Overview

Brief Summary

Biology

Klipspringers are monogamous animals that are nearly always seen in pairs, usually with one offspring. The bond between a male and female is strong and enduring; they spend most of their time within a few metres of each other with one being look-out while the other feeds, and this relationship usually lasts until one dies (3). Together the pair defends a territory in which they feed on herbs and low foliage, sometimes seeds, fruits, buds, twigs and bark, and grasses in the wet season (2) (3). Occasionally groups of eight or more klipspringers may be seen, but these quickly split back into family groups when disturbed (3). Like many animals that live in Africa's hot climate, klipspringers generally rest during the heat of the day, and are also generally inactive after midnight (2). The gestation period of the klipspringer is 210 days (4), after which a well-developed young is born. The young hides in vegetation for up to three months, while its mother visits three or four times a day for suckling (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This fascinating small antelope has a number of distinct features that make it well adapted to its rugged, rocky habitat (3). It is unique amongst the antelope for walking on the tips of its hooves and it has a remarkable dense, coarse coat consisting of hollow hairs that rustle when shaken or touched (2) (3). When the klipspringer is hot or sick its fur stands erect, giving the illusion of being much larger than it actually is (2). The coat varies in colour from yellow-brown to grey-yellow, with whitish underparts, chin and lips (4). In most areas only the males have horns, which are short, widely-spaced apart and ringed near the base; in the Ethiopian, Ugandan and Tanzanian populations some females may have horns too (4) (pers). The black-edged ears have white parts that catch attention when flicked (2). Numerous subspecies of the klipspringer have been described, but only one is recognised as valid for the purpose of assessing its conservation status: the western klipspringer (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

MammalMAP

MAD MAMMAL MONDAY

Today’s Monday post is about klipspringer also known as one of the tiny ten antelope’s in Southern Africa. The name Klipspringer is the Afrikaans for ‘rock jumper’ and alludes to the animal’s ability in rocky territory where it can be seen moving freely, seemingly on tiptoe. It can be found in the following areas in Southern Africa, Zoutpansberg and Lebombo mountain ranges and foothills, along the Kuiseb River in the Namib Desert, lower Orange River, and common in the mountain areas of the Western Cape. Less common in the Drakensberg mountain range. The klipspringer is a small species of African antelope and its scientific name is Oreotragus oreotragus.

Its appearance is about 11 – 13 kg with the females being slightly larger than the males. Males have horns, they standing 500 – 600mm high at shoulders this is the small and stocky antelopes. Known for their remarkable jumping ability, klipspringers live singly or in life-long monogamous relationships in which pairs spend most of their time within a few meters of each other. The males are fiercely territorial. Diet consists of the selective browsing of flowers, tender green shoots and fruits of a wide variety of shrubs and herbs. Hardly ever feeds on grass. Not dependent on drinking water.

Klipspringers have specially adapted hoofs for living in their rocky territories. They stand, walk, leap, and land on their tiny hoof tips like ballerinas constantly on tip toe. Their hooves are the consistency of hard rubber, absorbing the shock of their huge leaps. Klipspringers have remarkable dense, coarse coats consisting of hollow hairs that rustle when shaken or touched. This unique quality hair helps to cushion their bodies from any abrasion from sharp rocks.

The klipspringer is mainly active during the early morning and late afternoon, resting during the hottest part of the day among rocks or beneath overhangs. Their remarkable agility among the steep rocks of native kopjes can be attributed to a set of unique feet. The strong back legs can project the klipspringer up a smooth wall, and they can jump onto a projection the size of a silver dollar with all four feet. Pairs have exclusive territories of 8-49 hectares in size, which they defend fiercely, and rarely leave. Both sexes are involved in marking with their preorbital glands. A sentinel, or watcher, is posted at all times within the group, and this animal is responsible for the safety of the group. When alarmed, the sentinel emits a shrill whistle to alert the other animals, at which they head for cover.
For more info go to www.krugerpark.co.za/africa_klipspringer.htm or http://www.sanbona.com/propertyblogarticle.asp?id=156 and don't forget to check our blog at www.mammalmap.blog.com

Creative Commons Attribution 3.0 (CC BY 3.0)

© MammalMAP

Supplier: MammalMAP

Unreviewed

Article rating from 1 person

Average rating: 1.0 of 5

Distribution

Klipspringers (Oreotragus oreotragus) have a fairly patchy distribution due to their specific habitat requirements. Klipspringers range from north-eastern Sudan, Eritera, northern Somalia, and the Ethiopian Highlands to east and south Africa, including the west coast of Namibia and south-western Angola.

Klipspringers avoid populated areas, such as the Cape Peninsula and parts of the Karoo. Otherwise, they are common in unprotected areas where settlement has not occurred and livestock is not present. They particularly have large populations in protected parks such as: Tsavo National Park (Kenya), Nyika National Park (Malawi), the Namib-Naukluft National Park (Namibia), and Matobo National Park (Zimbabwe).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Klipspringer has a wide distribution from north-eastern Sudan, Eritrea, northern Somalia and the Ethiopian Highlands southwards through East and southern Africa to South Africa, and along the west coast in Namibia and south-western Angola. Isolated populations occur in the Central African Republic (two separate areas in the northern and western uplands) and south-eastern DR Congo (East 1999; Roberts in press). In Nigeria, they occur in and around the Jos Plateau (East 1999), and also in the east in the Gashaka-Gumpti N. P. (Nicholas 2004). The only country in which they formerly occurred, but are now probably extinct, is Burundi.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs from north-east to southern Africa, with a few isolated populations in central Africa. The western klipspringer is found in Nigeria and the Central African Republic (6)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Klipspringer are small antelope weighing between 8 and 18 kg with females weighing slightly more than males (male average: 10.6 kg; female average: 13.2 kg). The total length of klipspringers is between 8 and 10 cm with females being slightly longer than males (male average: 86.2 cm; female average: 90.5 cm). Heights of klipspringer are more variable, ranging from 43 to 51 cm.

Klipspringers are stocky antelopes with a short neck and body, and large hindquarters, which help it jump from rock to rock. Their ears are rounded and large, and their tails are small and rudimentary. Their hoof structure is unique because the last joints of the digits are rotated so klipspringers can walk on the tips of their hooves. Walking wears down the hooves giving them a cylindrical shape, which is suitable for a lifestyle on the rocks. Klipspringers secrete pheromones from their preorbital glands, which are narrow black slits found in the corner of their eyes. The scent glands are more developed in males than females.

Like other African antelope, the hairs of the klipspringer are hollow and smoothed flat. Their hair assists with the reflection of radiant heat, provides insulation from thermal extremes, reduces moisture loss, and protects them from injuries. In general, their hair has a springy texture and varies between 15 to 28 mm in length.

The color of the klipspringer results from the pigmented tips of their guard hairs. Individual hairs are light at the base and darken to a yellow-brown near the tips. Overall, klipspringer coat color varies with origin. The color is yellow and speckled with brown in the subspecies, O. o. oreotragus, bright golden-yellow in O. o. transvaalensis, and greyer and more dull in O. o. stevensoni. The underside of their body, their chin, and the area surrounding their lips are white. Their tails are the same colors as the upper side of the body, but lighter underneath. The top of their heads are darker, whereas the sides of their faces are lighter. The back of klipspringer ears is sparsely covered with black hairs, whereas the inner ear is extensively covered with long white hairs. The lower portions of their hooves are white with a black band immediately above their hooves, extending slightly upwards on the forelimbs and up to the ankle joints of the hind limbs.

There is very little information regarding the skull or dental features of klipspringers. A skull from northern Nigeria had a greater width, 3.25 inches in diameter across the orbits, compared to a skull found in East Africa, 2.94 inches in diameter across the orbits. This suggests that klipspringer skulls vary by region or subspecies. There are no specific records of klipspringer dental formulas. However a generalized antelopes, cattle, gazelles, goats, sheep, and relatives dental formula is the following: incisors 0/3, canines 0/1, premolars 3/2-3, and molars 3/3 equaling 30-32.

Within South Africa, only the males have horns, whereas both males and females of one subspecies (O. o. schillings) have horns in the eastern regions of Africa (Kenya and Tanzania). The latter could be the result of greater competitive interactions in the east. In general, the horns are short, straight spikes that are only ringed near the base. Horns start to grow after 4 months, protrude from the top of the head after 5.5 to 6 months, and reach adult size after 17 to 18 months. The average length of a horn is 10 cm, with a record length of 16.2 cm (Ward 1998 as cited in Skinner and Chimimba 2005).

Range mass: 8 to 18 kg.

Range length: 8 to 10 cm.

Sexual Dimorphism: female larger; ornamentation

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Klipspringers are restricted to rocky habitat including rocky hills or outcrops, koppies, and gorges with rocky sides. They can be found on rocky mountains as high as 4000 meters tall. Klipspringers will also travel up to 10 km along flat land between isolated koppies.

Range elevation: 4000 (high) m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Klipspringers are dependent on rocky and mountainous terrain, occurring up to 4,380 m in the Ethiopian Highlands (Yalden et al. 1996). The Rift Valleys and the Southern African escarpments provide extensive suitable habitat and are central to its distribution. Klipspringers are primarily browsers.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Klipspringers inhabit rocky, stony ground with abundant short vegetation (2), from coastal hills up to elevations of 4,500 metres (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Klipspringers feed primarily during the early morning and late afternoon, and for brief periods throughout the day. They will spend between 15 and 41 percent of their day feeding.

When klipspringers feed, one of the group members stands and remains vigilant. The male is typically the member to stand guard as the female requires greater time to feed and accumulate energy for lactation. Alternatively, the female leads the group from one feeding area to the next, which is likely due to her high food demands. During feeding, klipspringers never stand and forage in one place, but rather move from plant to plant. They have a narrow muzzle which helps them selectively browse on plant parts. In some cases, klipspringers will stand on their back legs to reach specific fruits or flowers.

Klipspringer energy requirements per unit body mass are higher than larger antelope due to its small size and high metabolic rate. Klipspringers cannot consume excessive amounts of food because their stomachs are small; therefore, they selectively browse on highly nutritious plants. Klipspringers are frugivores and folivores, feeding primarily on the fruits and flowers of plants such as rock false candlewood (Maytenus oleoides), large sour-plum (Ximenia caffra), kudu berry (Pseudolachnostylis maprouneifolia), kuni bush (Rhus undulata), Aspalathus hirta, velvet bush-willow (Combretum molle), and horn –pod (Dichrostachys cinerea). In fact, fruits and flowers make up approximately two thirds of klipspringer diets. In general, klipspringers will not feed on grasses even when the young shoots are available for consumption. However, when it is winter or conditions are dry, klipspringers will eat more leaves because nutritious plants are not abundant.

Klipspringers consume very little water because they live in an arid habitat. They attain most of their water from their food or from the dew accumulated on vegetation. Klipspringers will occasionally feed on succulents with thick fleshy leaves or stems for their water, but not for their nutritional content. When water is available, they will drink from temporary pools, waterholes and streams.

Plant Foods: leaves; fruit; flowers

Primary Diet: herbivore (Folivore , Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ectoparasites attach to the pelage of klipspringers, but can be removed through autogrooming. Birds, such as red-winged starlings and yellow-billed bulbuls, glean ectoparasites from the body and the preorbital glands of klipspringers. The birds benefit from a food source, while the klipspringers benefit from reduced parasite loads.

Ticks (Ixodes (Afrixodes) matopi) are found on the scent gland secretions of klipspringers. The tick will remain on a marked twig and will parasitize a klipspringer when it comes back to remark the twig.

Mutualist Species:

  • red-winged starlings (Onycohnthus morio)
  • yellow-billed bulbuls (Criniger phaeocephalus)

Commensal/Parasitic Species:

  • Ixodes (Afrixodes) matopi

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

If a predator is far away and is not considered an immediate threat, klipspringers will be attentive and face their predator. If klipspringers are found in a low-visibility situation, they will move to higher ground so that they can see the potential danger. If the predator keeps still, klipspringers will eventually become relaxed.

Klipspringers are more vulnerable to predation compared to other African antelope (e.g. duikers and bushbucks) because they live in an open habitat. Despite this, klipspringers can outrun many of their predators; therefore, the predators must rely on surprise. Leopards and caracals are considered the primary predators of klipspringers, because they show the greatest overlap with their distribution. Specifically, leopards are prominent in rocky terrain, whereas caracals are common in the koppie terrain. Other klipspringer predators include spotted hyenas, common jackals, wildcats, Simien foxes, hamadryas baboons, and eagles (e.g., Verreaux’s eagles, tawny eagles, and martial eagles).

When a predator is a threat, klipspringers will react initially by freezing. If the predator approaches, a single klipspringer will emit a loud alarm call, which can be heard from 0.7 km away. The call consists of a trumpet-like whistle that is exhaled through the nostrils. After emitting a call, the klipspringers will run 30 to 50 meters towards higher ground with the male bringing up the rear. After reaching a safe distance, the male and female will turn towards the predator and continue to emit alarm calls in duet with the male’s call shortly followed by the female’s call. It has been suggested that alarm calls are emitted to communicate the klipspringer’s awareness to its predator rather than alert other klipspringers.

Known Predators:

  • leopards (Panthera pardus)
  • caracals (Caracal caracal)
  • spotted hyenas (Crocuta crocuta)
  • common jackals (Canis aureus aureus)
  • wildcats (Felis silvestris)
  • Simien foxes (Canis simensis)
  • hamadryas baboons (Papio hamadryas)
  • Verreaux’s eagles (Aquila verreauxii)
  • tawny eagles (Aquila rapax)
  • martial eagles (Polemaetus bellicosus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Male and female pair bond relationships might be an adaptive trait allowing greater vigilance in open habitats. Although klipspringers remain in close proximity and are aware of each other’s behaviours and locations, actual contact between members is quite rare. The median distance between a pair of klipspringers was recorded to be 2 meters. Instead of mutual grooming, alarm calling in duet and territorial markings are important in maintaining pair bond relationships.

Klipspringers deposit feces around territory boundaries to mark their territories from conspecifics. More commonly, klipspringers scent mark by inserting bare twigs or grass pieces into their preorbital cavities, which leaves behind 4 to 6 mm smears of a black, glandular substance. Klipspringers will re-visit their scent-markings every seven days, which corresponds with the amount of time the scent remains detectable. Both sexes mark territories through scent marking, but the male usually follows the female to remark the areas she has visited. This scent marking behavior enforces pair bonding and reinforces territorial markings.

Communication Channels: acoustic ; chemical

Other Communication Modes: duets ; scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

A klipspringer in captivity was recorded to live up to 17 years and 10 months. There are no lifespan records for klipspringers occurring in the wild.

Range lifespan

Status: captivity:
18 (high) years.

Average lifespan

Status: captivity:
12.1 years.

Average lifespan

Status: captivity:
15.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25.9 years (captivity) Observations: One specimen lived 25.9 years at Frankfurt Zoo (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Klipspringers are found solitary, in monogamous pairs, or as a family group with a male, female, and their offspring. The average group size is 2.6 individuals.

Little has been published describing the act of mating, but males have been observed closely following females while occasionally lifting their forelegs. The male might also make low humming calls and arch its neck as a display of dominance. Mutual nibbling of the preorbital glands has also been observed in zoos (Walther 1972a as cited in Estes 1991).

Mating System: monogamous

Female klipspringers will give birth to a single offspring every 16 months. Their breeding season tends to occur between August and September, but can also be variable based on local conditions. Once copulation occurs, the fetus is implanted in the right uterine horn of the female. The gestation period is about 6 months. A single young is born (weight approximately 1 kg) during the spring or summer in the shelter of rocks and vegetation. Young animals remain hidden for the first 2 to 3 months after birth and nurse for approximately 3 to 4 months from their mothers' inguinal mammae. Young are weaned after 4 to 5 months and reach sexual maturity after 7 months. After approximately 1 year, young reach adult size. Males will leave their group earlier (approximately 6 months after birth) to establish new territories, whereas females can remain in a group up to 10 or 11 months.

Breeding interval: Klipspringers breed every 16 months.

Breeding season: Klipspringers typically mate between August and September.

Average number of offspring: 1.

Average gestation period: 6 months.

Average weaning age: 4.5 months.

Average time to independence: male: 6 months; female: 10 to11 months.

Average age at sexual or reproductive maturity (female): 7 months.

Average age at sexual or reproductive maturity (male): 7 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 1130 g.

Average gestation period: 196 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Klipspringers are precocial at birth. They therefore do not require much attention from their mother, and especially not from their father. However, the father can indirectly assist its young by defending their territory from predators and potential competitors.

In a zoo, a female was observed drawing attention away from her hidden fawn when another klipspringer approached. When the female sensed the danger was gone, she went to lick her young. If the young tried to stand upright, the female would push it down into a safe area. During the day, the female would associate with the other klipspringers and occasionally go feed her hidden fawn. During the night, the other klipspringers slept in the open, while the lactating female rested beside her fawn. The male of the offspring was aggressive to any klipspringer that approached his hidden fawn. However, no parental aggression towards the offspring has ever been recorded. After three months, the young was associated with the klipspringer group.

Parental Investment: precocial ; female parental care ; pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oreotragus oreotragus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGTTGACTATTCTCAACTAACCATAAAGATATCGGTACCCTATACCTTCTATTTGGTGCCTGAGCTGGCATGGTAGGAACCGCCCTAAGCTTACTAATTCGCGCTGAACTAGGCCAGCCAGGAACGTTACTCGGAGACGACCAGATTTATAACGTAATTGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTTATGCCCATTATAATTGGGGGATTTGGTAACTGACTAGTTCCTCTGATAATTGGTGCTCCTGATATAGCATTCCCTCGAATAAATAACATAAGTTTTTGACTCCTTCCTCCCTCCTTCTTGCTACTCCTAGCATCCTCTATAGTCGAAGCTGGGGCAGGAACTGGCTGAACCGTCTATCCCCCTCTCGCAGGCAATCTAGCCCATGCAGGAGCCTCCGTGGATTTAACCATTTTCTCTTTGCACTTGGCAGGTGTCTCCTCAATTCTAGGAGCTATCAATTTTATTACAACAATCATCAATATAAAACCCCCTGCAATATCACAATATCAAACACCCCTGTTTGTTTGATCAGTACTTATCACTGCAGTATTATTACTTCTGTCACTCCCAGTACTAGCTGCCGGCATTACAATACTACTAACAGACCGAAACCTAAACACAACCTTCTTTGATCCAGCAGGAGGAGGAGATCCTATCCTTTATCAACATCTATTCTGATTTTTCGGACACCCAGAAGTCTATATTCTCATTTTACCAGGGTTTGGAATAATCTCCCACATTGTAACCTATTATTCTGGAAAAAAGGAACCATTTGGGTACATGGGAATAGTATGGGCTATAATATCAATCGGATTTCTAGGGTTTATTGTATGAGCCCACCACATGTTCACAGTTGGTATAGACGTAGACACACGAGCCTACTTTACATCAGCTACCATAATTATTGCCATTCCAACTGGAGTGAAAGTCTTTAGCTGACTAGCTACACTTCACGGAGGTAACATTAAATGATCTCCTGCCATGATATGAGCCCTAGGCTTCATTTTCCTATTTACAGTTGGGGGATTAACTGGCATTGTTCTGGCCAACTCCTCTCTTGACATTGTCCTTCATGACACATACTATGTAGTAGCACATTTTCACTATGTATTATCTATAGGAGCCGTTTTTGCCATTATAGGGGGCTTTGTGCACTGATTTCCACTATTCTCAGGATATACCCTTAACACTACATGAGCCAAAATTCACTTCGCAATTATATTTGTAGGTGTAAACATGACCTTCTTCCCGCAACATTTCCTAGGACTTTCCGGTATGCCACGACGATACTCTGATTATCCAGACGCATATACGATGTGAAATACTATCTCATCTATAGGCTCATTTATCTCACTTACAGCAGTAGTACTAATAATTTTTATTATCTGAGAAGCATTTGCATCTAAACGAGAAGTTATAACCGTTGACCTGACAACAACAAACCTAGAATGACTAAATGGATGCCCTCCACCATATCATACATTTGAAGAACCCACATATGTTAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oreotragus oreotragus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

According to the International Union for Conservation of Nature (IUCN) list of threatened species, klipspringers are considered to be of ‘least concern’ with a population estimated at approximately 40,000.

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the total population has been estimated at more than 40,000, 25% of which were in protected areas. Populations in many protected areas and on private land were considered stable, and substantial numbers occurred in unprotected but inaccessible habitat. This species’ conservation status should not change and its future should be secure as long as it continues to receive active protection in national parks and equivalent reserves, hunting concessions and private farmland. It should also continue to survive in substantial numbers in extensive, inaccessible areas of unprotected habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1). Subspecies: Oreotragus oreotragus porteousi (western klipspringer) is classified as Endangered (EN) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The Klipspringer can reach relatively high population densities within continuous areas of favourable habitat, e.g., 10.0-14.0/km² in a 9.6 km² area of escarpment, ridge top and gorge in Simien Mountains National Park (Ethiopia). More typically, the Klipspringer’s habitat is discontinuous within a given area and its abundance is closely related to the extent of suitable rocky terrain. Its overall population density is frequently in the range 0.01-0.1/km² in protected areas within which it is common in restricted areas of suitable habitat. Higher densities occur in areas with more extensive Klipspringer habitat, e.g., 0.15-0.30/km² in Lengwe (Malawi) and Karoo, Mountain Zebra and Royal Natal National Parks and Giant’s Castle Game Reserve (South Africa) (various authors in East 1999).

East (1999) produced a total population estimate of about 42,000 animals, which is probably conservative. Population trend is stable in many protected areas and on private land, but tending to decrease in areas where small, isolated populations are subjected to uncontrolled hunting and competition with livestock. The numbers of the western klipspringer are unknown but are unlikely to exceed a few thousand at most, in view of its very restricted distribution. This subspecies’ population is probably decreasing, at least in Nigeria.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no obvious major threats to Klipspringers across their range. Their habitat is of little value to humans and it persists outside protected areas in regions where subsistence hunting pressure is not intense. The Klipspringer’s adaptation to the inaccessible hillsides and cliffs in these areas enables it to avoid most competition from domestic herds. Small, isolated populations within relatively small areas of rocky habitat are more vulnerable to hunting and competition from goats, and many of these populations have been eliminated in settled regions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Klipspringers are vulnerable to both hunting and competition from goats. These threats have resulted in populations in some areas being eliminated and others, particularly in agricultural regions, becoming rare (2) (6). Consequently, the western klipspringer in Nigeria and the Central African Republic has been classified as Endangered by the IUCN (1) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
About one-quarter of the population occurs in protected areas, including: Simien and Bale Mountains (Ethiopia), Tsavo (Kenya), North and South Luangwa (Zambia), Nyika (Malawi), Namib-Naukluft (Namibia) and Matobo (Zimbabwe). It occurs in lesser numbers in a large number of other protected areas throughout its range which contain smaller areas of suitable habitat. Very large numbers survive on private farmland in Namibia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The klipspringer has been classified as Lower Risk / Conservation Dependent because its future depends on its continued protection in many National Parks, reserves, hunting concessions and private farmland (1) (6), such as Serengeti National Park in Tanzania, a World Heritage Site (7). Large populations in very inaccessible areas are also believed to be fairly secure. However, the western klipspringer subspecies is at risk of extinction if no attempts are made to implement protective measures or begin a captive breeding programme (6), and so conservation measures are urgently required to save this distinctive and fascinating antelope.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Due to klipspringer preference for rocky habitat, they are seldom viewed as a problem species; however, they will occasionally browse on growing fruit buds in vineyards, orchards, and plantations across South Africa. At times, farmers will send in permits for permission to shoot problematic klipspringers.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the past, settlers used klipspringer hair to stuff and cushion saddles.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Klipspringer

The klipspringer (Oreotragus oreotragus) is a small species of African antelope.

Name[edit]

The word klipspringer literally means "rock jumper" in Afrikaans. The klipspringer is also known colloquially as a mvundla (from the Xhosa umvundla, meaning "rabbit").

Distribution and habitat[edit]

The klipspringer lives from the Cape of Good Hope, where it is found in mountain fynbos, through the rest of Southern Africa, where it is found in rocky koppies in woodland and savanna, north to East Africa and into the highly mountainous highlands of Ethiopia.

Description[edit]

A pair of klipspringers

Reaching approximately 58 cm (22 inches) at the shoulder, klipspringers are smaller than most other antelopes. They stand on the tips of their hooves and can fit all four hooves on a piece of cliff the size of a Canadian dollar coin (Loonie), roughly 30 mm in diameter. Male klipspringer horns are usually about 10–15 cm (4–6 inches) long. Female klipspringers in eastern African populations also have horns.

With a thick and dense, speckled "salt and pepper" patterned coat of an almost olive shade, klipspringers blend in well with the koppies (rock outcrops) on which they can usually be found. However, their agility on rocks and crags is so extreme that their most dangerous enemies are eagles and humans, so camouflage is not as important to them as to most other antelope.

Predators[edit]

Klipspringers are preyed upon by leopards, caracals, eagles and humans.

Diet[edit]

Klipspringers are herbivores, eating plants growing in mountainous habitats and rocky terrain. They never need to drink, since the succulents they consume provide them with enough water to survive.

Behavior[edit]

Klipspringers form breeding pairs rather than herds. The pairs mate for life and will spend most of their lives in close proximity to each other. When one klipspringer is eating, the other will assume lookout duty, helping to keep the pair aware of any predators.

The mating season for klipspringers is from September through January. The gestation period is about 214 days.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!