Articles on this page are available in 1 other language: Spanish (6) (learn more)

Overview

Distribution

Range Description

This species occurs in humid lowlands on the Atlantic slope from Costa Rica to east-central Panama and on the Pacific versant in southwestern Costa Rica to west-central Panama. Suggestions that the species occurs in Colombia are incorrect (T. Grant pers. comm.). It has an altitudinal range of 10-865m asl (Savage, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Countries

Countries

Costa Rica, Panama

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Identification

Adult

Species description based on Savage (2002).  A tiny rocket frog (males to 17 mm, females to 18 mm). Mature males have a swollen middle finger. Throat color in males pale grey throat (white in females).

Dorsal

The dorsal surface is dark brown; the coloration darkens to black along the sides. The dorsal and lateral coloration is separated by a complete or partial thin light stripe. The stripe extends from the groin to either midway across the side, or all the way to the eye. The upper surfaces of the arms and legs are usually orangeish. There are no bars on the arms or legs.

Concealed surfaces

The rear surface of the thigh is orangish, borded above by a dark line.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Colostethus flotator
Catalog Number: USNM 50177
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1912
Locality: Cana, Darién, Panama
Elevation (m): 549 to 610
  • Paratype: Dunn, E. R. 1931. Occ. Pap. Boston Soc. Nat. Hist. 5: 389.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a terrestrial, diurnal species generally found in the leaf-litter of humid lowland and montane forest; it may be found in secondary forest and plantations. Adults are often encountered along rocky sections of forest streams. Eggs are deposited in leaf-litter, the males transport hatching tadpoles to forest streams where they develop.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Lowland forest to 865 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Diet

Diet

This species consumes a variety of small arthropods, including large numbers of insect larvae (Toft 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Ecology

Silverstoneia flotator lives in leaf litter (Savage 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Call

A series of "peets", usually three repeated in a row (Ibanez and Smith 1995, Savage 2002)

Behavior and communication

Males are territorial and will wrestle with other males to defend their territories (Savage 2002). Eggs are laid in leaf litter in a male's territory (Savage 2002). When the eggs hatch, the male transports the tadpoles to nearby streams to continue development (Savage 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Life History

Breeding season

Males call from leaf litter during the early and later parts of the day (Savage 2002).

Tadpole

The tadpole body is oval-shaped, with a fairly long tail and low tail fins (Savage 2002). The body and tail are dark brown, with some darker pigmentation on the tail (Savage 2002). The ventral surface is pale (Savage 2002). Tadpoles can orient their large mouths dorsally to feed on particles trapped in the surface film of water (Savage 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Silverstoneia flotator

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Silverstoneia flotator

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATTTAGTATTTGGGGCTTGAGCTGGAATAGTAGGAACAGCCCTAAGTCTTCTAATTCGAGCCGAACTAAGTCAACCAGGCTCCTTACTGGGTGAC---GACCAAATTTACAACGTGATCGTTACTGCACATGCTTTCGTCATAATTTTTTTTATGGTTATACCGATCCTAATTGGCGGTTTTGGTAACTGACTGGTTCCATTAATAATTGGGGCCCCAGACATAGCCTTTCCACGAATAAATAATATGAGCTTTTGACTTCTTCCACCCTCATTTCTTCTTCTCCTAGCATCAGCAGGGGTGGAGGCCGGAGCTGGGACCGGGTGGACTGTGTACCCGCCCCTAGCCGGCAACCTGGCCCATGCAGGCCCCTCAGTTGATCTGACAATTTTCTCCCTTCATCTTGCAGGGGTCTCATCAATTCTAGGGGCAATTAACTTTATCACTACAACTTTAAATATAAAACCTCCATCGCTAACTCAATATCAAACCCCTCTATTTGTTTGATCCGTTTTAATTACTGCAGTTCTACTTCTTCTTTCTCTCCCTGTTTTAGCTGCTGGAATTACAATACTCTTAACTGACCGAAACCTTAATACTACCTTCTTTGACCCTGCAGGGGGAGGTGACCCAGTTTTATACCAACACCTCTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Frank Solís, Roberto Ibáñez, Gerardo Chaves, Jay Savage, César Jaramillo, Querube Fuenmayor, Federico Bolaños

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is a very common species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
In general habitat loss occurs by the destruction of natural forests.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place; the species has been recorded from a number of protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rainforest rocket frog

The rainforest rocket frog (Silverstoneia flotator, formerly Colostethus flotator) is a terrestrial, diurnal frog found in humid lowlands of Costa Rica and Panama. It is generally very common and therefore considered to be of least concern by the IUCN. The taxonomy is in need of a review, as it may consist of a complex of several species.

References [edit]

  • Solís, F., et al. 2004. Silverstoneia flotator. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 28 May 2013.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!