Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Comprehensive Description

Description

This frog is the largest in North America and is distinguished by lacking dorsolateral folds and having very large tympanums, larger than the eye in males. The tips of the fingers and toes are blunt. The webbing is well developed. The skin on the back of this species is rough with random tiny tubercles. There is no dorsolateral fold, but there is a prominent supratympanic fold. The mean snout to vent length for males is 152 mm (range 111-178) and for females it is 162 mm (range 120-183). The males have pigmented nuptial pads. The vocal openings are at the corner of the mouth.The dorsum is green, with or without a netlike pattern of gray or brown on top. The venter is slightly white, sometimes mottled with gray or yellow. Coloration varies widely depending on the locality of the bullfrog (Conant and Collins 1975).

See another account at californiaherps.com.

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
  • Maeda, N. and Matsui, M. (1990). Frogs and Toads of Japan, 2nd edition. Bun-Ichi Sogo Shuppan Co., Ltd., Tokyo, Japan.
  • Akmentins, M. S. and Cardozo, D. E. (2009). ''American bullfrog Lithobates catesbeianus (Shaw, 1802) invasion in Argentina.'' Biological Invasions, DOI: 10.1007/s10530-009-9515-3.
  • Bai, C., Garner, T. W. J., and Li, Y. (2010). ''First evidence of Batrachochytrium dendrobatidis in China: discovery of chytridiomycosis in introduced American bullfrogs and native amphibians in the Yunnan Province, China .'' EcoHealth, Published online 06 April 2010. DOI: 10.1007/s10393-010-0307-0.
  • Barrasso, D. A., Cajade, R., Nenda, S.J, Baloriani, G., and Herrera, R. (2009). ''Introduction of the American bullfrog Lithobates catesbeianus (Anura: Ranidae) in natural and modified environments: an increasing conservation problem in Argentina.'' South American Journal of Herpetology, 4, 69-75.
  • Borges-Martins, M., Di-Bernardo, M., Vinciprova, G., and Measey, J. (2002). ''Geographic distribution. Rana catesbeiana.'' Herpetological Review, 33, 319.
  • Cisneros-Heredia, D.F. (2004). ''Rana catesbeiana (bullfrog). Ecuador: provincia de Napo.'' Herpetological Review, 35, 406.
  • Daszak, P., Strieby, A., Cunningham, A.A., Longcore, J.E., Brown, C.C., and Porter, D. (2004). ''Experimental evidence that the bullfrog (Rana catesbeiana) is a potential carrier of chytridiomycosis, an emerging funcal disease of amphibians.'' Herpetological Journal, 14, 201-207.
  • Daza, J., and Castro, F. (1999). ''Feeding habits of the bullfrog (Rana catesbeiana) Anura: Ranidae, in the Cauca Valley, Colombia.'' Revista de la Academia Colombiana de Ciencias, 23, 265-274.
  • Fa, J.E., Soy, J.P., Capote, R., Martínez, M., Fernández, I., Avila, A., Rodríguez, D., Rodríguez, A., Cejas, F., and Brull, G. (2002). ''Biodiversity of Sierra del Cristal, Cuba: first insights.'' Oryx, 36(4), 389-395.
  • Ficetola, G. F., Coïc, C., Detaint, M., Berroneau, M., Lorvelec, O., and Miaud, C. (2006). ''Pattern of distribution of the American bullfrog Rana catesbeiana in Europe.'' Biological Invasions, 9, 767-772.
  • Garner, T.W.J., Perkins, M.W., Govindarajulu, P., Seglie, D., Walker, S., Cunningham, A.A., and Fisher, M.C. (2006). ''The emerging amphibian pathogen Batrachochytrium dendrobatidis globally infects introduced populations of the North American bullfrog, Rana catesbeiana.'' Biology Letters, 2, 455-459.
  • Giovanelli, J.G.R., Haddad, C.F.B., and Alexandrino, J. (2008). ''Predicting the potential distribution of the alien invasive bullfrog (Lithobates catesbeianus) in Brazil.'' Biological Invasions, 10, 585-590.
  • Grant, K. P., and Licht, L. R. (1995). "Effects of ultraviolet radiation on life-history stages of anurans from Ontario, Canada." Canadian Journal of Zoology, 73(12), 2292-2301.
  • Hanselmann, R., Rodríguez, A., Lampo, M., Fajardo-Ramos, L., Aguirre, A. A., Kilpatrick, A. M., Rodríguez, J., and Daszak, P. (2004). ''Presence of an emerging pathogen of amphibians in introduced bullfrogs Rana catesbeiana in Venezuela.'' Biological Conservation, 120, 115-119.
  • Hirai, T. (2004). ''Diet composition of introduced bullfrog, Rana catesbeiana, in the Mizorogaike Pond of Kyoto, Japan.'' Ecological Research, 19, 375-380.
  • Hoffman, W.H. and Noble, G.K. (1927). ''The Bullfrog in Cuba.'' Copeia, (163), 59-60.
  • Hsu, C. and Liang, H. (1970). ''Sex races of Rana catesbeiana in Taiwan.'' Herpetologica, 26(2), 214-221.
  • Jennings, M. (1985). ''Pre-1900 overharvest of California Red-legged Frogs (Rana aurora draytonii): The inducement for bullfrog (Rana catesbeiana) introduction.'' Herpetological Review, 31(1), 94-103.
  • Kaefer Í.L., Boelter, R.A., and Cechin, S.Z. (2007). ''Reproductive biology of the invasive bullfrog Lithobates catesbeianus in southern Brazil.'' Annales Zoologici Fennici, 44, 435-444.
  • Kiesecker, J. M., and Blaustein, A. R. (1997). ''Population differences in responses of red-legged frogs (Rana aurora) to introduced bullfrogs.'' Ecology (Washington D C), 78(6), 1752-1760.
  • Lanza, B. (1962). ''On the Introduction of Rana ridibunda Pallas and Rana catesbeiana Shaw in Italy.'' Copeia, 1962(3), 642-643.
  • Laufer, G., Canavero, A., Núñez, D., and Maneyro, R. (2008). ''Bullfrog (Lithobates catesbeianus) invasion in Uruguay.'' Biological Invasions, 10, 1183-1189.
  • Lever, C. (2003). Naturalized Reptiles and Amphibians of the World. Oxford University Press, Oxford.
  • Li, Y.M., Wu, Z.J., and Duncan, R.P. (2006). ''Why islands are easier to invade: human influences on bullfrog invasion in the Zhoushan archipelago and neighboring mainland China.'' Oecologia, 148, 129-136.
  • Liu, X. and Li, Y. (2009). ''Aquaculture enclosures relate to the establishment of feral populations of introduced species.'' PLoS One, 4:e6199 doi:10.1371/journal.pone.0006199.
  • Lynch, J.D. (2006). ''The amphibian fauna in the Villavicencio region of Eastern Colombia.'' Caldasia, 28(1), 135-155.
  • Lynch, J.D. (2006). ''The tadpoles of frogs and toads found in the lowlands of northern Colombia.'' Revista de la Academia Colombiana de Ciencias, 30(116), 443-457.
  • Mahon, R. and Aiken, K. (1977). ''The Establishment of the North American Bullfrog, Rana catesbeiana (Amphibia, Anura, Ranidae) in Jamaica.'' Journal of Herpetology, 11(2), 197-199.
  • Mazzoni, R., Cunningham, A.A., Daszak, P., Apolo, A., Perdomo, E., and Speranza, G. (2003). ''Emerging pathogen of wild amphibians in frogs (Rana catesbeiana) farmed for international trade.'' Emerging Infectious Diseases, 9(8), 995-998.
  • Minowa, S., Senga, Y., and Miyashita, T. (2008). ''Microhabitat Selection of the Introduced Bullfrogs (Rana catesbeiana) in Paddy Fields in Eastern Japan.'' Current Herpetology, 27(2), 55-59.
  • Mueses-Cisneros, J.J. and Ballén, G. (2007). ''Un nuevo caso de alerta sobre posible amenaza a una fauna nativa de anfibios en Colombia: Primer reporte de la rana toro (Lithobates catesbeianus) en la sabana de Bogotá.'' Revista de la Academia Colombiana de Ciencias, 31(118), 65-166.
  • Neveu, A., Bergot, F., and and Vigneux, E. (1997). ''The introduction of allochthonous green frog species into France, two dissimilar cases: R. catesbeiana and the foreign taxa of the esculenta complex.'' ''.'' Bulletin Francais de la Peche et de la Pisciculture,
  • Okada, Y. (1927). ''Frogs in Japan.'' Copeia, (158), 161-166.
  • Pereyra, M. O., Baldo, D., and Krauczuc, E. R. (2006). ''La ‘‘rana toro’’ en la Selva Atlántica Interior Argentina: un nuevo problema de conservación.'' Cuadernos de Herpetología, 20, 37-40.
  • Perez, M. E. (1951). ''The food of Rana catesbeiana Show in Puerto Rico.'' Herpetologica, 7(3), 102-104.
  • Ruiz, A., and Rueda-Almonacid, J. V. (2008). ''Batrachochytrium dendrobatidis and chytridiomycosis in anuran amphibians of Colombia.'' EcoHealth, 5, 27-33.
  • Sampedro, A., Montanez, L., and Suarez, O. (1985). ''Food of Rana catesbeiana at two zones of capture in Cuba.'' Ciencias Biologicas, (13), 59-66.
  • Sanabria, E. A., Quiroga, L. B., and Acosta, J. C. (2005). ''Introducción de Rana catesbeiana (rana toro), en ambientes precordilleranos de la provincia de San Juan, Argentina.'' Multequina, 14, 65-68.
  • Scalera, R. (2007). ''Virtues and shortcomings of EU legal provisions for managing NIS: Rana catesbeiana and Trachemys scripta elegans as case studies.'' Biological Invaders in Inland Waters: Profiles, Distribution, and Threats. F. Gherardi, eds., Springer Netherlands, 669-678.
  • Schloegel, L.M., Picco, A.M., Kilpatrick, A.M., Davies, A.J., Hyatte, A.D., and Daszak, P. (2009). ''Magnitude of the US trade in amphibians and presence of Batrachochytrium dendrobatidis and ranavirus infection in imported North American bullfrogs (Rana catesbeiana).'' Biological Conservation, 142, 1420-1426.
  • Stumpel, A.H.P. (1992). ''Successful reproduction of introduced bullfrogs Rana catesbeiana in northwestern Europe: A potential threat to indigenous amphibians.'' Biological Conservation, 60(1), 61-62.
  • Sánchez, D., Chacón-Ortiz, A., León, F., Han, B.A., and Lampo, M. (2008). ''Widespread occurrence of an emerging pathogen in amphibian communities of the Venezuelan Andes.'' Biological Conservation, 141, 2898-2905.
  • Thorn, Robert (1968). Les Salamandres d'Europe, d'Asie et d'Afrique du nord. Lechevalier, Paris.
  • Une, Y., Sakuma, A., Matsueda, H., Nakai, K., and Murakami, M. (2009). ''Ranavirus outbreak in North American Bullfrogs (Rana catesbeiana), Japan, 2008.'' Emerging Infectious Diseases, 15(7), 1146-1147.
  • Wang, X., Ma, L., Wu, M., and Liu, M. (1992). ''Study history and geographic distribution of Ranodon sibiricus.'' Foreign Animal Husbandry - Herbivorous Livestock. Biology Supplement, Urumqi, 59-61.
  • Wang, Y., Guo, Z., Pearl, C.A., and Li, Y. (2007). ''Body size affects the predatory interactions between introduced American Bullfrogs (Rana catesbeiana) and native anurans in China: an experimental study.'' Journal of Herpetology, 41(3), 514-520.
  • Wu, Z., Li, Y., Wang, Y., and Adams, M.J. (2005). ''Diet of introduced bullfrogs (Rana catesbeiana): predation on and diet overlap with native frogs on Daishan Island, China.'' Journal of Herpetology, 39(4), 668-674.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution and Habitat

R. catesbeiana is widely distributed in eastern North America, ranging from Nova Scotia to central Florida and west to eastern Wyoming, Colorado and New Mexico. It occurs throughout most of Texas and into northwestern Mexico. It has been widely introduced for a variety of purposes, and is now common in many parts of western North America and many other countries, including those in Europe, Asia and South America (e.g., see Lever 2003). Rana catesbeiana is strongly aquatic, and can be found primarily at the edges of lakes, marshes, or cypress bays (Conant and Collins 1975).

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
  • Maeda, N. and Matsui, M. (1990). Frogs and Toads of Japan, 2nd edition. Bun-Ichi Sogo Shuppan Co., Ltd., Tokyo, Japan.
  • Akmentins, M. S. and Cardozo, D. E. (2009). ''American bullfrog Lithobates catesbeianus (Shaw, 1802) invasion in Argentina.'' Biological Invasions, DOI: 10.1007/s10530-009-9515-3.
  • Bai, C., Garner, T. W. J., and Li, Y. (2010). ''First evidence of Batrachochytrium dendrobatidis in China: discovery of chytridiomycosis in introduced American bullfrogs and native amphibians in the Yunnan Province, China .'' EcoHealth, Published online 06 April 2010. DOI: 10.1007/s10393-010-0307-0.
  • Barrasso, D. A., Cajade, R., Nenda, S.J, Baloriani, G., and Herrera, R. (2009). ''Introduction of the American bullfrog Lithobates catesbeianus (Anura: Ranidae) in natural and modified environments: an increasing conservation problem in Argentina.'' South American Journal of Herpetology, 4, 69-75.
  • Borges-Martins, M., Di-Bernardo, M., Vinciprova, G., and Measey, J. (2002). ''Geographic distribution. Rana catesbeiana.'' Herpetological Review, 33, 319.
  • Cisneros-Heredia, D.F. (2004). ''Rana catesbeiana (bullfrog). Ecuador: provincia de Napo.'' Herpetological Review, 35, 406.
  • Daszak, P., Strieby, A., Cunningham, A.A., Longcore, J.E., Brown, C.C., and Porter, D. (2004). ''Experimental evidence that the bullfrog (Rana catesbeiana) is a potential carrier of chytridiomycosis, an emerging funcal disease of amphibians.'' Herpetological Journal, 14, 201-207.
  • Daza, J., and Castro, F. (1999). ''Feeding habits of the bullfrog (Rana catesbeiana) Anura: Ranidae, in the Cauca Valley, Colombia.'' Revista de la Academia Colombiana de Ciencias, 23, 265-274.
  • Fa, J.E., Soy, J.P., Capote, R., Martínez, M., Fernández, I., Avila, A., Rodríguez, D., Rodríguez, A., Cejas, F., and Brull, G. (2002). ''Biodiversity of Sierra del Cristal, Cuba: first insights.'' Oryx, 36(4), 389-395.
  • Ficetola, G. F., Coïc, C., Detaint, M., Berroneau, M., Lorvelec, O., and Miaud, C. (2006). ''Pattern of distribution of the American bullfrog Rana catesbeiana in Europe.'' Biological Invasions, 9, 767-772.
  • Garner, T.W.J., Perkins, M.W., Govindarajulu, P., Seglie, D., Walker, S., Cunningham, A.A., and Fisher, M.C. (2006). ''The emerging amphibian pathogen Batrachochytrium dendrobatidis globally infects introduced populations of the North American bullfrog, Rana catesbeiana.'' Biology Letters, 2, 455-459.
  • Giovanelli, J.G.R., Haddad, C.F.B., and Alexandrino, J. (2008). ''Predicting the potential distribution of the alien invasive bullfrog (Lithobates catesbeianus) in Brazil.'' Biological Invasions, 10, 585-590.
  • Grant, K. P., and Licht, L. R. (1995). "Effects of ultraviolet radiation on life-history stages of anurans from Ontario, Canada." Canadian Journal of Zoology, 73(12), 2292-2301.
  • Hanselmann, R., Rodríguez, A., Lampo, M., Fajardo-Ramos, L., Aguirre, A. A., Kilpatrick, A. M., Rodríguez, J., and Daszak, P. (2004). ''Presence of an emerging pathogen of amphibians in introduced bullfrogs Rana catesbeiana in Venezuela.'' Biological Conservation, 120, 115-119.
  • Hirai, T. (2004). ''Diet composition of introduced bullfrog, Rana catesbeiana, in the Mizorogaike Pond of Kyoto, Japan.'' Ecological Research, 19, 375-380.
  • Hoffman, W.H. and Noble, G.K. (1927). ''The Bullfrog in Cuba.'' Copeia, (163), 59-60.
  • Hsu, C. and Liang, H. (1970). ''Sex races of Rana catesbeiana in Taiwan.'' Herpetologica, 26(2), 214-221.
  • Jennings, M. (1985). ''Pre-1900 overharvest of California Red-legged Frogs (Rana aurora draytonii): The inducement for bullfrog (Rana catesbeiana) introduction.'' Herpetological Review, 31(1), 94-103.
  • Kaefer Í.L., Boelter, R.A., and Cechin, S.Z. (2007). ''Reproductive biology of the invasive bullfrog Lithobates catesbeianus in southern Brazil.'' Annales Zoologici Fennici, 44, 435-444.
  • Kiesecker, J. M., and Blaustein, A. R. (1997). ''Population differences in responses of red-legged frogs (Rana aurora) to introduced bullfrogs.'' Ecology (Washington D C), 78(6), 1752-1760.
  • Lanza, B. (1962). ''On the Introduction of Rana ridibunda Pallas and Rana catesbeiana Shaw in Italy.'' Copeia, 1962(3), 642-643.
  • Laufer, G., Canavero, A., Núñez, D., and Maneyro, R. (2008). ''Bullfrog (Lithobates catesbeianus) invasion in Uruguay.'' Biological Invasions, 10, 1183-1189.
  • Lever, C. (2003). Naturalized Reptiles and Amphibians of the World. Oxford University Press, Oxford.
  • Li, Y.M., Wu, Z.J., and Duncan, R.P. (2006). ''Why islands are easier to invade: human influences on bullfrog invasion in the Zhoushan archipelago and neighboring mainland China.'' Oecologia, 148, 129-136.
  • Liu, X. and Li, Y. (2009). ''Aquaculture enclosures relate to the establishment of feral populations of introduced species.'' PLoS One, 4:e6199 doi:10.1371/journal.pone.0006199.
  • Lynch, J.D. (2006). ''The amphibian fauna in the Villavicencio region of Eastern Colombia.'' Caldasia, 28(1), 135-155.
  • Lynch, J.D. (2006). ''The tadpoles of frogs and toads found in the lowlands of northern Colombia.'' Revista de la Academia Colombiana de Ciencias, 30(116), 443-457.
  • Mahon, R. and Aiken, K. (1977). ''The Establishment of the North American Bullfrog, Rana catesbeiana (Amphibia, Anura, Ranidae) in Jamaica.'' Journal of Herpetology, 11(2), 197-199.
  • Mazzoni, R., Cunningham, A.A., Daszak, P., Apolo, A., Perdomo, E., and Speranza, G. (2003). ''Emerging pathogen of wild amphibians in frogs (Rana catesbeiana) farmed for international trade.'' Emerging Infectious Diseases, 9(8), 995-998.
  • Minowa, S., Senga, Y., and Miyashita, T. (2008). ''Microhabitat Selection of the Introduced Bullfrogs (Rana catesbeiana) in Paddy Fields in Eastern Japan.'' Current Herpetology, 27(2), 55-59.
  • Mueses-Cisneros, J.J. and Ballén, G. (2007). ''Un nuevo caso de alerta sobre posible amenaza a una fauna nativa de anfibios en Colombia: Primer reporte de la rana toro (Lithobates catesbeianus) en la sabana de Bogotá.'' Revista de la Academia Colombiana de Ciencias, 31(118), 65-166.
  • Neveu, A., Bergot, F., and and Vigneux, E. (1997). ''The introduction of allochthonous green frog species into France, two dissimilar cases: R. catesbeiana and the foreign taxa of the esculenta complex.'' ''.'' Bulletin Francais de la Peche et de la Pisciculture,
  • Okada, Y. (1927). ''Frogs in Japan.'' Copeia, (158), 161-166.
  • Pereyra, M. O., Baldo, D., and Krauczuc, E. R. (2006). ''La ‘‘rana toro’’ en la Selva Atlántica Interior Argentina: un nuevo problema de conservación.'' Cuadernos de Herpetología, 20, 37-40.
  • Perez, M. E. (1951). ''The food of Rana catesbeiana Show in Puerto Rico.'' Herpetologica, 7(3), 102-104.
  • Ruiz, A., and Rueda-Almonacid, J. V. (2008). ''Batrachochytrium dendrobatidis and chytridiomycosis in anuran amphibians of Colombia.'' EcoHealth, 5, 27-33.
  • Sampedro, A., Montanez, L., and Suarez, O. (1985). ''Food of Rana catesbeiana at two zones of capture in Cuba.'' Ciencias Biologicas, (13), 59-66.
  • Sanabria, E. A., Quiroga, L. B., and Acosta, J. C. (2005). ''Introducción de Rana catesbeiana (rana toro), en ambientes precordilleranos de la provincia de San Juan, Argentina.'' Multequina, 14, 65-68.
  • Scalera, R. (2007). ''Virtues and shortcomings of EU legal provisions for managing NIS: Rana catesbeiana and Trachemys scripta elegans as case studies.'' Biological Invaders in Inland Waters: Profiles, Distribution, and Threats. F. Gherardi, eds., Springer Netherlands, 669-678.
  • Schloegel, L.M., Picco, A.M., Kilpatrick, A.M., Davies, A.J., Hyatte, A.D., and Daszak, P. (2009). ''Magnitude of the US trade in amphibians and presence of Batrachochytrium dendrobatidis and ranavirus infection in imported North American bullfrogs (Rana catesbeiana).'' Biological Conservation, 142, 1420-1426.
  • Stumpel, A.H.P. (1992). ''Successful reproduction of introduced bullfrogs Rana catesbeiana in northwestern Europe: A potential threat to indigenous amphibians.'' Biological Conservation, 60(1), 61-62.
  • Sánchez, D., Chacón-Ortiz, A., León, F., Han, B.A., and Lampo, M. (2008). ''Widespread occurrence of an emerging pathogen in amphibian communities of the Venezuelan Andes.'' Biological Conservation, 141, 2898-2905.
  • Thorn, Robert (1968). Les Salamandres d'Europe, d'Asie et d'Afrique du nord. Lechevalier, Paris.
  • Une, Y., Sakuma, A., Matsueda, H., Nakai, K., and Murakami, M. (2009). ''Ranavirus outbreak in North American Bullfrogs (Rana catesbeiana), Japan, 2008.'' Emerging Infectious Diseases, 15(7), 1146-1147.
  • Wang, X., Ma, L., Wu, M., and Liu, M. (1992). ''Study history and geographic distribution of Ranodon sibiricus.'' Foreign Animal Husbandry - Herbivorous Livestock. Biology Supplement, Urumqi, 59-61.
  • Wang, Y., Guo, Z., Pearl, C.A., and Li, Y. (2007). ''Body size affects the predatory interactions between introduced American Bullfrogs (Rana catesbeiana) and native anurans in China: an experimental study.'' Journal of Herpetology, 41(3), 514-520.
  • Wu, Z., Li, Y., Wang, Y., and Adams, M.J. (2005). ''Diet of introduced bullfrogs (Rana catesbeiana): predation on and diet overlap with native frogs on Daishan Island, China.'' Journal of Herpetology, 39(4), 668-674.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

North American bullfrogs (Rana_catesbeiana) are only native to the Nearctic region. They are found from Nova Scotia to central Florida, from the East coast to Wisconsin, and across the Great Plains to the Rockies. The natural western limits of this species are now confused due to their introduction into places as far west as California and Mexico. It is known that bullfrogs were introduced to areas of California and Colorado in the early 1900's. The species has also been introduced (accidentally or on purpose) into southern Europe, South America, and Asia.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); oriental (Introduced ); neotropical (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This is a very wide-ranging species. Its native range is from Nova Scotia and New Brunswick, southern Quebec, Canada, south to eastern North America, except southern Florida, USA, then southward through Veracruz, Mexico. It is also found in Sinaloa, and probably other areas in Mexico, as well (these are not shown on the map). This species was introduced to Mexico at the beginning of last century. It was introduced to 'La Garita' in Costa Rica, but now appears to be extinct in this country (G. Chaves pers. comm.). It is also introduced in Cuba, Puerto Rico (introduced 1935), Hawaii (introduced mid- to late 1800s, now on all main islands), Isla de la Juventud, Hispaniola (only confirmed in northern and eastern Dominican Republic, not in Haiti) and Jamaica. Its range is increasing in some areas. It is introduced to South America. In Venezuela, there is an expanding population near La Azulita, in Mérida state, at the Andean versants facing Lake Maracaibo basin. In Colombia it is known from the Middle Magdalena Valley, north to the lowlands on the Caribbean coast. It has also been found in Bogotá, although it is not known whether it has established a population there. In Peru it has become established around Iquitos in central Loreto Department in the Amazon Basin, and also around Lima on the Pacific coast. There are also a number of populations established in Ecuador and Brazil. It has been introduced in Rincón de Pando, Canelones, Uruguay, and in Misiones, Argentina. In Europe, where it is introduced, the largest population occurs within the Po River Valley (Italy) where formal introductions continued at least until 1937. Other populations have been reported from Belgium (recorded from several sites in Wallonia and at least one population is known in Flanders), the Netherlands, central and southwestern France, Germany (in the vicinity of Bonn and also in Baden-Wuttemburg), Greece (Crete), Spain (Gran Canaria in the Canary Islands [only a few individuals observed and not mapped here], Villasbuenas de Gata in Cacerés [not recently observed and not mapped here] and Sierra de Collserola, Cataluña Province [only a few individuals observed and not mapped here]) and the United Kingdom (possibly now eradicated). It has possibly been introduced to Switzerland, although this requires further confirmation. In Asia, where it is also introduced, it is found in several localities in the Philippines, Malaysia, Indonesia, Thailand [not mapped here] and Singapore [not mapped here]. It has been introduced to mainland China and Taiwan, Province of China, for raising in farms for human consumption. Feral populations have become established in Taiwan, Province of China, Kunming in Yunnan province, Sichuan, Xinjiang and possibly other places in China as a result of escape or deliberate release. Individuals have been found in the wild in Hong Kong probably from releases of market animals. However, there is no evidence to suggest that this species is now established in Hong Kong. It is found widely from southern Hokkaido to Ishigakijima in Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

North American bullfrogs (Lithobates catesbeianus) are only native to the Nearctic region. They are found from Nova Scotia to central Florida, from the East coast to Wisconsin, and across the Great Plains to the Rockies. The natural western limits of this species are now confused due to their introduction into places as far west as California and Mexico. It is known that bullfrogs were introduced to areas of California and Colorado in the early 1900's. The species has also been introduced (accidentally or on purpose) into southern Europe, South America, and Asia.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); oriental (Introduced ); neotropical (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The native range extends from Nova Scotia, New Brunswick, and southern Quebec, Canada, west to the Great Lakes region, and south through most of the central and eastern United States and south into northeastern Mexico. The western limits of the native range are ambiguous due to widespread introductions in western North America. The species also has been introduced and is established in the Greater Antilles, Hawaii, and many other locations worldwide.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Physical Description

Morphology

Physical Description

Bullfrogs are the largest real frog found in North America, weighing up to 0.5 kg and measuring 460 mm in length. Their average length is 100-175 mm. Their color varies from brownish to shades of green, often with spots or blotches of a darker color around their backs. Their back feet are fully webbed. The sex of an adult bullfrog can be found out easily by examining the size of the tympanum (the external ear of the frog) relative to size of the eye. The tympanum is a round circle located on the side of the head near the eye, and in males it is much larger than the eye. In females the tympanum is as large or smaller than the eye. Also, during the breeding season the throat of the male bullfrog is yellow, and the female's is white.

Range mass: 0.5 (high) kg.

Range length: 460 (high) mm.

Average length: 100-175 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

North American bullfrogs are the largest true frog found in North America, weighing up to 0.5 kg and 203 mm in length. Typical length ranges from 90 to 152 mm. Color varies from brownish to shades of green, often with spots or blotches of a darker color about the back. The hind feet are fully webbed. The sex of an adult bullfrog can be easily determined by examining the size of the tympanum (the external ear of the frog) relative to that of the eye. The tympanum is a round circle located on the side of the head near the eye, and in males it is much larger than the eye. In females the tympanum is as large or smaller than the eye. Also, during the breeding season the throat of the male bullfrog is yellow, whereas the female's is white.

Range mass: 0.5 (high) kg.

Range length: 460 (high) mm.

Average length: 100-175 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

Average basal metabolic rate: 0.0134 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 20 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

North American bullfrogs need to live in water and are therefore usually found near some source of water, like a lake, pond, river, or bog. Warm, calm, shallow waters are their favorite places. Bullfrogs are becoming much more common in areas that have been changed by humans. Increased water temperatures and increased amounts of water plants, which are common signs of lakes that have been polluted by humans, favor bullfrogs by providing good habitats for growth, reproduction, and escape from predators.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh ; swamp ; bog

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits ponds, swamps, lakes, reservoirs, marshes, brackish ponds (in Hawaii), stream margins and irrigation ditches. It is sometimes found in temporary waters hundreds of metres from permanent water. It winters at the bottom of pools. It may disperse from water in wet weather. Eggs and larvae develop in permanent slow or non-flowing bodies of water.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North American bullfrogs must live in water and are therefore usually found near some source of water, such as a lake, pond, river, or bog. Warm, still, shallow waters are preferred. Bullfrogs are becoming increasingly common in areas that have been modified by humans. Increased water temperatures and increased aquatic vegetation, which are common factors of lakes polluted by humans, favor bullfrogs by providing suitable habitats for growth, reproduction, and escape from predators.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh ; swamp ; bog

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: American bullfrogs inhabit ponds, swamps, lakes, reservoirs, marshes, brackish ponds (e.g., Hawaii), stream margins, and irrigation ditches, especially sites with abundant floating, emergent, or submerged vegetation. They may disperse from water in wet weather and sometimes are found in temporary waters hundreds of meters from permanent water. Bullfrogs sometimes make seasonal migrations to and from ephemeral bodies of water, or between adjacent permanent aquatic habitats. Individuals often remain in one pond or in a cluster of adjacent ponds throughout a season but may move up to a mile or more from one year to the next. Breeding sites are primarily permanent slow- or nonflowing bodies of water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May make seasonal migrations to and from ephemeral bodies of water, or between adjacent permanent aquatic habitats. Usually remains in one pond or in a cluster of adjacent ponds throughout season but may move up to a mile or more from one year to the next. In Missouri, Willis et al. (1956) found that R. catesbeiana made interpond movements of 0.16-2.8 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Bullfrogs are predators. They usually eat serpentes, Annelida, insecta, crustacea, anura, tadpoles, and aquatic eggs of actinopterygii, frogs, insects, or caudata. They are cannibalistic and will not hesitate to eat their own kind. There have also been a few cases reported of bullfrogs eating chiroptera. Bullfrog tadpoles mostly graze on aquatic plants.

Animal Foods: birds; mammals; amphibians; reptiles; fish; eggs; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: algae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Bullfrogs are predators. They usually eat snakes, worms, insects, crustaceans, frogs, tadpoles, and aquatic eggs of fish, frogs, insects, or salamanders. They are cannibalistic and will not hesitate to eat their own kind. There have also been a few cases reported of bullfrogs eating bats. Bullfrog tadpoles mostly graze on aquatic plants.

Animal Foods: birds; mammals; amphibians; reptiles; fish; eggs; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: algae

Primary Diet: carnivore (Eats terrestrial vertebrates); herbivore (Algivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Metamorphosed frogs eat any animal that can be captured and swallowed, including all kinds of vertebrates and invertebrates. Larvae eat suspended matter, organic debris, algae, plant tissue, and small aquatic invertebrates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Fungus / infection vector
Batrachochytrium dendrobatidis is spread by Rana catesbeiana

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Humans hunt bullfrogs for frog legs, but they have a limited hunting season in most states. Bullfrogs are also eaten by a wide variety of other animals, depending on the region. These include ardeidae, such as Ardea herodias and Ardea alba, testudines, Nerodia, procyon lotor, and Ceryle alcyon. Most fish are averse to eating bullfrog tadpoles because of their undesirable taste.

Known Predators:

  • great blue herons (Ardea_herodias)
  • great egrets (Ardea_alba)
  • belted kingfishers (Ceryle_alcyon)
  • turtles (Testudines)
  • water snakes (Nerodia)
  • raccoons (Procyon_lotor)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Humans hunt bullfrogs for frog legs, but they have a limited hunting season in most states. Bullfrogs are also eaten by a wide variety of other animals, depending on the region. These include herons, such as great blue herons and great egrets, turtles, water snakes, raccoons, and belted kingfishers. Most fish are averse to eating bullfrog tadpoles because of their undesirable taste.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Rana catesbeiana preys on:
Chelydra serpentina
Diadophis punctatus
Anas fulvigula
Bombycilla cedrorum
Parascalops breweri

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Represented by many and/or large occurrences throughout most of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but clearly exceeds 1,000,000 individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Introduced bullfrogs apparently have detrimental effects on populations of native ranid frogs.

Bullfrog larvae generally are not palatable to fish predators but are sensitive to invertebrate predators (e.g., see Smith et al. 1999).

Bullfrogs in hand may go limp, then suddenly "revive" and leap away. Sometimes they produce a loud open-mouthed call lasting up to several seconds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The call of a male bullfrog has a low frequency and can be heard for over one kilometer. The sound is often described as a low rumbling "jug-o-rum". Bullfrogs also have a good sense of vision and sense vibrations. See a video of a bullfrog calling here:   http://www.midwestfrogs.com/.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

The call of a male bullfrog has a low frequency and can be heard for over one kilometer. The sound is often described as a low rumbling "jug-o-rum". Bullfrogs also have a good sense of vision and sense vibrations. See a video of a bullfrog calling here:   http://www.midwestfrogs.com/.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Bullfrogs are easily observed in daytime or (with a light) at night; movements and breeding activity during summer occur mostly at dusk and at night, though calling commonly occurs in daytime as well. Bullfrogs are relatively inactive during cold winter months, where they situate themselves at the bottom of pools or under various sorts of cover in or near water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

About four days after fertilization, spotted tadpoles emerge from the floating egg mass. The tadpoles have gills and a tail, which eventually disappears as the tadpole transforms into a froglet. Tadpole development is quite slow; it may take between one to three years to begin transformation from the tadpole stage into the adult stage. Adults reach sexual maturity after an additional two years.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

About four days after fertilization, spotted tadpoles emerge from the floating egg mass. The tadpoles have gills and a tail, which eventually disappears as the tadpole transforms into a froglet. Tadpole development is quite slow; it may take between one to three years to begin transformation from the tadpole stage into the adult stage. Adults reach sexual maturity after an additional two years.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average bullfrog lives seven to nine years in the wild. The record lifespan of an animal in captivity is 16 years.

Range lifespan

Status: captivity:
16 (high) years.

Typical lifespan

Status: wild:
7 to 9 years.

Average lifespan

Status: wild:
7-9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

The average bullfrog lives seven to nine years in the wild. The record lifespan of an animal in captivity is 16 years.

Range lifespan

Status: captivity:
16 (high) years.

Typical lifespan

Status: wild:
7 to 9 years.

Average lifespan

Status: wild:
7-9 years.

Average lifespan

Sex: male

Status: captivity:
6.6 years.

Average lifespan

Status: captivity:
8.0 years.

Average lifespan

Status: captivity:
16.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 16 years (captivity) Observations: Increased reproductive output with age has been documented in these animals (Caleb Finch 1990). Record longevity may be underestimated. In the wild, mortality rates appear to rise at later ages. Growth rates also appear to decline (Kara 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating System: polygynous

Breeding takes place in May to July in the north, and from February to October in the south. Fertilization is external, with the females depositing as many as 20,000 eggs in a foamy film in quiet, protected waters. Fertilization is usually, but not always, by one male. Tadpoles emerge about four days after fertilization. These tadpoles may remain in the tadpole stage for almost 3 years before transforming into frogs. Adults reach sexual maturity after 3 to 5 years.

Breeding interval: Bullfrogs breed once each year.

Breeding season: May to July in the north and February to October in the south

Range number of offspring: 20000 (high) .

Average time to hatching: 4 days.

Range age at sexual or reproductive maturity (female): 3 to 5 years.

Range age at sexual or reproductive maturity (male): 3 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Females provide the eggs with yolk before they are laid. There is no parental involvement in offspring after the eggs are laid. Newly hatched tadpoles can take care of themselves right away.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating System: polygynous

Breeding takes place in May to July in the north, and from February to October in the south. Fertilization is external, with the females depositing as many as 20,000 eggs in a foamy film in quiet, protected waters. Fertilization is usually, but not always, by one male. Tadpoles emerge about four days after fertilization. These tadpoles may remain in the tadpole stage for almost 3 years before transforming into frogs. Adults reach sexual maturity after 3 to 5 years.

Breeding interval: Bullfrogs breed once each year.

Breeding season: May to July in the north and February to October in the south

Range number of offspring: 20000 (high) .

Average time to hatching: 4 days.

Range age at sexual or reproductive maturity (female): 3 to 5 years.

Range age at sexual or reproductive maturity (male): 3 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Females provide the eggs with yolk before they are laid. There is no parental involvement in offspring after the eggs are laid. Newly hatched tadpoles can take care of themselves right away.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding occurs when water temperatures are relatively warm, mainly in May-July in the northern part of the range, primarily late spring to late summer in Georgia, and mainly March through summer in Louisiana. Individual females produce 1-2 clutches/year. Larvae hatch in 4-20 days. In most areas, larvae overwinter at least once before metamorphosing, but larvae metamorphose in less than a year in warm climates (e.g., 5-6 months in Louisiana; less than 6 months in Hawaii, Tinker 1941). Individuals become sexually mature an average of 1-5 years after metamorphosis, with the oldest ages of maturity occurring in environments with the shortest growing seasons (e.g., average of 5 years after metamorphosis in central Ontario females); in a particular location, males tend to mature a year or so earlier than do females (Shirose et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rana catesbeiana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTGTACTTAGTCTTCGGTGCNTGAGCCGGGATAGTCGGAACAGCCCTAAGTCTGCTGATTCGCGCAGAACTAAGCCAGCCAGGAACCCTCCTTGGCGACGATCAAATCTACAATGTTATCGTTACTGCTCACGCATTTGTTATAATTTTCTTCATAGTTATGCCTATCCTAATTGGAGGCTTTGGAAACTGACTAGTCCCCTTAATGATTGGGGCCCCTGATATAGCCTTCCCCCGAATAAATAACATGAGCTTTTGACTTCTCCCTCCATCCTTCTTTCTTCTACTAGCTTCTTCCACAGTTGAAGCCGGGGCTGGCACAGGCTGAACAGTCTACCCCCCTCTAGCTGGGAACCTAGCCCACGCAGGCCCATCTGTAGATCTAGCTATTTTCTCGCTACATTTAGCTGGGGTATCCTCTATTCTAGGGGCTATTAATTTTATTACTACAATTATTAATATGAAGCCATCCTCAACTACACAATACCAAACACCTTTATTCGTCTGATCAGTTTTAATTACCGCAGTTCTACTACTTTTATCCCTTCCAGTATTAGCTGCCGGAATTACTATACTCCTCACAGATCGAAACCTAAACACCACATTTTTCGACCCGGCAGGAGGCGGAGATCCTGTTCTTTATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rana catesbeiana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Bullfrogs are dealing fairly well with the changes in the environment that have occurred due to human influences, and they are becoming increasingly common in areas that have been modified by humans. Bullfrogs have a much higher critical thermal maximum than most other frogs, meaning that they are able to thrive in higher water temperatures. Bullfrogs have a longer breeding season and a high rate of surviving through the tadpole stage, which allows them to be more successful than other frogs. In many areas, such as California and Colorado, bullfrogs are driving other frog populations to extinction. An interesting reason to explain why bullfrogs in California might have an advantage over other species that are native to that state is that bullfrogs evolved with many different kinds of fish in eastern North America. For many years in California people have been introducing new fish species that are predators of frogs. Bullfrogs have evolved ways to avoid being eaten by fish, such as tadpoles that are not active much of the time which reduces their exposure to predators. Native frog species of California are also suffering a decline because bullfrogs are intense predators on frog populations.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Santos-Barrera, G., Hammerson, G., Hedges, B., Joglar, R., Inchaustegui, S., Lue Kuangyang, Chou Wenhao, Gu Huiqing, Shi Haitao, Diesmos, A., Iskandar, D., van Dijk, P.P., Masafumi Matsui, Schmidt, B., Miaud, C. & Martínez-Solano, I.

Reviewer/s
Cox, N. & Temple, H.J. (Global Amphibian Assessment)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining to qualify for listing in a more threatened category.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bullfrogs do well with changes in the environment that have occured due to human modification, and are becoming increasingly common in areas modified by humans. Bullfrogs have a much higher critical thermal maximum than most other frogs, meaning that they are able to thrive in higher water temperatures. Bullfrogs have a longer breeding season and a higher rate of pre-metamorphic survivorship, which also allows them to be more successful than other frogs. In some areas, such as California, bullfrogs are driving other frog populations to extinction. One possible reason to explain why bullfrogs in California might have an advantage over other species native to that state is that bullfrogs evolved with a diverse predatory fish fauna in eastern North America. In California there have been attempts to control bullfrog populations by introducing new fish species that are their predators. Bullfrogs have evolved mechanisms to avoid predation by fish, such as less palatable eggs and tadpoles, and tadpoles that are not active much of the time, which reduces their exposure to predators. Native frog species of California are also suffering a decline because bullfrogs are efficient predators of frogs and tadpoles.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Moderate to broad.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

The breeding season begins in spring and lasts throughout early summer, but can vary according to latitude. Bullfrogs breed on the surface of shallow, permanent water covered with vegetation. Males make distinctive resonant low-pitched calls with a single note that lasts 0.8 seconds at a frequency of 1.0 kHz. Males also display aggressive territorial behavior in defending good oviposition sites. One clutch consists of up to 20,000 eggs and one quarter of the female's body weight. Duration of the larval stage varies greatly depending on the temperature. Metamorphosis is not synchronized.Bullfrogs are often the predominant species in interspecific relationships, contributing to the decline of other amphibians and excluding them from the habitat. Bullfrog juveniles are adept at colonizing new ponds, and they are believed to disperse throughout an environment this way. Bullfrogs are opportunistic predators, and prey on any animal smaller than themselves. While smaller bullfrogs eat mostly insects, larger bullfrogs consume aquatic species such as fish and crayfish, mice, and other frogs (for a video, see the account on Bufo californicus). Cannibalism is prevalent in a bullfrog's diet, sometimes comprising up to 80% of its food.

For additional details on Life History, please refer to the Lannoo account (click on yellow tab above).

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
  • Maeda, N. and Matsui, M. (1990). Frogs and Toads of Japan, 2nd edition. Bun-Ichi Sogo Shuppan Co., Ltd., Tokyo, Japan.
  • Akmentins, M. S. and Cardozo, D. E. (2009). ''American bullfrog Lithobates catesbeianus (Shaw, 1802) invasion in Argentina.'' Biological Invasions, DOI: 10.1007/s10530-009-9515-3.
  • Bai, C., Garner, T. W. J., and Li, Y. (2010). ''First evidence of Batrachochytrium dendrobatidis in China: discovery of chytridiomycosis in introduced American bullfrogs and native amphibians in the Yunnan Province, China .'' EcoHealth, Published online 06 April 2010. DOI: 10.1007/s10393-010-0307-0.
  • Barrasso, D. A., Cajade, R., Nenda, S.J, Baloriani, G., and Herrera, R. (2009). ''Introduction of the American bullfrog Lithobates catesbeianus (Anura: Ranidae) in natural and modified environments: an increasing conservation problem in Argentina.'' South American Journal of Herpetology, 4, 69-75.
  • Borges-Martins, M., Di-Bernardo, M., Vinciprova, G., and Measey, J. (2002). ''Geographic distribution. Rana catesbeiana.'' Herpetological Review, 33, 319.
  • Cisneros-Heredia, D.F. (2004). ''Rana catesbeiana (bullfrog). Ecuador: provincia de Napo.'' Herpetological Review, 35, 406.
  • Daszak, P., Strieby, A., Cunningham, A.A., Longcore, J.E., Brown, C.C., and Porter, D. (2004). ''Experimental evidence that the bullfrog (Rana catesbeiana) is a potential carrier of chytridiomycosis, an emerging funcal disease of amphibians.'' Herpetological Journal, 14, 201-207.
  • Daza, J., and Castro, F. (1999). ''Feeding habits of the bullfrog (Rana catesbeiana) Anura: Ranidae, in the Cauca Valley, Colombia.'' Revista de la Academia Colombiana de Ciencias, 23, 265-274.
  • Fa, J.E., Soy, J.P., Capote, R., Martínez, M., Fernández, I., Avila, A., Rodríguez, D., Rodríguez, A., Cejas, F., and Brull, G. (2002). ''Biodiversity of Sierra del Cristal, Cuba: first insights.'' Oryx, 36(4), 389-395.
  • Ficetola, G. F., Coïc, C., Detaint, M., Berroneau, M., Lorvelec, O., and Miaud, C. (2006). ''Pattern of distribution of the American bullfrog Rana catesbeiana in Europe.'' Biological Invasions, 9, 767-772.
  • Garner, T.W.J., Perkins, M.W., Govindarajulu, P., Seglie, D., Walker, S., Cunningham, A.A., and Fisher, M.C. (2006). ''The emerging amphibian pathogen Batrachochytrium dendrobatidis globally infects introduced populations of the North American bullfrog, Rana catesbeiana.'' Biology Letters, 2, 455-459.
  • Giovanelli, J.G.R., Haddad, C.F.B., and Alexandrino, J. (2008). ''Predicting the potential distribution of the alien invasive bullfrog (Lithobates catesbeianus) in Brazil.'' Biological Invasions, 10, 585-590.
  • Grant, K. P., and Licht, L. R. (1995). "Effects of ultraviolet radiation on life-history stages of anurans from Ontario, Canada." Canadian Journal of Zoology, 73(12), 2292-2301.
  • Hanselmann, R., Rodríguez, A., Lampo, M., Fajardo-Ramos, L., Aguirre, A. A., Kilpatrick, A. M., Rodríguez, J., and Daszak, P. (2004). ''Presence of an emerging pathogen of amphibians in introduced bullfrogs Rana catesbeiana in Venezuela.'' Biological Conservation, 120, 115-119.
  • Hirai, T. (2004). ''Diet composition of introduced bullfrog, Rana catesbeiana, in the Mizorogaike Pond of Kyoto, Japan.'' Ecological Research, 19, 375-380.
  • Hoffman, W.H. and Noble, G.K. (1927). ''The Bullfrog in Cuba.'' Copeia, (163), 59-60.
  • Hsu, C. and Liang, H. (1970). ''Sex races of Rana catesbeiana in Taiwan.'' Herpetologica, 26(2), 214-221.
  • Jennings, M. (1985). ''Pre-1900 overharvest of California Red-legged Frogs (Rana aurora draytonii): The inducement for bullfrog (Rana catesbeiana) introduction.'' Herpetological Review, 31(1), 94-103.
  • Kaefer Í.L., Boelter, R.A., and Cechin, S.Z. (2007). ''Reproductive biology of the invasive bullfrog Lithobates catesbeianus in southern Brazil.'' Annales Zoologici Fennici, 44, 435-444.
  • Kiesecker, J. M., and Blaustein, A. R. (1997). ''Population differences in responses of red-legged frogs (Rana aurora) to introduced bullfrogs.'' Ecology (Washington D C), 78(6), 1752-1760.
  • Lanza, B. (1962). ''On the Introduction of Rana ridibunda Pallas and Rana catesbeiana Shaw in Italy.'' Copeia, 1962(3), 642-643.
  • Laufer, G., Canavero, A., Núñez, D., and Maneyro, R. (2008). ''Bullfrog (Lithobates catesbeianus) invasion in Uruguay.'' Biological Invasions, 10, 1183-1189.
  • Lever, C. (2003). Naturalized Reptiles and Amphibians of the World. Oxford University Press, Oxford.
  • Li, Y.M., Wu, Z.J., and Duncan, R.P. (2006). ''Why islands are easier to invade: human influences on bullfrog invasion in the Zhoushan archipelago and neighboring mainland China.'' Oecologia, 148, 129-136.
  • Liu, X. and Li, Y. (2009). ''Aquaculture enclosures relate to the establishment of feral populations of introduced species.'' PLoS One, 4:e6199 doi:10.1371/journal.pone.0006199.
  • Lynch, J.D. (2006). ''The amphibian fauna in the Villavicencio region of Eastern Colombia.'' Caldasia, 28(1), 135-155.
  • Lynch, J.D. (2006). ''The tadpoles of frogs and toads found in the lowlands of northern Colombia.'' Revista de la Academia Colombiana de Ciencias, 30(116), 443-457.
  • Mahon, R. and Aiken, K. (1977). ''The Establishment of the North American Bullfrog, Rana catesbeiana (Amphibia, Anura, Ranidae) in Jamaica.'' Journal of Herpetology, 11(2), 197-199.
  • Mazzoni, R., Cunningham, A.A., Daszak, P., Apolo, A., Perdomo, E., and Speranza, G. (2003). ''Emerging pathogen of wild amphibians in frogs (Rana catesbeiana) farmed for international trade.'' Emerging Infectious Diseases, 9(8), 995-998.
  • Minowa, S., Senga, Y., and Miyashita, T. (2008). ''Microhabitat Selection of the Introduced Bullfrogs (Rana catesbeiana) in Paddy Fields in Eastern Japan.'' Current Herpetology, 27(2), 55-59.
  • Mueses-Cisneros, J.J. and Ballén, G. (2007). ''Un nuevo caso de alerta sobre posible amenaza a una fauna nativa de anfibios en Colombia: Primer reporte de la rana toro (Lithobates catesbeianus) en la sabana de Bogotá.'' Revista de la Academia Colombiana de Ciencias, 31(118), 65-166.
  • Neveu, A., Bergot, F., and and Vigneux, E. (1997). ''The introduction of allochthonous green frog species into France, two dissimilar cases: R. catesbeiana and the foreign taxa of the esculenta complex.'' ''.'' Bulletin Francais de la Peche et de la Pisciculture,
  • Okada, Y. (1927). ''Frogs in Japan.'' Copeia, (158), 161-166.
  • Pereyra, M. O., Baldo, D., and Krauczuc, E. R. (2006). ''La ‘‘rana toro’’ en la Selva Atlántica Interior Argentina: un nuevo problema de conservación.'' Cuadernos de Herpetología, 20, 37-40.
  • Perez, M. E. (1951). ''The food of Rana catesbeiana Show in Puerto Rico.'' Herpetologica, 7(3), 102-104.
  • Ruiz, A., and Rueda-Almonacid, J. V. (2008). ''Batrachochytrium dendrobatidis and chytridiomycosis in anuran amphibians of Colombia.'' EcoHealth, 5, 27-33.
  • Sampedro, A., Montanez, L., and Suarez, O. (1985). ''Food of Rana catesbeiana at two zones of capture in Cuba.'' Ciencias Biologicas, (13), 59-66.
  • Sanabria, E. A., Quiroga, L. B., and Acosta, J. C. (2005). ''Introducción de Rana catesbeiana (rana toro), en ambientes precordilleranos de la provincia de San Juan, Argentina.'' Multequina, 14, 65-68.
  • Scalera, R. (2007). ''Virtues and shortcomings of EU legal provisions for managing NIS: Rana catesbeiana and Trachemys scripta elegans as case studies.'' Biological Invaders in Inland Waters: Profiles, Distribution, and Threats. F. Gherardi, eds., Springer Netherlands, 669-678.
  • Schloegel, L.M., Picco, A.M., Kilpatrick, A.M., Davies, A.J., Hyatte, A.D., and Daszak, P. (2009). ''Magnitude of the US trade in amphibians and presence of Batrachochytrium dendrobatidis and ranavirus infection in imported North American bullfrogs (Rana catesbeiana).'' Biological Conservation, 142, 1420-1426.
  • Stumpel, A.H.P. (1992). ''Successful reproduction of introduced bullfrogs Rana catesbeiana in northwestern Europe: A potential threat to indigenous amphibians.'' Biological Conservation, 60(1), 61-62.
  • Sánchez, D., Chacón-Ortiz, A., León, F., Han, B.A., and Lampo, M. (2008). ''Widespread occurrence of an emerging pathogen in amphibian communities of the Venezuelan Andes.'' Biological Conservation, 141, 2898-2905.
  • Thorn, Robert (1968). Les Salamandres d'Europe, d'Asie et d'Afrique du nord. Lechevalier, Paris.
  • Une, Y., Sakuma, A., Matsueda, H., Nakai, K., and Murakami, M. (2009). ''Ranavirus outbreak in North American Bullfrogs (Rana catesbeiana), Japan, 2008.'' Emerging Infectious Diseases, 15(7), 1146-1147.
  • Wang, X., Ma, L., Wu, M., and Liu, M. (1992). ''Study history and geographic distribution of Ranodon sibiricus.'' Foreign Animal Husbandry - Herbivorous Livestock. Biology Supplement, Urumqi, 59-61.
  • Wang, Y., Guo, Z., Pearl, C.A., and Li, Y. (2007). ''Body size affects the predatory interactions between introduced American Bullfrogs (Rana catesbeiana) and native anurans in China: an experimental study.'' Journal of Herpetology, 41(3), 514-520.
  • Wu, Z., Li, Y., Wang, Y., and Adams, M.J. (2005). ''Diet of introduced bullfrogs (Rana catesbeiana): predation on and diet overlap with native frogs on Daishan Island, China.'' Journal of Herpetology, 39(4), 668-674.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are thousands of occurrences of this species. It is highly abundant and its global population is increasing. Although some of the populations in Europe of this species are increasing, other introductions not have become fully established. In Asia, it is only present in isolated pockets. Animals have been deliberately introduced to northern Thailand in the hope of augmenting native frog production. Farmed animals are exported alive to East Asia (Pariyanonth and Daorerk 1995, Lim and Lim 1992) and can escape or be released to become established. A growing population is now established in the Venezuelan Andes (C. Gottberg and A. Diaz pers. comm.), near the town of Jají, in Mérida State.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: Likely increasing.

Global Long Term Trend: Increase of >25%

Comments: Has increased in all aspects through introductions and subsequent unaided spread.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Life History, Abundance, Activity, and Special Behaviors

Introduced populations present great threats to native frogs, due to the bullfrog's voracious feeding habits and the size and competitive ability of the larvae. Although aquatic species and frogs constitute a major portion of its diet, other native species are also likely affected because bullfrogs have been reported to eat snake, birds, and small mammals as well. Furthermore, as bullfrogs are being introduced worldwide, they serve as carriers of the pathogenic fungus Batrachochytrium dendrobatidis (chytrid), which causes the lethal disease chytridiomycosis, believed to be a major factor in recent global amphibian declines (e.g., Garner et al. 2006 found that bullfrogs were consistently chytrid-infected in multiple countries). Infected bullfrogs appear to be rather resistant to chytridiomycosis, whereas the disease is lethal to many other amphibians, making the bullfrog an efficient carrier of the chytrid fungus (Daszak et al. 2004).Argentina: Introduced populations of R. catesbeiana have been recently reported in San Juan (Sanabria et al. 2005), Misiones (Pereyra et al. 2006), Buenos Aires (Barrasso et al. 2009), and Córdoba and Salta provinces (Akmentins and Cardozo 2009). Most introductions come from intentional or incidental releases from breeding facilities, except for Misiones where the bullfrogs there are believed to be the result of the range expansion of a Brazilian population (Pereyra et al. 2006). The bullfrog's adaptive ability has allowed it to invade a diversity of environments and disperse throughout Argentina. It has been observed to prey on native vertebrates. Although it has not yet been identified as a chytrid carrier in Argentina, its negative influence as a potential disease carrier remains to be further examined. One Argentinian species greatly affected by the presence of R. catesbeiana is Leptodactylus ocellatus, a generalist predator who shares a similar diet with R. catesbeiana and whose larvae are being preyed on by bullfrogs (Barrasso et al. 2009). The increase in number of captive-breeding facilities due to a large demand for human consumption and the lack of effective governmental control thereof are serious concerns in Argentina (Akmentins and Cardozo 2009).Belgium: Bullfrog larvae have been imported on a large scale for trade in pet shops. Many specimens were released into the wild and were able to survive to reach adulthood (Stumpel 1992). Free-ranging populations of R. catesbeiana have been observed in Belgium (Ficetola et al. 2006). Conservationists are concerned about the potential threat of R. catesbeiana to indigenous species, in particular Rana esculenta, which occupies the same niche (Stumpel 1992).Brazil: Introductions date as early as the 1930's in association with aquaculture. Except for the coldest months of the year, R. catesbeiana reproduces continuously during warm weather such as that of Brazil (Kaefer et al. 2007). This characteristic is shared with the cane toad (Bufo marinus, another invasive species in Brazil. The degree of native population loss brought on by the introduction of bullfrogs is still being speculated, but the reproductive ability of R. catesbeiana is worrisome. Giovanelli et al. (2008) propose that the Brazilian Atlantic Forest biodiversity hotspot in southern and southeastern Brazil may be the most susceptible to invasion, based on ecological niche modeling. Furthermore, a chytridiomycosis outbreak in an Uruguayan farm with stock that originated from Brazil suggests that Brazilian rearing facilities may contain specimens that are infected by B. dendrobatidis, and could thus be harmful to native anuran species if allowed to escape (Mazzoni et al. 2003). These authors urge the Brazilian government to regulate human introductions of R. catesbeiana more strictly.China: R. catesbeiana was first introduced to China in 1959. Since then, breeding populations have been established in most provinces of mainland China including Yunnan, Sichuan, Shanxi, and Zhejian Provinces (Wang et al. 2007). The bullfrog has been widely bred for both local consumption and for export since the 1980s (Wu et al. 2005). Escapes occur from rearing pens or in the process of transportation or trade (Wu et al. 2005; Li et al. 2006; Liu and Li 2009). R. catesbeiana poses a great threat to native anuran species due to its voracious feeding habits. Its body size is also much larger than any other native species, and it is known to consume at least 4 of the 10 native species in the Zhoushan archipelago of Zhejian Province. Wang et al. (2007) quantified the predatory impacts of R. catesbeiana and found that body size plays an important role in predator-prey interactions with native anurans of China. It has been suggested that the primary threat posed by juvenile bullfrogs is food competition, whereas the primary threat posed by adult bullfrogs is predation (Wu et al. 2005). Chytridiomycosis has also been reported from introduced bullfrogs (wild, farmed, and market-sold) in Yunnan province, as well as in native amphibians, suggesting that farmed and escaped bullfrogs may present a major threat to native species by carrying disease as well (Bai et al. 2010).Colombia: R. catesbeiana was introduced into Colombia in the 1990s and inhabits the inter-Andean valleys (Lynch 2006a). The bullfrog was originally introduced in hopes of exploiting it for food consumption, but it is now a biological plague in the valley of the Río Cauca and in certain localities on the western slopes of the Cordillera Oriental in Cundinamarca, as well as the lowlands of the Caribbean Region (Lynch 2006b). Its diet in Colombia has been reported to consist mostly of insects (56%), whereas vertebrates constitute only 2% of the diet (Daza and Castro 1999). Many endogenous Colombian frog species have been impacted by the lethal fungal disease chytridiomycosis; R. catesbeiana is a potential vector in Colombia of the fungal pathogen Batrachochytrium dendrobatidis (Ruiz and Rueda-Almonacid 2008).Cuba: In the 1920s, both adult and larval bullfrogs were observed in two small ponds near Rincon, a small village approximately 50 kilometers from Havana. It was not deemed a threat to the ecological system in Cuba at that time because it was thought that the bullfrog, which had a larval period of more than one year, would not be able to breed in the many temporary pools in Cuba (Hoffman and Nobel 1927). Now, bullfrogs are present throughout Cuba except the Sierra del Cristal National Park (Fa et al. 2002).France: Acclimatized R. catesbeiana populations have been recorded in France beginning in the 1960s (Ficetola et al. 2006). It was observed to be occurring near Bordeaux in 1997, in a limited area of gravel pits (Neveu et al. 1997). Currently, southwest France is the European area where the strongest expansion of R. catesbeiana is taking place; it also represents the second largest area in Europe where R. catesbeiana is present, constituting about 2,000 square km. Only three breeding populations have been reported, but observations of isolated individuals suggest that translocations are frequent. These secondary translocations facilitated by humans can substantially increase the rate of population expansion, which may further enhance capture and translocation. A large-scale eradication plan is being carried out in southwest France, including trapping of both adults and tadpoles, and education of local people (Ficetola et al. 2006). Unfortunately, samples of introduced populations of bullfrogs in Loir et Cher are found to be infected with B. dendrobatidis (Garner et al. 2006).Italy: R. catesbeiana was introduced to Italy in the 1930s, making it the first European country where this species was successfully introduced (Ficetola 2006). It is well established in northern Italy and breeds abundantly. Provinces affected at least since 1960 include Mantova, Pavia, and Verona (Lanza 1962). In northern Italy, the R. catesbeiana population does not appear to have expanded since the 1980's. Some populations are known to be infected by B. dendrobatidis (Ficetola 2006).Jamaica: Twenty-two R. catesbeiana specimens were first introduced to the Great Morass of the Black River of Jamaica in 1967 for commercial purposes. During the next 4 years it has spread in all directions from the point of introduction and eventually established themselves in the Upper Morass. Although no quantitative population estimates have been conducted, R. catesbeiana appears to have established extensive populations at suitable habitat areas of the island. Its expansion in Jamaica is further facilitated by temperature and lack of competition; the frogs breed continually throughout the year and displace local anurans such as Bufo marinus through habitat competition (Mahon and Aiken 1977).Japan: R. catesbeiana was first introduced to Japan by a professor at the Imperial University of Tokyo (now Tokyo University) around 1918 (Okada 1927). The frog was already well integrated into the Japanese herpetofauna by 1958-1959, approximately 40 years after its introduction (Telford 1960). R. catesbeiana is firmly established in at least the Kanto and Kansai Plains, the two largest lowland regions of Japan, and many local people recognize it as the "food frog" (Telford 1960). R. catesbeiana resides in freshwater habitats such as rice fields, ponds, and rivers. Studies reveal that it may negatively affect native anuran species such as the endangered Rana porosa brevipoda through predation and food competition. The removal of bullfrogs, along with other invasive exotic species, is highly recommended for conservation of local vertebrates (Hirai 2004). Studies reveal R. catesbeiana populations expanding in paddy fields prefer microhabitat with deep water; managing habitats to reduce immigration of bullfrogs may help prevent the spread of this invasive species (Minowa et al. 2008). A recent die-off of R. catesbeiana from ranavirus lasted from September through October 2008 in a 1000-m2 pond in western Japan. Infected feral populations of R. catesbeiana presents a serious threat to Japanese amphibians (Une et al. 2009). Fortunately, B. dendrobatidis does not seem to have infected introduced populations of R. catesbeiana, and no die-off from chytridiomycosis has been reported (Garner et al. 2006).Netherlands: bullfrogs were imported for trade in pet shops in the 1980s. Many specimens are released into the wild as larvae or freshly metamorphosed juveniles. In 1991, a reproducing population since 1989 was recorded in a garden pond in the city of Breda (Stumpel 1992). Eradication programs have been carried out in the Netherlands (Scalera 2007).Puerto Rico: in 1935, the Insular Department of Agriculture and Commerce of Puerto Rico introduced a total of 40 R. catesbeiana specimens from Florida to a specially constructed pond at Rio Piedras. The population expanded successfully, and by 1951 had invaded the neighboring towns of Mayaguez and Humacao. It did not appear to prey on other amphibians, but did consume a diversity of local insects (Perez 1951).Taiwan: the species was introduced into Taiwan from the United States via Japan in 1924 and 1951 (Hsu et al. 1970). The country actively participates in the production of bullfrog meat, and in fact is the world's top exporter of ranids. However, its native amphibians are at risk of infection by B. dendrobatidis. Taiwan's subtropical climate also creates a suitable environment for the growth of this pathogen (Schloegel et al. 2009).Uruguay: R. catesbeiana was first introduced in 1987 for farming purposes, but at present most of the farms have closed down. A feral population was reported in 2008 at one of the closed farms at Rincón de Pando. Establishment of the population appears to be at an early stage but is potentially dangerous, as the invaded pond exhibits significant differences from non-invaded ones. For example, R. catesbeiana seems to have some type of positive interaction with fish, because the body size of common fish species are higher in the invaded pond where aquatic vertebrate richness is also highest. Furthermore, R. catesbeiana is the highest fraction of vertebrate biomass, displacing native amphibian species such as Hypsiboas pulchellus. Other negative effects on local amphibian fitness include reducing the premetamorphic period due to competition and predation pressures. The high level of anthropogenic disturbance and large amount of suitable habitat in Uruguay may facilitate R. catesbeiana expansion (Laufer et al. 2008). Recent mass deaths occurred at a large farming facility for bullfrogs 46 km from Montevideo, Uruguay, and the cause is suspected to be chytridiomycosis (Mazzoni et al. 2003). This is potentially dangerous to native anurans if R. catesbeiana were to serve as a carrier of B. dendrobatidis. However, no control program was implemented for these closed farms. Laufer et al. (2008) recommend taking measures against the population expansion as well as searching for new invasion points.Venezuela: the bullfrog was introduced as a food source around the 1990s, and has established dense populations in 14 natural and artificial ponds as far as 4.3 km away from the point of introduction. Examination of R. catesbeiana specimens in the Venezuelan Andes suggests that the bullfrog acts as a pathogen carrier that causes amphibian population declines in Venezuela (Hanselmann et al. 2004). 79.9% of the bullfrogs surveyed are infected with B. dendrobatidis and carrying an average of 2299 zoospores (Sánchez et al. 2008). Of the infected frogs, 96% appear otherwise healthy, making R. catesbeiana an efficient reservoir host. It is likely that year-round bullfrog breeding will heighten the impact of chytridiomycosis (Hanselmann et al. 2004). Chytridiomycosis is detected in native species occuring in pond, stream and terrestrial habitats from 80-2600 m. Dendropsophus meridensis, an endangered native species sympatric with R. catesbeiana, shows the highest infection prevalence and mean zoospore load (26.7% and 2749 zoospores). Although no clinical signs of disease were detected, environmental stress could potentially increase its vulnerability to the pathogen (Sánchez et al. 2008). B. dendrobatidis is also known to migrate through autoclaved late water to reach distant amphibian populations outside the range of R. catesbeiana dispersal (Hanselmann et al. 2004).R. catesbeiana has been introduced worldwide, and AmphibiaWeb is in the process of editing the Trends and Threats section of this page for each country.

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
  • Maeda, N. and Matsui, M. (1990). Frogs and Toads of Japan, 2nd edition. Bun-Ichi Sogo Shuppan Co., Ltd., Tokyo, Japan.
  • Akmentins, M. S. and Cardozo, D. E. (2009). ''American bullfrog Lithobates catesbeianus (Shaw, 1802) invasion in Argentina.'' Biological Invasions, DOI: 10.1007/s10530-009-9515-3.
  • Bai, C., Garner, T. W. J., and Li, Y. (2010). ''First evidence of Batrachochytrium dendrobatidis in China: discovery of chytridiomycosis in introduced American bullfrogs and native amphibians in the Yunnan Province, China .'' EcoHealth, Published online 06 April 2010. DOI: 10.1007/s10393-010-0307-0.
  • Barrasso, D. A., Cajade, R., Nenda, S.J, Baloriani, G., and Herrera, R. (2009). ''Introduction of the American bullfrog Lithobates catesbeianus (Anura: Ranidae) in natural and modified environments: an increasing conservation problem in Argentina.'' South American Journal of Herpetology, 4, 69-75.
  • Borges-Martins, M., Di-Bernardo, M., Vinciprova, G., and Measey, J. (2002). ''Geographic distribution. Rana catesbeiana.'' Herpetological Review, 33, 319.
  • Cisneros-Heredia, D.F. (2004). ''Rana catesbeiana (bullfrog). Ecuador: provincia de Napo.'' Herpetological Review, 35, 406.
  • Daszak, P., Strieby, A., Cunningham, A.A., Longcore, J.E., Brown, C.C., and Porter, D. (2004). ''Experimental evidence that the bullfrog (Rana catesbeiana) is a potential carrier of chytridiomycosis, an emerging funcal disease of amphibians.'' Herpetological Journal, 14, 201-207.
  • Daza, J., and Castro, F. (1999). ''Feeding habits of the bullfrog (Rana catesbeiana) Anura: Ranidae, in the Cauca Valley, Colombia.'' Revista de la Academia Colombiana de Ciencias, 23, 265-274.
  • Fa, J.E., Soy, J.P., Capote, R., Martínez, M., Fernández, I., Avila, A., Rodríguez, D., Rodríguez, A., Cejas, F., and Brull, G. (2002). ''Biodiversity of Sierra del Cristal, Cuba: first insights.'' Oryx, 36(4), 389-395.
  • Ficetola, G. F., Coïc, C., Detaint, M., Berroneau, M., Lorvelec, O., and Miaud, C. (2006). ''Pattern of distribution of the American bullfrog Rana catesbeiana in Europe.'' Biological Invasions, 9, 767-772.
  • Garner, T.W.J., Perkins, M.W., Govindarajulu, P., Seglie, D., Walker, S., Cunningham, A.A., and Fisher, M.C. (2006). ''The emerging amphibian pathogen Batrachochytrium dendrobatidis globally infects introduced populations of the North American bullfrog, Rana catesbeiana.'' Biology Letters, 2, 455-459.
  • Giovanelli, J.G.R., Haddad, C.F.B., and Alexandrino, J. (2008). ''Predicting the potential distribution of the alien invasive bullfrog (Lithobates catesbeianus) in Brazil.'' Biological Invasions, 10, 585-590.
  • Grant, K. P., and Licht, L. R. (1995). "Effects of ultraviolet radiation on life-history stages of anurans from Ontario, Canada." Canadian Journal of Zoology, 73(12), 2292-2301.
  • Hanselmann, R., Rodríguez, A., Lampo, M., Fajardo-Ramos, L., Aguirre, A. A., Kilpatrick, A. M., Rodríguez, J., and Daszak, P. (2004). ''Presence of an emerging pathogen of amphibians in introduced bullfrogs Rana catesbeiana in Venezuela.'' Biological Conservation, 120, 115-119.
  • Hirai, T. (2004). ''Diet composition of introduced bullfrog, Rana catesbeiana, in the Mizorogaike Pond of Kyoto, Japan.'' Ecological Research, 19, 375-380.
  • Hoffman, W.H. and Noble, G.K. (1927). ''The Bullfrog in Cuba.'' Copeia, (163), 59-60.
  • Hsu, C. and Liang, H. (1970). ''Sex races of Rana catesbeiana in Taiwan.'' Herpetologica, 26(2), 214-221.
  • Jennings, M. (1985). ''Pre-1900 overharvest of California Red-legged Frogs (Rana aurora draytonii): The inducement for bullfrog (Rana catesbeiana) introduction.'' Herpetological Review, 31(1), 94-103.
  • Kaefer Í.L., Boelter, R.A., and Cechin, S.Z. (2007). ''Reproductive biology of the invasive bullfrog Lithobates catesbeianus in southern Brazil.'' Annales Zoologici Fennici, 44, 435-444.
  • Kiesecker, J. M., and Blaustein, A. R. (1997). ''Population differences in responses of red-legged frogs (Rana aurora) to introduced bullfrogs.'' Ecology (Washington D C), 78(6), 1752-1760.
  • Lanza, B. (1962). ''On the Introduction of Rana ridibunda Pallas and Rana catesbeiana Shaw in Italy.'' Copeia, 1962(3), 642-643.
  • Laufer, G., Canavero, A., Núñez, D., and Maneyro, R. (2008). ''Bullfrog (Lithobates catesbeianus) invasion in Uruguay.'' Biological Invasions, 10, 1183-1189.
  • Lever, C. (2003). Naturalized Reptiles and Amphibians of the World. Oxford University Press, Oxford.
  • Li, Y.M., Wu, Z.J., and Duncan, R.P. (2006). ''Why islands are easier to invade: human influences on bullfrog invasion in the Zhoushan archipelago and neighboring mainland China.'' Oecologia, 148, 129-136.
  • Liu, X. and Li, Y. (2009). ''Aquaculture enclosures relate to the establishment of feral populations of introduced species.'' PLoS One, 4:e6199 doi:10.1371/journal.pone.0006199.
  • Lynch, J.D. (2006). ''The amphibian fauna in the Villavicencio region of Eastern Colombia.'' Caldasia, 28(1), 135-155.
  • Lynch, J.D. (2006). ''The tadpoles of frogs and toads found in the lowlands of northern Colombia.'' Revista de la Academia Colombiana de Ciencias, 30(116), 443-457.
  • Mahon, R. and Aiken, K. (1977). ''The Establishment of the North American Bullfrog, Rana catesbeiana (Amphibia, Anura, Ranidae) in Jamaica.'' Journal of Herpetology, 11(2), 197-199.
  • Mazzoni, R., Cunningham, A.A., Daszak, P., Apolo, A., Perdomo, E., and Speranza, G. (2003). ''Emerging pathogen of wild amphibians in frogs (Rana catesbeiana) farmed for international trade.'' Emerging Infectious Diseases, 9(8), 995-998.
  • Minowa, S., Senga, Y., and Miyashita, T. (2008). ''Microhabitat Selection of the Introduced Bullfrogs (Rana catesbeiana) in Paddy Fields in Eastern Japan.'' Current Herpetology, 27(2), 55-59.
  • Mueses-Cisneros, J.J. and Ballén, G. (2007). ''Un nuevo caso de alerta sobre posible amenaza a una fauna nativa de anfibios en Colombia: Primer reporte de la rana toro (Lithobates catesbeianus) en la sabana de Bogotá.'' Revista de la Academia Colombiana de Ciencias, 31(118), 65-166.
  • Neveu, A., Bergot, F., and and Vigneux, E. (1997). ''The introduction of allochthonous green frog species into France, two dissimilar cases: R. catesbeiana and the foreign taxa of the esculenta complex.'' ''.'' Bulletin Francais de la Peche et de la Pisciculture,
  • Okada, Y. (1927). ''Frogs in Japan.'' Copeia, (158), 161-166.
  • Pereyra, M. O., Baldo, D., and Krauczuc, E. R. (2006). ''La ‘‘rana toro’’ en la Selva Atlántica Interior Argentina: un nuevo problema de conservación.'' Cuadernos de Herpetología, 20, 37-40.
  • Perez, M. E. (1951). ''The food of Rana catesbeiana Show in Puerto Rico.'' Herpetologica, 7(3), 102-104.
  • Ruiz, A., and Rueda-Almonacid, J. V. (2008). ''Batrachochytrium dendrobatidis and chytridiomycosis in anuran amphibians of Colombia.'' EcoHealth, 5, 27-33.
  • Sampedro, A., Montanez, L., and Suarez, O. (1985). ''Food of Rana catesbeiana at two zones of capture in Cuba.'' Ciencias Biologicas, (13), 59-66.
  • Sanabria, E. A., Quiroga, L. B., and Acosta, J. C. (2005). ''Introducción de Rana catesbeiana (rana toro), en ambientes precordilleranos de la provincia de San Juan, Argentina.'' Multequina, 14, 65-68.
  • Scalera, R. (2007). ''Virtues and shortcomings of EU legal provisions for managing NIS: Rana catesbeiana and Trachemys scripta elegans as case studies.'' Biological Invaders in Inland Waters: Profiles, Distribution, and Threats. F. Gherardi, eds., Springer Netherlands, 669-678.
  • Schloegel, L.M., Picco, A.M., Kilpatrick, A.M., Davies, A.J., Hyatte, A.D., and Daszak, P. (2009). ''Magnitude of the US trade in amphibians and presence of Batrachochytrium dendrobatidis and ranavirus infection in imported North American bullfrogs (Rana catesbeiana).'' Biological Conservation, 142, 1420-1426.
  • Stumpel, A.H.P. (1992). ''Successful reproduction of introduced bullfrogs Rana catesbeiana in northwestern Europe: A potential threat to indigenous amphibians.'' Biological Conservation, 60(1), 61-62.
  • Sánchez, D., Chacón-Ortiz, A., León, F., Han, B.A., and Lampo, M. (2008). ''Widespread occurrence of an emerging pathogen in amphibian communities of the Venezuelan Andes.'' Biological Conservation, 141, 2898-2905.
  • Thorn, Robert (1968). Les Salamandres d'Europe, d'Asie et d'Afrique du nord. Lechevalier, Paris.
  • Une, Y., Sakuma, A., Matsueda, H., Nakai, K., and Murakami, M. (2009). ''Ranavirus outbreak in North American Bullfrogs (Rana catesbeiana), Japan, 2008.'' Emerging Infectious Diseases, 15(7), 1146-1147.
  • Wang, X., Ma, L., Wu, M., and Liu, M. (1992). ''Study history and geographic distribution of Ranodon sibiricus.'' Foreign Animal Husbandry - Herbivorous Livestock. Biology Supplement, Urumqi, 59-61.
  • Wang, Y., Guo, Z., Pearl, C.A., and Li, Y. (2007). ''Body size affects the predatory interactions between introduced American Bullfrogs (Rana catesbeiana) and native anurans in China: an experimental study.'' Journal of Herpetology, 41(3), 514-520.
  • Wu, Z., Li, Y., Wang, Y., and Adams, M.J. (2005). ''Diet of introduced bullfrogs (Rana catesbeiana): predation on and diet overlap with native frogs on Daishan Island, China.'' Journal of Herpetology, 39(4), 668-674.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no threats to this species. Outside its native range, this species is considered a pest. It has been observed predating on native species in Puerto Rico, including on Leptodactylus albilabris, and is a potential predator of other native species throughout its introduced range. It is a possible vector of pathogens.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: There are no threats to this species. Outside of the United States this species is considered a pest.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no measures required to conserve this species. Instead, eradication of this species from its introduced range is a conservation priority. In Asia, this species is believed to have a negative impact on the native amphibian fauna. It should be monitored and controlled. Farming activities should concentrate on native Hoplobatrachus rugulosus. Farming of Lithobates catesbeianus should at least be strictly contained, including water discharges from farms that should be carefully controlled or prevented. Ideally, the farming of the species outside its range should be prohibited. Studies of actual and potential ecological impacts should be conducted, perhaps leading to an elimination programme. Awareness of the potential threat posed by this species to native biodiversity must be raised. The Venezuelan government has taken actions to avoid the spread of this species. There has been an eradication program, with participants from the University of Los Andes at Mérida, the Venezuelan Institute of Scientific Research (IVIC) and the Ministry of Environment, instated at the beginning of 2002.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: See Bury and Whelan (1984) for management information.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Introduced bullfrogs may be driving native frogs to extinction in some areas. Colorado, among many other places, is experiencing problems due to the introduced bullfrog population. Bullfrogs may have been introduced accidentally to trout streams and lakes during the Colorado Divisions of Wildlife fish stocking operations. Bullfrogs occasionally invade fish hatchery ponds and their larvae are caught along with the fishes that are routinely stocked in ponds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

North American bullfrogs help to control insect pests. They are important for medical research because their skeletal, muscle, digestive, and nervous systems are similar to those of other animals. They are often hunted for meat (frog legs).

Positive Impacts: food ; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Introduced bullfrogs may be driving native frogs to extinction in some areas. Colorado, among many other places, is experiencing problems due to the introduced bullfrog population. Bullfrogs may have been introduced accidentally to trout streams and lakes during the Colorado Divisions of Wildlife fish stocking operations. Bullfrogs occasionally invade fish hatchery ponds and their larvae are caught along with the fishes that are routinely stocked in ponds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

North American bullfrogs help to control insect pests. They are important for medical research because their skeletal, muscle, digestive, and nervous systems are similar to those of other animals. They are often hunted for meat (frog legs).

Positive Impacts: food ; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Harvested for meat in many areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Relation to Humans

This large frog is widely farmed for human consumption as a source of meat, as well as for entertainment or as an agent to control pest population (Lever 2003).

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
  • Maeda, N. and Matsui, M. (1990). Frogs and Toads of Japan, 2nd edition. Bun-Ichi Sogo Shuppan Co., Ltd., Tokyo, Japan.
  • Akmentins, M. S. and Cardozo, D. E. (2009). ''American bullfrog Lithobates catesbeianus (Shaw, 1802) invasion in Argentina.'' Biological Invasions, DOI: 10.1007/s10530-009-9515-3.
  • Bai, C., Garner, T. W. J., and Li, Y. (2010). ''First evidence of Batrachochytrium dendrobatidis in China: discovery of chytridiomycosis in introduced American bullfrogs and native amphibians in the Yunnan Province, China .'' EcoHealth, Published online 06 April 2010. DOI: 10.1007/s10393-010-0307-0.
  • Barrasso, D. A., Cajade, R., Nenda, S.J, Baloriani, G., and Herrera, R. (2009). ''Introduction of the American bullfrog Lithobates catesbeianus (Anura: Ranidae) in natural and modified environments: an increasing conservation problem in Argentina.'' South American Journal of Herpetology, 4, 69-75.
  • Borges-Martins, M., Di-Bernardo, M., Vinciprova, G., and Measey, J. (2002). ''Geographic distribution. Rana catesbeiana.'' Herpetological Review, 33, 319.
  • Cisneros-Heredia, D.F. (2004). ''Rana catesbeiana (bullfrog). Ecuador: provincia de Napo.'' Herpetological Review, 35, 406.
  • Daszak, P., Strieby, A., Cunningham, A.A., Longcore, J.E., Brown, C.C., and Porter, D. (2004). ''Experimental evidence that the bullfrog (Rana catesbeiana) is a potential carrier of chytridiomycosis, an emerging funcal disease of amphibians.'' Herpetological Journal, 14, 201-207.
  • Daza, J., and Castro, F. (1999). ''Feeding habits of the bullfrog (Rana catesbeiana) Anura: Ranidae, in the Cauca Valley, Colombia.'' Revista de la Academia Colombiana de Ciencias, 23, 265-274.
  • Fa, J.E., Soy, J.P., Capote, R., Martínez, M., Fernández, I., Avila, A., Rodríguez, D., Rodríguez, A., Cejas, F., and Brull, G. (2002). ''Biodiversity of Sierra del Cristal, Cuba: first insights.'' Oryx, 36(4), 389-395.
  • Ficetola, G. F., Coïc, C., Detaint, M., Berroneau, M., Lorvelec, O., and Miaud, C. (2006). ''Pattern of distribution of the American bullfrog Rana catesbeiana in Europe.'' Biological Invasions, 9, 767-772.
  • Garner, T.W.J., Perkins, M.W., Govindarajulu, P., Seglie, D., Walker, S., Cunningham, A.A., and Fisher, M.C. (2006). ''The emerging amphibian pathogen Batrachochytrium dendrobatidis globally infects introduced populations of the North American bullfrog, Rana catesbeiana.'' Biology Letters, 2, 455-459.
  • Giovanelli, J.G.R., Haddad, C.F.B., and Alexandrino, J. (2008). ''Predicting the potential distribution of the alien invasive bullfrog (Lithobates catesbeianus) in Brazil.'' Biological Invasions, 10, 585-590.
  • Grant, K. P., and Licht, L. R. (1995). "Effects of ultraviolet radiation on life-history stages of anurans from Ontario, Canada." Canadian Journal of Zoology, 73(12), 2292-2301.
  • Hanselmann, R., Rodríguez, A., Lampo, M., Fajardo-Ramos, L., Aguirre, A. A., Kilpatrick, A. M., Rodríguez, J., and Daszak, P. (2004). ''Presence of an emerging pathogen of amphibians in introduced bullfrogs Rana catesbeiana in Venezuela.'' Biological Conservation, 120, 115-119.
  • Hirai, T. (2004). ''Diet composition of introduced bullfrog, Rana catesbeiana, in the Mizorogaike Pond of Kyoto, Japan.'' Ecological Research, 19, 375-380.
  • Hoffman, W.H. and Noble, G.K. (1927). ''The Bullfrog in Cuba.'' Copeia, (163), 59-60.
  • Hsu, C. and Liang, H. (1970). ''Sex races of Rana catesbeiana in Taiwan.'' Herpetologica, 26(2), 214-221.
  • Jennings, M. (1985). ''Pre-1900 overharvest of California Red-legged Frogs (Rana aurora draytonii): The inducement for bullfrog (Rana catesbeiana) introduction.'' Herpetological Review, 31(1), 94-103.
  • Kaefer Í.L., Boelter, R.A., and Cechin, S.Z. (2007). ''Reproductive biology of the invasive bullfrog Lithobates catesbeianus in southern Brazil.'' Annales Zoologici Fennici, 44, 435-444.
  • Kiesecker, J. M., and Blaustein, A. R. (1997). ''Population differences in responses of red-legged frogs (Rana aurora) to introduced bullfrogs.'' Ecology (Washington D C), 78(6), 1752-1760.
  • Lanza, B. (1962). ''On the Introduction of Rana ridibunda Pallas and Rana catesbeiana Shaw in Italy.'' Copeia, 1962(3), 642-643.
  • Laufer, G., Canavero, A., Núñez, D., and Maneyro, R. (2008). ''Bullfrog (Lithobates catesbeianus) invasion in Uruguay.'' Biological Invasions, 10, 1183-1189.
  • Lever, C. (2003). Naturalized Reptiles and Amphibians of the World. Oxford University Press, Oxford.
  • Li, Y.M., Wu, Z.J., and Duncan, R.P. (2006). ''Why islands are easier to invade: human influences on bullfrog invasion in the Zhoushan archipelago and neighboring mainland China.'' Oecologia, 148, 129-136.
  • Liu, X. and Li, Y. (2009). ''Aquaculture enclosures relate to the establishment of feral populations of introduced species.'' PLoS One, 4:e6199 doi:10.1371/journal.pone.0006199.
  • Lynch, J.D. (2006). ''The amphibian fauna in the Villavicencio region of Eastern Colombia.'' Caldasia, 28(1), 135-155.
  • Lynch, J.D. (2006). ''The tadpoles of frogs and toads found in the lowlands of northern Colombia.'' Revista de la Academia Colombiana de Ciencias, 30(116), 443-457.
  • Mahon, R. and Aiken, K. (1977). ''The Establishment of the North American Bullfrog, Rana catesbeiana (Amphibia, Anura, Ranidae) in Jamaica.'' Journal of Herpetology, 11(2), 197-199.
  • Mazzoni, R., Cunningham, A.A., Daszak, P., Apolo, A., Perdomo, E., and Speranza, G. (2003). ''Emerging pathogen of wild amphibians in frogs (Rana catesbeiana) farmed for international trade.'' Emerging Infectious Diseases, 9(8), 995-998.
  • Minowa, S., Senga, Y., and Miyashita, T. (2008). ''Microhabitat Selection of the Introduced Bullfrogs (Rana catesbeiana) in Paddy Fields in Eastern Japan.'' Current Herpetology, 27(2), 55-59.
  • Mueses-Cisneros, J.J. and Ballén, G. (2007). ''Un nuevo caso de alerta sobre posible amenaza a una fauna nativa de anfibios en Colombia: Primer reporte de la rana toro (Lithobates catesbeianus) en la sabana de Bogotá.'' Revista de la Academia Colombiana de Ciencias, 31(118), 65-166.
  • Neveu, A., Bergot, F., and and Vigneux, E. (1997). ''The introduction of allochthonous green frog species into France, two dissimilar cases: R. catesbeiana and the foreign taxa of the esculenta complex.'' ''.'' Bulletin Francais de la Peche et de la Pisciculture,
  • Okada, Y. (1927). ''Frogs in Japan.'' Copeia, (158), 161-166.
  • Pereyra, M. O., Baldo, D., and Krauczuc, E. R. (2006). ''La ‘‘rana toro’’ en la Selva Atlántica Interior Argentina: un nuevo problema de conservación.'' Cuadernos de Herpetología, 20, 37-40.
  • Perez, M. E. (1951). ''The food of Rana catesbeiana Show in Puerto Rico.'' Herpetologica, 7(3), 102-104.
  • Ruiz, A., and Rueda-Almonacid, J. V. (2008). ''Batrachochytrium dendrobatidis and chytridiomycosis in anuran amphibians of Colombia.'' EcoHealth, 5, 27-33.
  • Sampedro, A., Montanez, L., and Suarez, O. (1985). ''Food of Rana catesbeiana at two zones of capture in Cuba.'' Ciencias Biologicas, (13), 59-66.
  • Sanabria, E. A., Quiroga, L. B., and Acosta, J. C. (2005). ''Introducción de Rana catesbeiana (rana toro), en ambientes precordilleranos de la provincia de San Juan, Argentina.'' Multequina, 14, 65-68.
  • Scalera, R. (2007). ''Virtues and shortcomings of EU legal provisions for managing NIS: Rana catesbeiana and Trachemys scripta elegans as case studies.'' Biological Invaders in Inland Waters: Profiles, Distribution, and Threats. F. Gherardi, eds., Springer Netherlands, 669-678.
  • Schloegel, L.M., Picco, A.M., Kilpatrick, A.M., Davies, A.J., Hyatte, A.D., and Daszak, P. (2009). ''Magnitude of the US trade in amphibians and presence of Batrachochytrium dendrobatidis and ranavirus infection in imported North American bullfrogs (Rana catesbeiana).'' Biological Conservation, 142, 1420-1426.
  • Stumpel, A.H.P. (1992). ''Successful reproduction of introduced bullfrogs Rana catesbeiana in northwestern Europe: A potential threat to indigenous amphibians.'' Biological Conservation, 60(1), 61-62.
  • Sánchez, D., Chacón-Ortiz, A., León, F., Han, B.A., and Lampo, M. (2008). ''Widespread occurrence of an emerging pathogen in amphibian communities of the Venezuelan Andes.'' Biological Conservation, 141, 2898-2905.
  • Thorn, Robert (1968). Les Salamandres d'Europe, d'Asie et d'Afrique du nord. Lechevalier, Paris.
  • Une, Y., Sakuma, A., Matsueda, H., Nakai, K., and Murakami, M. (2009). ''Ranavirus outbreak in North American Bullfrogs (Rana catesbeiana), Japan, 2008.'' Emerging Infectious Diseases, 15(7), 1146-1147.
  • Wang, X., Ma, L., Wu, M., and Liu, M. (1992). ''Study history and geographic distribution of Ranodon sibiricus.'' Foreign Animal Husbandry - Herbivorous Livestock. Biology Supplement, Urumqi, 59-61.
  • Wang, Y., Guo, Z., Pearl, C.A., and Li, Y. (2007). ''Body size affects the predatory interactions between introduced American Bullfrogs (Rana catesbeiana) and native anurans in China: an experimental study.'' Journal of Herpetology, 41(3), 514-520.
  • Wu, Z., Li, Y., Wang, Y., and Adams, M.J. (2005). ''Diet of introduced bullfrogs (Rana catesbeiana): predation on and diet overlap with native frogs on Daishan Island, China.'' Journal of Herpetology, 39(4), 668-674.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

American bullfrog

The American bullfrog, often simply known as the bullfrog in Canada and the United States, is an aquatic frog, a member of the family Ranidae, or “true frogs”. This species has traditionally been classified as Rana catesbeiana, but there is some dispute as to whether Lithobates catesbeianus is a more correct name. This frog inhabits large, permanent water bodies, such as swamps, ponds, and lakes, where it is usually found along the water's edge. The male bullfrog defends a territory during the breeding season. His call is reminiscent of the roar of a bull, which gives the frog its common name. This frog is native to southern and eastern parts of the United States and Canada, but has been widely introduced across other parts of North, Central and South America, Western Europe, and parts of Asia.

The hind legs of the bullfrog are used as food and it is harvested from the wild in North America and several countries into which it has been introduced. It is also cultured in controlled environments, though this is a difficult undertaking, and there is some international trade in frog legs.

Contents

Taxonomy [edit]

Although some authorities accept the specific name Rana catesbeiana,[2][3][4] others consider this frog should be included in the genus Lithobates as Lithobates catesbeianus.[1][5][6]

Mitochondrial DNA studies of New World species put Rana catesbeiana in the Aquarana group of ranids and suggest this clade is a sister group to Rana sylvatica, the wood frog. The data strongly supported the monophyly of the Aquarana grouping, which includes the green frog (Rana clamitans) and the Florida bog frog (Rana okaloosae), which appear to have recently diverged, and the closely related American bullfrog (R. catesbeiana) and river frog (R. heckscheri).[3] This placement was disputed by Darrel Frost and the American Museum of Natural History, who placed most of the North American ranids in the genus Lithobates.[7] His view is rejected by Stuart (2008)[8] and Pauly et al. (2009)[9] and it is not accepted by Amphibiaweb.[4]

Description [edit]

American bullfrog

The dorsal surface of the bullfrog has an olive-green basal color, either plain or with a mottling and banding of grayish-brown. The ventral surface is off-white blotched with yellow or gray. There is often a marked contrast in color between the green upper lip and the pale lower lip. The eyes are prominent with brown irises and horizontal almond-shaped pupils. The tympani (eardrums) are easily seen and the dorsolateral folds of skin end close to them. The limbs are blotched or banded with gray. The forelegs are short and sturdy and the hind legs long. The hands are not webbed, but the feet have webbing between the digits with the exception of the fourth toe.[10]

Bullfrogs are dimorphic, with males being smaller than females, and having yellow throats tympani larger than their eyes, whereas the tympani in females are about the same size as the eyes.[10] Bullfrogs measure about 3.6 to 6 in (9 to 15 cm) from snout to vent. They grow fast in the first eight months of life, typically increasing in weight from 5 to 175 g (0.18 to 6.2 oz),[11] and large mature individuals can weigh up to 500 g (1.1 lb).[12] Exceptional bullfrogs can possibly attain 800 g (1.8 lb) and measure up to 8 in (20 cm) in length.[11][13]

Distribution [edit]

The bullfrog is native to the eastern half of the United States. Its natural range extends from the Atlantic Coast to as far west as Oklahoma and Kansas. It is not found on offshore islands near Cape Cod and is largely absent from Florida, Texas, Colorado, Nebraska, South Dakota, and Minnesota.[14] It has been introduced into Massachusetts, Arizona, Utah, other parts of Colorado and Nebraska, Nevada, California, Oregon, Washington, and Hawaii. In these states, it is considered to be an invasive species and there is concern that it may outcompete native species of amphibians and upset the ecological balance.[14] It is very common in California, where it is believed to pose a threat to the California red-legged frog and is considered to be a factor in the decline of that vulnerable species.[15]

Other countries into which the bullfrog has been introduced include Mexico, the western half of Canada, Cuba, Jamaica, Italy, the Netherlands, and France.[16] It is also found in Argentina, Brazil, Uruguay, Venezuela, Colombia, China and Japan.[17] The reasons for introducing the bullfrog to these countries have included their intentional release, either to provide a source of food or as biological control agents, the escape of frogs from breeding establishments, and the escape or release of frogs kept as pets.[16] Conservationists are concerned the bullfrog is relatively immune to the fungal infection chytridiomycosis and as it invades new territories, it may assist the spread of this lethal disease to more susceptible native species of frog.[17]

Breeding behavior [edit]

In typical aquatic habitat

The bullfrog breeding season typically lasts two to three months.[18][19][20][21] A study of bullfrogs in Michigan showed the males arriving at the breeding site in late May or early June, and remaining in the area into July. The territorial males that occupy sites are usually spaced some 3 to 6 m (9.8 to 20 ft) apart and call loudly.[18][19][20][21] At least three different types of calls have been noted in male bullfrogs under different circumstances. These distinctive calls include territorial calls made as threats to other males, advertisement calls made to attract females, and encounter calls which precede combat.[22][23]

The bullfrogs have a prolonged breeding season,[18] with the males continuously engaging in sexual activity throughout. Males are present at the breeding pond for longer periods than females during the entire season, increasing their chances of multiple matings.[20][21] The sex ratio is typically skewed toward males.[23] Conversely, females have brief periods of sexual receptivity during the season. In one study, female sexual activity typically lasted for a single night and mating did not occur unless the females initiated the physical contact.[18][23] Males only clasp females after they have indicated their willingness to mate.[18] This finding refutes previous claims that a male frog will clasp any proximate female with no regard as to whether the female has consented.[22][24][25][26]

These male and female behaviors cause male-to-male competition to be high within the bullfrog population and sexual selection for the females to be an intense process.[18] Wells postulated leks, territorial polygyny, and harems are the most likely classifications for the bullfrog mating system. Leks would be a valid description because males congregate to attract females, and the females arrive to the site for the purpose of copulation.[18][22] In a 1980 study on bullfrogs in New Jersey, the mating system was classified as resource-defense polygyny. The males defended territories within the group and demonstrated typical physical forms of defense.[23]

Choruses [edit]

Male bullfrogs aggregate into groups called choruses. The male chorus behavior is analogous to the lek formation of birds, mammals, and other vertebrates. Choruses are dynamic, forming and remaining associated for a few days, breaking down temporarily, and then forming again in a new area with a different group of males.[22] Male movement has experimentally been noted to be dynamic.[23] In the Michigan study, the choruses were described as “centers of attraction” in which their larger numbers enhanced the males’ overall acoustical displays. This is more attractive to females and also attractive to other sexually active males. Choruses in this study were dynamic, constantly forming and breaking up. New choruses were formed in other areas of the site. Males moved around and were highly mobile within the choruses.[18]

A review of multiple studies on bullfrogs and other anurans noted male behavior within the groups changes according to the population density of the leks. At higher population densities, leks are favored due to difficulty defending individual territories among a large population of males. This variance causes differences in how females choose their mates. When the male population density is low and males maintain clearer, more distinct territories, female choice is mostly determined by territory quality.[22] When male population density is higher, females depend on other cues to select their mates. These cues include the males’ positions within the chorus and differences in male display behaviors among other determinants.[20][22] Social dominance within the choruses is established through challenges, threats, and other physical displays. Older males tend to acquire more central locations while younger males were located on the periphery.[18]

Chorus tenure is the number of nights that a male participates in the breeding chorus.[27] One study distinguishes between chorus tenure and dominant tenure. Dominant tenure is the more strictly defined as the amount of time a male maintains a dominant status.[28] Chorus tenure is restricted due to increased risk of predation,[29] lost foraging opportunities,[30] and higher energy consumption.[31] Calling is postulated to be energetically costly to anurans in general.[32] Energy is also expended through locomotion and aggressive interactions of male bullfrogs within choruses.[28]

Aggressive behavior [edit]

Within choruses, to establish social dominance, bullfrogs demonstrate typical forms of aggression, especially through visual displays. Posture is a key factor in establishing social position and threatening challengers.[22] Territorial males have inflated postures while nonterritorial males only have their heads above the water. For dominant (territorial) males, their elevated posture reveals yellow-colored throats.[20][22] When two dominant males encounter each other, they engage in a wrestling bout. The males have their venters clasped, each individual in an erect position rising to well above water level.[22] The New Jersey study noted the males would approach each other to within a few centimeters and then tilt back their heads, displaying their brilliantly colored gular sacs. The gular is dichromatic in bullfrogs, with dominant and fitter males displaying yellow gulars. The New Jersey study also reported low posture with only the head exposed above the water surface was typical of subordinate, or nonterritorial males, and females. High posture was demonstrated by territorial males, which floated on the surface of the water with their lungs inflated, displaying their yellow gulars.[23] Males optimize their reproductive fitness in a number of ways. Early arrival at the breeding site, prolonged breeding with continuous sexual activity throughout the season, ownership of a centrally located territory within the chorus, and successful movement between the dynamically changing choruses are all common ways for males to maintain dominant, or territorial, status within the chorus. Older males have greater success in all of these areas than younger males.[18] Some of the males display a more inferior role, termed by many researchers as the silent male status. These silent males sit near resident males, moving into the dominant males’ territories. The silent males will sit for many hours near the resident males, and demonstrate low postures. The silent males are not in the practice of intercepting matings. They are actually waiting for territories to be vacated.[20][22] This has also been called the alternate or satellite male strategy.[22]

Growth and development [edit]

Bullfrog larva and mouthparts

After selecting a male, the female deposit eggs in his territory.[23] During the mating grasp, or amplexus, the male rides on top of the female, grasping her with his fore limbs posterior to her fore limbs. The female chooses a site in shallow water among vegetation, and lays a batch of up to 20,000 eggs, and the male simultaneously releases sperm, resulting in external fertilization.[33] The eggs form a thin, floating sheet which may cover an area of 0.5 to 1 m2 (5.4 to 11 sq ft). The embryos develop best at water temperatures between 24 and 30 °C (75 and 86 °F) and hatch in three to five days. If the water temperature rises above 32 °C (90 °F), developmental abnormalities occur, and if it falls below 15 °C (59 °F), normal development ceases.[14] Newly hatched tadpoles show a preference for living in shallow water on fine gravel bottoms. This may reflect a lesser number of predators in these locations. As they grow, they tend to move into deeper water. The tadpoles initially have three pairs of external gills and several rows of labial teeth. They pump water through their gills by movements of the floor of their mouths, trapping bacteria, single-celled algae, protozoans, pollen grains, and other small particles on mucus in a filtration organ in their pharanges. As they grow, they begin to ingest larger particles and use their teeth for rasping. They have downward-facing mouths, deep bodies, and tails with broad dorsal and ventral fins.[34]

Time to metamorphosis ranges from a few months in the southern part of the range to three years in the north.[33] Maximum lifespan in the wild is estimated to be eight to 10 years, but one frog lived for almost 16 years in captivity.[33]

Feeding [edit]

Juvenile with a small, grey, oval-shaped area on top of the head, the parietal eye
Native habitat

Bullfrogs are voracious, opportunistic, ambush predators that prey on any small animal they can overpower and stuff down their throats. Bullfrog stomachs have been found to contain rodents, small turtles, snakes, crayfish, frogs (including bullfrogs), birds, and a bat,[35] as well as the many invertebrates, such as insects, which are the usual food of ranid frogs.[36] These studies revealed the bullfrog's diet to be unique among North American ranids in the inclusion of a large percentage of aquatic animals, such as fish, tadpoles, ram's horn snails, and dytiscid beetles. The specialized ability of bullfrogs to capture submerged and large, strong prey comprises a pronounced biting motor pattern that follows up on the initial and typical ranid tongue strike.[36] Adaptation to target image displacement due to light refraction at the water-air interface consists of the bullfrog's application of tongue surface comparatively posterior to the perceived location of the prey target.[36] The comparative ability of bullfrogs to capture submerged prey, compared to that of the green frog, leopard frog, and wood frog (R. clamitans, R. pipiens, and R. sylvatica, respectively) was also demonstrated in laboratory experiments.[36]

Prey motion elicits feeding behavior. First, if necessary, the frog performs a single, orienting bodily rotation ending with the frog aimed towards the prey, followed by approaching leaps, if necessary. Once within striking distance, the bullfrog begins its feeding strike, which consists of a ballistic lunge (eyes closed as during all leaps) that ends with the mouth opening, extension of the fleshy and mucous-coated tongue upon the prey, often engulfing it, while the jaws continue their forward travel to close (bite) in close proximity to the prey's original location, just as the tongue is retracted back into the mouth, prey attached. Large prey that do not fit entirely into the mouth are stuffed in with the hands. In laboratory observations, bullfrogs taking mice usually swam underwater with prey in mouth, apparently with the advantageous result of altering the mouse's defense from counterattack to struggling for air.[36] The tiny teeth of bullfrogs are useful only in grasping. Asphyxiation is the most likely cause of death of endothermic (warm-blooded) bullfrog prey.[36]

Ecology [edit]

Bullfrogs are an important item of prey to many birds, otters, fish, and other amphibians. The eggs and larvae are unpalatable to many salamanders and fish, but the high levels of activity of the tadpoles may make them more noticeable to a predator not deterred by their unpleasant taste. Humans hunt them as game and consume their legs. Adult frogs try to escape by splashing and leaping into deep water. A trapped individual may squawk or emit a piercing scream, which may surprise the attacker sufficiently for the frog to escape. An attack on one bullfrog is likely to alert others in the vicinity to danger and they will all retreat into the safety of deeper water. Bullfrogs may be at least partially resistant to the venom of copperheads Agkistrodon contortrix and cottonmouths Agkistrodon piscivorus.[17]

Human use [edit]

Bullfrogs in a Chinese supermarket

The American bullfrog provides a food source, especially in the Southern and some areas of the Midwestern United States. The traditional way of hunting them is to paddle or pole silently by canoe or flatboat in ponds or swamps at night; when the frog's call is heard, a light is shone at the frog which temporarily inhibits its movement. The frog will not jump into deeper water as long as it is approached slowly and steadily. When close enough, the frog is gigged with a multiple-tined spear and brought into the boat.[35] Bullfrogs can also be stalked on land, by again taking great care not to startle them.[37] In some states, breaking the skin while catching them is illegal, and either grasping gigs or hand capture are used. The only parts normally eaten are the rear legs, which resemble small chicken drumsticks and can be cooked in similar ways.[35]

Commercial bullfrog culture in near-natural enclosed ponds has been attempted, but is fraught with difficulties. Although pelleted feed is available, the frogs will not willingly consume artificial diets, and providing sufficient live prey is challenging. Disease also tends to be a problem even when great care is taken to provide sanitary conditions. Other challenges to be overcome may be predation, cannibalism, and low water quality.[38] The frogs are large, have powerful leaps, and inevitably escape after which they may wreak havoc among the native frog population.[35] Countries that export bullfrog legs include Belgium, the Netherlands, Mexico, Bangladesh, Japan, China, Taiwan and Indonesia. Most of these frogs are caught from the wild, but some are captive-reared. The United States is a net importer of frog legs.[38]

While occasionally kept as pets, the bullfrog will still bite even when tamed, and can live 16 years or more in captivity. PetWatch, a project of EcoHealth Alliance advising on the suitability of different species as pets, has classified bullfrogs as "worst choice pets".[39] The American bullfrog is also used as a specimen for dissection in many schools across the world. It is the state amphibian of Missouri, Ohio, and Oklahoma.[40]

References [edit]

  1. ^ a b Santos-Barrera, G., Hammerson, G., Hedges, B., Joglar, R., Inchaustegui, S., Lue Kuangyang, Chou Wenhao, Gu Huiqing, Shi Haitao, Diesmos, A., Iskandar, D., van Dijk, P.P., Masafumi Matsui, Schmidt, B., Miaud, C. & Martínez-Solano, I. (2009) Lithobates catesbeianus. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2.
  2. ^ Hillis, D. M. (2007). "Constraints in naming parts of the Tree of Life". Molecular Phylogenetics and Evolution 42 (2): 331–338. doi:10.1016/j.ympev.2006.08.001. PMID 16997582. 
  3. ^ a b Hillis, D. M. and Wilcox, T. P. (2005). "Phylogeny of the New World True Frogs (Rana)". Molecular Phylogenetics and Evolution 34 (2): 299–314. doi:10.1016/j.ympev.2004.10.007. PMID 15619443. 
  4. ^ a b AmphibiaWeb: Information on amphibian biology and conservation.
  5. ^ American Bullfrog (Lithobates catesbeianus), Ontario Nature
  6. ^ Lithobates catesbeianus, USDA
  7. ^ Frost, Darell (2011). "American Museum of Natural History: Amphibian Species of the World 5.5, an Online Reference". Herpetology. The American Museum of Natural History. Retrieved 2013-02-17. 
  8. ^ Stuart, Bryan L. (2008). "The phylogenetic problem of Huia (Amphibia: Ranidae)". Molecular Phylogenetics and Evolution 46 (1): 40–60. doi:10.1016/j.ympev.2007.09.016. 
  9. ^ Pauly, Greg B., Hillis, David M. & Cannatella, David C. (2009). "Taxonomic freedom and the role of official lists of species names". Herpetologica 65 (2): 115–128. doi:10.1655/08-031R1.1. 
  10. ^ a b Knapp, W. W. (2008-05-28). "Bullfrog - Rana catesbeiana". The Frogs and Toads of Georgia. Retrieved 2013-01-20. 
  11. ^ a b Lutz, G. & Avery, J. "Bullfrog Culture". Southern Regional Aquaculture Center. Retrieved 2013-01-09. 
  12. ^ "ANIMAL BYTES- North American Bullfrog". Sea World. Retrieved 2013-01-09. 
  13. ^ "Rana catesbeiana". Fisheries and Aquaculture Department. Retrieved 2013-01-09. 
  14. ^ a b c McKercher, Liz; Gregoire, Denise R. (2011-09-14). "Lithobates catesbeianus (Shaw, 1802)". Nonindigenous Aquatic Species. U.S. Geological Survey. Retrieved 2013-01-20. 
  15. ^ Hammerson, Geoffrey (2008). "Rana draytonii". IUCN Red List of Threatened Species. Version 2012.2. Retrieved 2013-01-23. 
  16. ^ a b Crayon, John J. (2009-12-03). "Lithobates catesbeianus (=Rana catesbeiana) (amphibian)". Global Invasive Species Database. Invasive Species Specialist Group. Retrieved 2013-01-20. 
  17. ^ a b c Lu, Christine; Sopory, Ambika (2010-08-23). "Rana catesbeiana". AmphibiaWeb. Retrieved 2013-01-20. 
  18. ^ a b c d e f g h i j Emlen, Stephen T (1976). "Lek organization and mating strategies in the bullfrog". Behavioral Ecology and Sociobiology 1 (3): 283–313. doi:10.1007/BF00300069. JSTOR 4599103. 
  19. ^ a b Blair, Albert P (1963). "Notes on anuran behavior, especially Rana catesbeiana". Herpetologica 19 (2): 151–151. 
  20. ^ a b c d e f Emlen, Stephen T (1968). "Territoriality in the bullfrog, Rana catesbeiana". Copeia 1968 (2): 240–243. doi:10.2307/1441748. JSTOR 1441748. 
  21. ^ a b c Wiewandt, Thomas A (1969). "Vocalization, aggressive behavior, and territoriality in the bullfrog, Rana catesbeiana". Copeia 1969 (2): 276–285. doi:10.2307/1442074. JSTOR 1442074. 
  22. ^ a b c d e f g h i j k Wells, Kentwood D (1977). "Territoriality and male mating success in the green frog (Rana clamitans)". Ecology 58 (4): 750–762. doi:10.2307/1936211. 
  23. ^ a b c d e f g Ryan, Michael J. (1980). "The Reproductive Behavior of the Bullfrog (Rana catesbiana)". Copeia 1980: 108–114. doi:10.2307/1444139. 
  24. ^ Blair, W. Frank (1958). "Call structure and species groups in US treefrogs (Hyla)". The Southwestern Naturalist 3: 77–89. doi:10.2307/3669039. 
  25. ^ Bogert, Charles Mitchill. "The influence of sound on the behavior of amphibians and reptiles." (1960).
  26. ^ Littlejohn, M. J, and Martin, A. A. (1969). "Acoustic interaction between two species of leptodactylid frogs". Animal Behaviour 17 (4): 785–791. doi:10.1016/S0003-3472(69)80027-8. 
  27. ^ Murphy, Christopher G. (1994). "Chorus tenure of male barking treefrogs, Hyla gratiosa". Animal Behaviour 48 (4): 763. doi:10.1006/anbe.1994.1301. 
  28. ^ a b Judge, Kevin A., and Ronald J. Brooks (2001). "Chorus participation by male bullfrogs, Rana catesbeiana: a test of the energetic constraint hypothesis". Animal Behaviour 62 62 (5): 849–861. doi:10.1006/anbe.2001.1801. 
  29. ^ Ryan, Michael J., Merlin D. Tuttle, and Lucinda K. Taft (1981). "The costs and benefits of frog chorusing behavior". Behavioral Ecology and Sociobiology 8 (4): 273–278. doi:10.1007/BF00299526. 
  30. ^ Woolbright, Lawrence L., and Margaret M. Stewart (1987). "Foraging success of the tropical frog, Eleutherodactylus coqui: the cost of calling". Copeia 1987: 69–75. doi:10.2307/1446039. 
  31. ^ Prestwich, Kenneth N., Kristin E. Brugger, and Mary Topping (1989). "Energy and communication in three species of hylid frogs: power input, power output and efficiency". Journal of Experimental Biology 144 (1): 53–80. 
  32. ^ Pough, F. H., et al. (1992) “Behavioral energetics.” in Environmental physiology of the amphibians, University of Chicago Press, pp. 395–436 ISBN 0226239446.
  33. ^ a b c Casper, G. S. and Hendricks, R. (2005) Amphibian Declines: The Conservation Status of United States Species, M. Lannoo, ed. University of California Press ISBN 0520235924.
  34. ^ Stebbins, Robert C.; Cohen (1995). A Natural History of Amphibians. Princeton University Press. pp. 181–184. ISBN 0-691-03281-5.  Unknown parameter |First2= ignored (|first2= suggested) (help)
  35. ^ a b c d Moyle, Peter (2012-07-04). "Bullfrog". Eat the Invaders. Retrieved 2013-02-18. 
  36. ^ a b c d e f Cardini, F. (1974) Specializations of the Feeding Response of the Bullfrog, Rana catesbeiana, for the Capture of Prey Submerged in Water. M.S. Thesis, U. of Massachusetts, Amherst, MA
  37. ^ "How to Catch a Bullfrog". WikiHow to do anything. Retrieved 2013-02-17. 
  38. ^ a b Lutz, C. Greg; Avery, Jimmy L. (1999). "Bullfrog Culture". Southern Regional Aquaculture Center. Retrieved 2013-02-17. 
  39. ^ "North American Bullfrog". PetWatch. EcoHealth Alliance. Retrieved 2013-02-18. 
  40. ^ "Official state amphibians". NetState.com. 2012-07-11. Retrieved 2013-01-23. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!