Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Comprehensive Description

Description

Gymnopis multiplicata reaches a body length of up to 500mm. The eye is covered by skin and bone, and can not be seen. The tentacle lies anterior to the eye. Teeth are monocuspid, slightly recurved, slightly arrow head shaped, and diminish in height posteriorly. Splenial teeth are present. The number of teeth increases slowly with age. The vent, is simple, transverse and lobed, and the male intromittent organ has 8-10 elongate lobes and appears fluted when everted. There are mineralized denticles embedded in the annuli of the dermal scales. There are 112-133 primary annuli and 64-117 secondaries. There are two nuchal collars, the anterior one possessing a transverse dorsal groove, and the posterior one grooved but mostly fused with the first primary annulus.
 

A Spanish-language species account can be found at the website of Instituto Nacional de Biodiversidad (INBio).

  • Wake, M. H. (1963). ''Gymnopis multiplicata.'' Catalogue of American Amphibians and Reptiles. American Society of Ichthyologists and Herpetologists, 411.1-411.2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species from Central America is found in the western cordilleras and western Atlantic lowlands from eastern Guatemala to northwestern Panama, and on the Pacific versant on premontane slopes and in the lowlands in northwestern Costa Rica and on the lowlands of southwestern Costa Rica and adjacent Panama. In Panama it has been recorded from Isla Cristóbal, Isla Escudo de Veraguas and Isla Colon (Marvalee Wake pers. comm.) in the Bocas del Toro. In Costa Rica it has been recorded from Isla del Caño. Its altitudinal range is from sea level up to 1,400m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Gymnophis multiplicata is found in tropical forests of countries along the equator. This includes Central and South America, Central Africa, and Southern Asia.

Biogeographic Regions: oriental (Native ); ethiopian (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

This species occurs in Alta Verapaz, Guatemala, in Honduras and Nicaragua, Costa Rica and adjacent Panama, from sea level to 900m. Found from sea level to 1400 m south to Veragua, Panama.
  • Wake, M. H. (1963). ''Gymnopis multiplicata.'' Catalogue of American Amphibians and Reptiles. American Society of Ichthyologists and Herpetologists, 411.1-411.2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Countries

Countries

Costa Rica, Guatemala, Honduras, Nicaragua, Panama

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The most distinguishing characteristic of all caecilians is their limbless, worm-like bodies. This caecilian reaches about 30 centimeters, or one foot, in length and is dark purple, almost black, in color with about 100 or so grooves encircling its body. It has very tiny eyes with sensory tentacles, each between one eye and one nostril. This tentacle can retract when it is not in use. It also has well-developed jaws and teeth, which distinguishes it from a very large earthworm. Caecilians also have scales embedded in their skin.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Identification

Adult

Species description based on Savage (2002).  A medium-sized caecilian (to 480 mm total length). The body is rather robust.

Dorsal

The dorsal color is purplish-grey.

Distinguishing characteristics

The color of the annular grooves is not distinct from rest of the body.  Number of primary annuli: 112-133  Number of secondary annuli: 84-117  Total annuli: 199-250

Eye

The eyes are not visible.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Gymnopis multiplicata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: No Further Locality Data, Costa Rica
  • Holotype: Cope, E. D. 1877. Proc. Amer. Philos. Soc. 17 (100): 91.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lectotype; Syntype for Gymnopis multiplicata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Limon, from the forest country near the coast at, Limon, Costa Rica
  • Lectotype: Taylor, E. H. 1968. The Caecilians of the World: A Taxonomic Review. 525.; Cope, E. D. 1877. Proc. Amer. Philos. Soc. 17 (100): 90.; Syntype: Taylor, E. H. 1968. The Caecilians of the World: A Taxonomic Review. 525.; Cope, E. D. 1877. Proc. Amer. Philos. Soc. 17 (100): 90.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype; Syntype for Gymnopis multiplicata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Limon, from the forest country near the coast at, Limon, Costa Rica
  • Paralectotype: Taylor, E. H. 1968. The Caecilians of the World: A Taxonomic Review. 525.; Cope, E. D. 1877. Proc. Amer. Philos. Soc. 17 (100): 90.; Syntype: Taylor, E. H. 1968. The Caecilians of the World: A Taxonomic Review. 525.; Cope, E. D. 1877. Proc. Amer. Philos. Soc. 17 (100): 90.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a subterranean species of humid lowland and montane forest, lowland dry forest, gallery forest, meadows, pastures, saturated sedge peat, and secondary habitats. It is a viviparous species, and development of young takes place in the female oviduct.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Gymnophis multiplicata is found in tropical forests burrowing up to three meters below ground.

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Habitat

Lowland and premontane forest to 1400 m. Also found in grassy areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

This Caecilian’s diet ranges from worms, caterpillars, termites, and small burrowing snakes that it catches while burrowing through the earth.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diet

Diet

The diet consists of the soft larval stages of many arthropods (Wake 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Ecology

Gymnopis multiplicata lives underground (Savage 2002). It is sometimes encountered during the day under rocks or fallen logs (Savage 2002). At night, they may be encountered foraging along the forest floor (Savage 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life History

Egg

A female will produce between 2 and 10 young at a time (Wake 1980). Eggs are retained within the mother's oviduct (Wake 1980). Once embryos have exhausted their yolk supply, they hatch to feed on nutritive secretions produced by the mother (Wake 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The sexes look alike externally. The male, unlike the other amphibians, have a concealed organ for the direct passage of semen into the body of the female. After internal fertilization, the larvae are born in water and have external gills, which they lose at metamorphosis into adults. At this point, they can drown if they remain underwater.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnopis multiplicata

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBAP1164-10|GQ244471|Gymnopis multiplicata| ATACGTTGATTCTTTTCAACTAATCATAAAGACATCGGCACCCTTTATTTACTCTTTGGTGCTTGAACTGGAATAATGGGTACTGCTTTA---AGCCTTCTGATCCGAGCTGAATTAAGCCAACCAGGTAATTTACTAGGTGAT---GACCAAATTTATAATGTAGTCGTAACTGCCCATGCCTTCATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGGTTTGGTAATTGATTAGTACCATTAATAATA---GGAGCCCCAGATATAGCCTTTCCACGAATAAACAACATAAGTTTTTGACTTCTTCCTCCATCACTATTATTATTAATAGCATCATCAAGTGTAGAAGCTGGTGCAGGTACTGGTTGAACAGTATACCCACCACTAGCCAGTAATTTAACCCATGCTGGAGCATCAGTTGATTTA---ACAATTTTCTCATTACACTTAGCCGGTATTTCATCAATCTTAGGTGCAATCAACTTCATTACAACAATCATTAACATAAAACCCCCAACAATATCTCAATACCAAACCCCCCTATTTATTTGATCTATTTTAGTTACAGCAATCTTATTATTATTATCTCTACCAATTTTAGCCGCT---GGTATCACTATATTACTAACTGACCGTAATATCAATACAACTTTTTTCGATCCATCTGGTGGAGGAGATCCAATTCTATACCAACATTTATTCTGATTCTTTGGACACCCAGAAGTGTATATTTTAATCCTTCCTGGATTTGGTATAATCTCACATATCGTCACATATTATTCTGGTAAAAAA---GAACCATTTGGCTATATAGGTATAGTTTGAGCAATAATATCAATCGGATTCCTAGGATTTATTGTTTGAGCACACCATATATTTACAGTAGGTATAA  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gymnopis multiplicata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Frank Solís, Roberto Ibáñez, César Jaramillo, Gerardo Chaves, Federico Bolaños, Jay Savage, Gustavo Cruz, Larry David Wilson, Gunther Köhler, Mark Wilkinson, Marvalee Wake, Franklin Castañeda, Javier Sunyer

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining to qualify for listing in a more threatened category.

History
  • 2008
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Because caecilians are not well-studied, their risk of extinction is not known. However, they may be affected by rain forest destruction.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is a low density, fairly common species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

This species is viviparous, with the fetuses recieving maternal nutrition after the yolk has been used up. Metamorphosis occurs while the fetuses are in the oviduct. Fetuses are thought to scrape their teeth along the oviduct wall to stimulate cell turnover and secretion of nutrients. Fetuses possess tiramous gills that are resorbed before birth. Gestation period is about 11 months. Females reproduce every two years, bearing 2-10 offspring. Males are spermatogenic from February to November.
  • Wake, M. H. (1963). ''Gymnopis multiplicata.'' Catalogue of American Amphibians and Reptiles. American Society of Ichthyologists and Herpetologists, 411.1-411.2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Although the species can be found in modified areas, it persists at considerably reduced densities than in primary and secondary tropical forest. Suitable forest within the species range is being extensively converted to agricultural use including banana and coffee plantations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It has been recorded from several protected areas, including the Sierra el Caral in Guatemala. There is a particular need to conserve remaining areas of lowland tropical forest for this species. There is a need for further research into the population dynamics of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gymnopis multiplicata

Siphonops simus Cope, "1878" 1877

Gymnopis multiplicata is a species of amphibian in the Caeciliidae family. It is found in Costa Rica, Honduras, Nicaragua, Panama, and possibly Guatemala. Its natural habitats are subtropical or tropical dry forests, subtropical or tropical moist lowland forests, subtropical or tropical moist montane forests, pastureland, plantations , rural gardens, and urban areas.

References

  1. ^ Frank Solís, Roberto Ibáñez, César Jaramillo, Gerardo Chaves, Federico Bolaños, Jay Savage, Gustavo Cruz, Larry David Wilson, Gunther Köhler, Mark Wilkinson, Marvalee Wake, Franklin Castañeda (2008). Gymnopis multiplicata. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 21 June 2009. Database entry includes a brief justification of why this species is of least concern.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!