.

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Klipspringers inhabit rocky, stony ground with abundant short vegetation (2), from coastal hills up to elevations of 4,500 metres (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Klipspringers are selective browsers. They prefer lush evergreen shrubs and herbs but will eat fruit, seed pods, flowers and lichens. They will leave their home ranges to forage on new grass shoots. They drink when water is available but they generally get water from their food.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
12.1 years.

Average lifespan

Status: captivity:
15.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25.9 years (captivity) Observations: One specimen lived 25.9 years at Frankfurt Zoo (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction varies with geography. Breeding is seasonal in Ethiopia, perennial in Zambia, and varies locally in Cape Province. Females give birth to one young after a seven month gestation period. Young are born in a protected rocky recess and remain hidden for 2-3 months. Young join the parents after 2-3 months and are weaned after 4-5 months. Horns begin to develop at 6 months and are fully grown at 17-18 months. Young reach adult size after one year.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 7 to 7.5 months.

Range weaning age: 4 to 5 months.

Average birth mass: 1130 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oreotragus oreotragus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGTTGACTATTCTCAACTAACCATAAAGATATCGGTACCCTATACCTTCTATTTGGTGCCTGAGCTGGCATGGTAGGAACCGCCCTAAGCTTACTAATTCGCGCTGAACTAGGCCAGCCAGGAACGTTACTCGGAGACGACCAGATTTATAACGTAATTGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTTATGCCCATTATAATTGGGGGATTTGGTAACTGACTAGTTCCTCTGATAATTGGTGCTCCTGATATAGCATTCCCTCGAATAAATAACATAAGTTTTTGACTCCTTCCTCCCTCCTTCTTGCTACTCCTAGCATCCTCTATAGTCGAAGCTGGGGCAGGAACTGGCTGAACCGTCTATCCCCCTCTCGCAGGCAATCTAGCCCATGCAGGAGCCTCCGTGGATTTAACCATTTTCTCTTTGCACTTGGCAGGTGTCTCCTCAATTCTAGGAGCTATCAATTTTATTACAACAATCATCAATATAAAACCCCCTGCAATATCACAATATCAAACACCCCTGTTTGTTTGATCAGTACTTATCACTGCAGTATTATTACTTCTGTCACTCCCAGTACTAGCTGCCGGCATTACAATACTACTAACAGACCGAAACCTAAACACAACCTTCTTTGATCCAGCAGGAGGAGGAGATCCTATCCTTTATCAACATCTATTCTGATTTTTCGGACACCCAGAAGTCTATATTCTCATTTTACCAGGGTTTGGAATAATCTCCCACATTGTAACCTATTATTCTGGAAAAAAGGAACCATTTGGGTACATGGGAATAGTATGGGCTATAATATCAATCGGATTTCTAGGGTTTATTGTATGAGCCCACCACATGTTCACAGTTGGTATAGACGTAGACACACGAGCCTACTTTACATCAGCTACCATAATTATTGCCATTCCAACTGGAGTGAAAGTCTTTAGCTGACTAGCTACACTTCACGGAGGTAACATTAAATGATCTCCTGCCATGATATGAGCCCTAGGCTTCATTTTCCTATTTACAGTTGGGGGATTAACTGGCATTGTTCTGGCCAACTCCTCTCTTGACATTGTCCTTCATGACACATACTATGTAGTAGCACATTTTCACTATGTATTATCTATAGGAGCCGTTTTTGCCATTATAGGGGGCTTTGTGCACTGATTTCCACTATTCTCAGGATATACCCTTAACACTACATGAGCCAAAATTCACTTCGCAATTATATTTGTAGGTGTAAACATGACCTTCTTCCCGCAACATTTCCTAGGACTTTCCGGTATGCCACGACGATACTCTGATTATCCAGACGCATATACGATGTGAAATACTATCTCATCTATAGGCTCATTTATCTCACTTACAGCAGTAGTACTAATAATTTTTATTATCTGAGAAGCATTTGCATCTAAACGAGAAGTTATAACCGTTGACCTGACAACAACAAACCTAGAATGACTAAATGGATGCCCTCCACCATATCATACATTTGAAGAACCCACATATGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oreotragus oreotragus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the total population has been estimated at more than 40,000, 25% of which were in protected areas. Populations in many protected areas and on private land were considered stable, and substantial numbers occurred in unprotected but inaccessible habitat. This species’ conservation status should not change and its future should be secure as long as it continues to receive active protection in national parks and equivalent reserves, hunting concessions and private farmland. It should also continue to survive in substantial numbers in extensive, inaccessible areas of unprotected habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Because they are patchily distributed in isolated populations, klipspringers have differentiated into distinct populations, several of which are threatened. The most severely threatened population is the Nigerian subspecies O. o. porteousi. Other populations, especilly those in Ethiopia, are thriving.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1). Subspecies: Oreotragus oreotragus porteousi (western klipspringer) is classified as Endangered (EN) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Klipspringer can reach relatively high population densities within continuous areas of favourable habitat, e.g., 10.0-14.0/km² in a 9.6 km² area of escarpment, ridge top and gorge in Simien Mountains National Park (Ethiopia). More typically, the Klipspringer’s habitat is discontinuous within a given area and its abundance is closely related to the extent of suitable rocky terrain. Its overall population density is frequently in the range 0.01-0.1/km² in protected areas within which it is common in restricted areas of suitable habitat. Higher densities occur in areas with more extensive Klipspringer habitat, e.g., 0.15-0.30/km² in Lengwe (Malawi) and Karoo, Mountain Zebra and Royal Natal National Parks and Giant’s Castle Game Reserve (South Africa) (various authors in East 1999).

East (1999) produced a total population estimate of about 42,000 animals, which is probably conservative. Population trend is stable in many protected areas and on private land, but tending to decrease in areas where small, isolated populations are subjected to uncontrolled hunting and competition with livestock. The numbers of the western klipspringer are unknown but are unlikely to exceed a few thousand at most, in view of its very restricted distribution. This subspecies’ population is probably decreasing, at least in Nigeria.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no obvious major threats to Klipspringers across their range. Their habitat is of little value to humans and it persists outside protected areas in regions where subsistence hunting pressure is not intense. The Klipspringer’s adaptation to the inaccessible hillsides and cliffs in these areas enables it to avoid most competition from domestic herds. Small, isolated populations within relatively small areas of rocky habitat are more vulnerable to hunting and competition from goats, and many of these populations have been eliminated in settled regions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Klipspringers are vulnerable to both hunting and competition from goats. These threats have resulted in populations in some areas being eliminated and others, particularly in agricultural regions, becoming rare (2) (6). Consequently, the western klipspringer in Nigeria and the Central African Republic has been classified as Endangered by the IUCN (1) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
About one-quarter of the population occurs in protected areas, including: Simien and Bale Mountains (Ethiopia), Tsavo (Kenya), North and South Luangwa (Zambia), Nyika (Malawi), Namib-Naukluft (Namibia) and Matobo (Zimbabwe). It occurs in lesser numbers in a large number of other protected areas throughout its range which contain smaller areas of suitable habitat. Very large numbers survive on private farmland in Namibia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The klipspringer has been classified as Lower Risk / Conservation Dependent because its future depends on its continued protection in many National Parks, reserves, hunting concessions and private farmland (1) (6), such as Serengeti National Park in Tanzania, a World Heritage Site (7). Large populations in very inaccessible areas are also believed to be fairly secure. However, the western klipspringer subspecies is at risk of extinction if no attempts are made to implement protective measures or begin a captive breeding programme (6), and so conservation measures are urgently required to save this distinctive and fascinating antelope.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Klipspringers may be a host to the tse-tse fly, which can carry African sleeping sickness.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

These agile, charming animals serve to attract tourists and hunters.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Klipspringer

The klipspringer (Oreotragus oreotragus) is a small species of African antelope.

Name[edit]

The word klipspringer literally means "rock jumper" in Afrikaans. The klipspringer is also known colloquially as a mvundla (from the Xhosa umvundla, meaning "rabbit").

Distribution and habitat[edit]

The klipspringer lives from the Cape of Good Hope, where it is found in mountain fynbos, through the rest of Southern Africa, where it is found in rocky koppies in woodland and savanna, north to East Africa and into the highly mountainous highlands of Ethiopia.

Description[edit]

A pair of klipspringers

Reaching approximately 58 cm (22 inches) at the shoulder, klipspringers are smaller than most other antelopes. They stand on the tips of their hooves and can fit all four hooves on a piece of cliff the size of a Canadian dollar coin (Loonie), roughly 30 mm in diameter. Male klipspringer horns are usually about 10–15 cm (4–6 inches) long. Female klipspringers in eastern African populations also have horns.

With a thick and dense, speckled "salt and pepper" patterned coat of an almost olive shade, klipspringers blend in well with the koppies (rock outcrops) on which they can usually be found. However, their agility on rocks and crags is so extreme that their most dangerous enemies are eagles and humans, so camouflage is not as important to them as to most other antelope.

Predators[edit]

Klipspringers are preyed upon by leopards, caracals, eagles and humans.

Diet[edit]

Klipspringers are herbivores, eating plants growing in mountainous habitats and rocky terrain. They never need to drink, since the succulents they consume provide them with enough water to survive.

Behaviour[edit]

Klipspringers form breeding pairs rather than herds. The pairs mate for life and will spend most of their lives in close proximity to each other. When one klipspringer is eating, the other will assume lookout duty, helping to keep the pair aware of any predators.

The mating season for klipspringers is from September through January. The gestation period is about 214 days.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!