Overview

Comprehensive Description

Description

Dorsal coloration variable; ground color may be cream, grey, red, or black. Dorsum may show a variable pattern of dark streaks and blotches. Head lacks tympanum, pupil is vertical, and a light streak may extend from tip of snout to above the eyes. Whitish-yellow venter, more yellow in femoral region. Males have a tail-like extension of the cloaca, and during breeding season show greatly enlarged forearms. Larvae have a distinctively large, round mouth, modified for suction, which they use to cling to streamside rocks (modified from Stebbins 1951).

Ascaphus is the only living representative of a basal lineage of anurans, and may retain some relatively primitive traits of early frogs (e.g. Ford and Cannatella 1992).

See another account at californiaherps.com.

  • Stebbins, R. C. (1985). A Field Guide to Western Reptiles and Amphibians. Houghton Mifflin, Boston.
  • Ford, L.S., and Cannatella, D.C. (1993). ''The major clades of frogs.'' Herpetological Monographs, 7, 94-117.
  • Nussbaum, R. A., Brodie, E. D., Jr., and Storm, R. M. (1983). Amphibians and Reptiles of the Pacific Northwest. University of Idaho Press, Moscow, Idaho.
  • Stebbins, R.C. (1951). Amphibians of Western North America. University of California Press, Berkeley.
  • Bull, E. L. and Carter, B. E. (1996). ''Tailed Frogs: Distribution, ecology, and association with timber harvest in Northeastern Oregon.'' United States Forest Service Research Paper, (497), 1-12.
  • Orchard, S.A. (1992). ''Amphibian population declines in British Columbia.'' Declines in Canadian amphibian populations: designing a national monitoring strategy. C. A. Bishop nd K.E. Petit, eds., Canadian Wildlife Service, 10-13.
  • Wallace, R. L. and Diller, L. V. (1998). ''Length of the larval cycle of Ascaphus truei in coastal streams of the redwood region, northern California.'' Journal of Herpetology, 32(3), 404-409.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Tailed frogs occur from northwestern California north to the Portland Canal and Nass River of British Columbia. This range is bordered by the Cascade Mountains to the east and the Pacific coast to the west. Several separate populations are also found in the Blue Mountains of southeastern Washington and northeastern Oregon as well as in the northern Rocky Mountains of northern Idaho and western Montana.

Biogeographic Regions: nearctic (Native )

  • Adams, M., C. Pearl. 2005. Amphibian Declines: The Conservation Status of United States Species. Ascaphus truei. Berkley, CA: University of California Press.
  • Leonard, W., H. Brown, L. Jones, K. McAllister, R. Storm. 1993. Amphibians of Washington and Oregon. Seattle, WA: Seattle Audubon Society.
  • Mallory, A. 2004. Coastal Tailed Frog: Ascaphus truei. Accounts and Measures for Managing Identified Wildlife: Southern Interior Forest Region, 2004: 77-86. Accessed November 26, 2010 at http://www.env.gov.bc.ca/wld/frpa/iwms/documents/Accounts_and_Measures_South.pdf.
  • Stebbins, R. 2003. A Field Guide to Western Reptiles and Amphibians. New York, NY: Houghton Mifflin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species ranges from the Cascades and the Pacific Coast from southern British Columbia, Canada south to north-western California, USA (Stebbins 1985, Nielson et al. 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Cascades and the Pacific Coast from southern British Columbia south to northwestern California (Nielson et al. 2001, Stebbins 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

From sea level to timberline, ranging along Pacific coast of North America from northern California to southern British Columbia. Also includes a disjuct distribution in northern Idaho and western Montana (Nussbaum et al 1983). Associated with cold, fast-moving streams with cobbled bottoms and emergent boulders (Bull and Carter 1996).

  • Stebbins, R. C. (1985). A Field Guide to Western Reptiles and Amphibians. Houghton Mifflin, Boston.
  • Ford, L.S., and Cannatella, D.C. (1993). ''The major clades of frogs.'' Herpetological Monographs, 7, 94-117.
  • Nussbaum, R. A., Brodie, E. D., Jr., and Storm, R. M. (1983). Amphibians and Reptiles of the Pacific Northwest. University of Idaho Press, Moscow, Idaho.
  • Stebbins, R.C. (1951). Amphibians of Western North America. University of California Press, Berkeley.
  • Bull, E. L. and Carter, B. E. (1996). ''Tailed Frogs: Distribution, ecology, and association with timber harvest in Northeastern Oregon.'' United States Forest Service Research Paper, (497), 1-12.
  • Orchard, S.A. (1992). ''Amphibian population declines in British Columbia.'' Declines in Canadian amphibian populations: designing a national monitoring strategy. C. A. Bishop nd K.E. Petit, eds., Canadian Wildlife Service, 10-13.
  • Wallace, R. L. and Diller, L. V. (1998). ''Length of the larval cycle of Ascaphus truei in coastal streams of the redwood region, northern California.'' Journal of Herpetology, 32(3), 404-409.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Since tailed frogs spend their life in association with fast-flowing streams, they have evolved some morphological adaptations that stand out from other frogs and toads. For example, the lungs are greatly reduced, presumably to control buoyancy, and the toe tips are hard and keratinized, to facilitate crawling among rocks on the stream bottom.

Juveniles and adults are small, typically ranging from 2.2 to 5.1 cm in snout-vent length. Overall, color is usually comparable to the tailed frog’s substrate and may vary from tan to chocolate brown or olive green. Regardless of the color, its skin has a characteristic rough feel. Moreover, the head is comparatively large and flattened with a light triangular-shaped mark generally present between the snout and eyes. The eyes themselves have visibly vertical pupils, and a dark stripe extends from the snout to the shoulder. Some more obvious adaptations to its streamside habitat include a slight webbing of the toes, with the outer hind toes also flattened. In addition, they lack tympani or ear membranes and, as a result, lacks the capacity to communicate acoustically, a likely adaptation to the steady sound of flowing water. Tailed frogs get their common name from another aquatic adaptation: males have a short, tail-like copulatory organ used during internal fertilization. Tailed frogs exhibit additional sexual dimorphism in that males are smaller than females, and they develop black, horny pads on the insides of their thighs during the mating season to aid gripping females during amplexus.

Tadpoles average little more than 11 mm after hatching, but may grow to 65 mm in length before metamorphosis. Initially, hatchlings have no color, but are instead identified according to the presence of a prominent yolk sac seen in the abdomen. However, tadpoles eventually take on a black to brownish-grey coloration of the body that is covered with black speckling. A white dot discernible on the tip of the tail and an obvious copper-colored bar between the eyes and snout are additional field marks for identification. Tailed frog tadpoles also have some adaptations to keep from being swept away by stream currents. The body is flattened ventrally and the tail is laterally compressed. Moreover, the mouth has evolved into an oral disc that is sucker-like, allowing for attachment to rocks. Eggs are unpigmented and are laid in a gelatinous string beneath a rock in shallow water.

Range length: 2.2 to 5.1 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike; female larger; sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 5 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Ascaphus truei
Catalog Number: USNM 25979
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1897
Locality: Humptulips, Grays Harbor, Washington, United States, North America
  • Holotype: Stejneger, L. 1899. Proc. U. S. Nat. Mus. 21: 900, Fig. 1 and Plate 89.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Tailed frogs clear, cold streams of mountainous regions with step-pools, such that the slope is neither too shallow nor too steep. They inhabit a wide range of elevations from coastal to mountainous. Stream temperatures must remain cool even in summer months, as this species is known to have narrow temperature tolerances. Also, coarse substrates are favored for egg-laying and over-wintering events. As larvae do exhibit a long developmental period, stream habitats must be permanent features of the landscape. Juveniles and adults, however, further require the presence of a mature or old growth forest alongside their stream habitat. While they will not venture too far from the water, juveniles and adults will utilize riparian vegetation for food and refuge. This vegetation is also important to larvae, as it helps to control stream temperatures and prevent excessive sedimentation through bank stabilization.

Range elevation: 0 to 2557 m.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: forest ; mountains

Aquatic Biomes: rivers and streams

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Can be found in clear, cold swift-moving mountain streams with coarse substrates. Primarily in older forest sites, required microclimatic and microhabitat conditions are more common in older forests (Welsh 1990). Diller and Wallace (1999) reported that canopy cover, temperature, and forest age in managed forests were not significantly different between occupied and unoccupied stream reaches in northern California; however, this probably reflects past timber harvest patterns. Animals may be found on land during wet weather near water in humid forests or in more open habitat. During dry weather it stays on moist stream-banks and lays eggs in long strings under stones in water.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central Pacific Coastal Forests Habitat

This taxon is found in the Central Pacific Coastal Forests ecoregion, as one of its North American ecoregions of occurrence. These mixed conifer rainforests stretch from stretch from southern Oregon in the USA to the northern tip of Vancouver Island, Canada. These forests are among the most productive in the world, characterized by large trees, substantial woody debris, luxuriant growths of mosses and lichens, and abundant ferns and herbs on the forest floor. The major forest complex consists of Douglas-fir (Pseudotsuga menziesii) and Western hemlock (Tsuga heterophylla), encompassing seral forests dominated by Douglas-fir and massive old-growth forests of Douglas-fir, Western hemlock, Western red cedar (Thuja plicata), and other species. These forests occur from sea level up to elevations of 700-1000 meters in the Coast Range and Olympic Mountains. Such forests occupy a gamut of environments with variable composition and structure and includes such other species as Grand fir (Abies grandis), Sitka spruce (Picea sitchensis), and Western white pine (Pinus monticola).

Characteristic mammalian fauna include Elk (Cervus elaphus), Black-tailed Deer (Odocoileus hemionus), Coyote (Canis latrans), Black Bear (Ursus americanus), Mink (Mustela vison), and Raccoon (Procyon lotor).

The following anuran species occur in the Central Pacific coastal forests: Coastal tailed frog (Ascaphus truei); Oregon spotted frog (Rana pretiosa VU); Northern red-legged frog (Rana pretiosa); Pacific chorus frog (Pseudacris regilla); Cascade frog (Rana cascadae NT), generally restricted to the Cascade Range from northern Washington to the California border; Foothill yellow-legged frog (Rana boylii) and the Western toad (Anaxyrus boreas NT).  A newt found in the ecoregion is the Rough skinned newt (Taricha granulosa).

Salamanders within the ecoregion are: Del Norte salamander (Plethodon elongatus NT);  Van Dyke's salamander (Plethodon vandykei); Western redback salamander (Plethodon vehiculum); Northwestern salamander (Ambystoma gracile);  Olympic torrent salamander (Rhyacotriton olympicus VU), whose preferred habitat is along richly leafed stream edges; Long-toed salamander (Ambystoma macrodactylum), whose adults are always subterranean except during the breeding season; Dunn's salamander (Plethodon dunni), usually found in seeps and stream splash zones; Clouded salamander (Aneides ferreus NT), an aggressive insectivore; Monterey ensatina (Ensatina eschscholtzii), usually found in thermally insulated micro-habitats such as under logs and rocks; Pacific giant salamander (Dicamptodon tenebrosus), found in damp, dense forests near streams; and Cope's giant salamander (Dicamptodon copei), usually found in rapidly flowing waters on the Olympic Peninsula and Cascade Range.

There are a small number of reptilian taxa that are observed within this forested ecoregion, including: Pacific pond turtle (Emys marmorata); Common garter snake (Thamnophis sirtalis), an adaptable snake most often found near water; Northern alligator lizard (Elgaria coerulea); and the Western fence lizard.

Numerous avian species are found in the ecoregion, both resident and migratory. Example taxa occurring here are the Belted kingfisher (Megaceryle alcyon); Wild turkey (Meleagris gallopavo); and the White-headed woodpecker (Picoides albolarvatus) and the Trumpeter swan (Cygnus buccinator), the largest of the North American waterfowl.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Clear, cold swift-moving mountain streams with coarse substrates. Primarily in older forest sites; required microclimatic and microhabitat conditions are more common in older forests (Welsh 1990). Diller and Wallace (1999) reported that canopy cover, temperature, and forest age in managed forests were not significantly different between occupied and unoccupied stream reaches in northern California; however, this probably reflects past timber harvest patterns. May be found on land during wet weather near water in humid forests or in more open habitat. During dry weather stays on moist stream-banks. Lays eggs in long strings under stones in water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Animal Foods: insects; terrestrial non-insect arthropods; mollusks; zooplankton

Plant Foods: algae

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Larva feed mostly on diatoms. Adults eat a wide variety of insects and other invertebrates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Tailed frog tadpoles can actually act as the dominant herbivore in some stream habitats. However, tailed frogs are restricted to aquatic lotic systems as a tadpole. As a juvenile or adult on the other hand, they may play an active part in both its aquatic and adjacent terrestrial ecosystem through interaction with its prey and predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Little is known regarding potential predators of tailed frogs, as observations regarding this subject of study are few in number. Of those accounts that exist, common garter snakes, shrews (Sorex) and western terrestrial garter snakes were observed consuming post-metamorphic tailed frogs. There are also accounts of hellgrammites (Megaloptera), larval Cope’s giant salamanders and Pacific giant salamanders consuming larval tailed frogs. Other predators include trout (Salmonidae), sculpins and dippers.

Known Predators:

Anti-predator Adaptations: cryptic

  • Lund, E., M. Hayes, T. Curry, J. Marsten, K. Young. 2008. Predation on the Coastal Tailed Frog (Ascaphus truei) by a Shrew (Sorex spp.) in Washington State. Northwestern Naturalist, 89: 200-202. Accessed November 26, 2010 at http://wdfw.wa.gov/publications/00138/wdfw00138.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Many extant occurrences distributed throughout the range. Washington has 436 unique sites, many of which will combine into a smaller number of distinct occurrences (K. Dvornich, pers. comm., 1997). Oregon has approximately 60 occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Comments: Total population size is unknown but likely exceeds 10,000. Common in suitable habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Adult and subadult frogs usually are less commonly encountered than are larvae. For example, in California, Diller and Wallace (1999) found 693 A. truei larvae but only 32 metamorphosed individuals over four years in 54 of 72 randomly selected streams, though researchers have found higher densities in other areas. Diller and Wallace found 0.04-0.76 larvae per square meter (mean 0.24), whereas Hawkins et al. (1988) recorded mean densities of 0.58 to 4.40 larvae per square meter in three different classes of watersheds near Mt. St. Helens in Washington; two of the three sampled streams contained two larval cohorts.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication through calls, as characteristic of most anurans, does not appear possible due to the absence of the tongue, vocal sacs, middle and external ear bones, and external eardrums which are critical to creating and perceiving sound. With acoustic communication lacking in tailed frogs, they are presumably reliant on visual and tactile cues to carry out courtship and mating activities. Still, more research is needed in this subject of study, as chemical cues may prove important to communication as well.

Communication Channels: visual ; tactile

Perception Channels: visual ; tactile

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Adults most active April-October, depending on locality.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

While most frogs and toads exhibit external fertilization, tailed frogs unique in that they have internal fertilization. Female tailed frogs purposefully attach their eggs to the bottom of big rocks or boulders found submerged in the stream. Hatching occurs about six weeks after deposition of the eggs. Tadpoles utilize their large yolk sac for nourishment throughout the winter months, after which development of a suctorial mouth allows them to prey upon other organisms. Following one to four years, metamorphosis takes place, producing juvenile tailed frogs that differ dramatically in appearance from their previous larval form. Metamorphosis can last up to 60 days. The age that juveniles reach sexual maturity varies geographically, with coastal populations maturing at 2 to 3 years old and montane populations maturing at 8 to 9 years old.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

With a maximum lifespan of at least fourteen years, and from 2 to 9 years required to attain sexual maturity, tailed frogs have one of the longer life histories known among anurans.

Range lifespan

Status: captivity:
14 (high) years.

  • Daugherty, C., A. Sheldon. 1982. Age-Determination, Growth, and Life History of a Montana Population of the Tailed Frog (Ascaphus truei). Herpetologica, 38/4: 461-468.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14 years (wild) Observations: In the wild, these animals may live up to 14 years (Smirina 1994). Some speculate that females may live 15-20 years and males somewhat less. In inland populations females appear to bread every other year, while in coastal populations may breed every year (http://amphibiaweb.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Tailed frogs are unique among the anurans in exhibiting a combination of amplexus and copulation during courtship and mating. Courtship occurs at the onset of fall, between September and October, and is carried out in the water. During courtship, a male typically lunges or swims suddenly toward a female of the same species. Clasping the female’s body directly anterior to her pelvic region, the male may then perform either inguinal or ventral amplexus. Once in the proper position, copulation can follow, the male's erect “tail” inserted into the female’s cloaca. To press closer to the female during copulation, the male may repeatedly produce thrusts of his pelvic region, his “tail” still within the cloaca.

Mating System: polygynous

Tailed frog females have been shown to reproduce biennially, while males may mate annually. This behavior may vary geographically. Although courtship and mating occur in the fall, tailed frog females store the sperm and do not deposit eggs until June or July. When deposition finally takes places, a dual strand of 44 to 85 small-sized eggs is fixed to the base of a rock or boulder within the stream system. After approximately six weeks, hatchlings then appear. The tadpole or larval stage may last anywhere from one to four years, geographic location likely impacts the length. Coastal populations spend 1 to 3 years in the larval state, whereas montane or inland populations spend 3 to 4 years. Tailed frog tadpoles undergo metamorphosis, which includes absorbing their tails, developing an adult mouth, losing the suction mouth, and developing legs. A juvenile may not reach reproductive maturity until it is 2 to 8 years old, varying geographically.

Breeding interval: Tailed frog females breed biennially, while males may breed annually.

Breeding season: Tailed frogs breed from September through October (fertilization) and females lay eggs from June to July (oviposition).

Range number of offspring: 44 to 85.

Average time to hatching: 6 weeks.

Range age at sexual or reproductive maturity (female): 2.5 to 4 years.

Average age at sexual or reproductive maturity (female): 3 years.

Range age at sexual or reproductive maturity (male): 1.5 to 4 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous ; sperm-storing

There is little available information on parental care in tailed frogs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds May-October, mostly in fall. Fertilization is internal; male has a tail-like copulatory organ. Clutch size averages 44-75; eggs are laid in July, hatch in August-September. Larval period lasts 2-4 years in mountains and northern areas, 1 year in a few coastal Oregon populations (Bury and Adams 1999) and in lowland streams of California (Wallace and Diller 1998). May not breed until 7-8 years old or 6-8 years after metamorphosis (Nussbaum et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ascaphus truei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACTCGTTGGCTATTTTCAACAAATCATAAAGATATTGGCACCCTGTATTTAGTTTTTGGTGCCTGAGCAGGAATAGTTGGTACAGCCTTAAGTCTACTAATTCGAGCGGAACTAAGTCAACCTGGGGCCCTCTTGGGGGAC---GATCAGATTTATAACGTTATTGTTACTGCTCATGCTTTTGTTATGATCTTTTTTATAGTTATACCTGTCATAATTGGGGGCTTTGGAAACTGGCTGGTACCTTTAATAATTGGGGCCCCAGATATAGCTTTCCCCCGAATAAATAACATAAGCTTCTGATTATTACCCCCGTCTTTTCTGCTGCTCCTAGCTTCTTCTGGAGTAGAAGCAGGGGCAGGAACAGGGTGAACTGTTTATCCCCCTTTAGCAGGCAATCTGGCACATGCGGGAGCTTCTGTAGACCTAACTATTTTTTCACTCCACCTGGCTGGTATCTCTTCTATTTTAGGAGCAATTAACTTTATTACTACTACTATTAATATAAAACCCCCAGCGATATCTCAATATCAAACACCCCTATTTGTATGATCTGTGCTAATTACCGCTATTCTGTTACTACTATCTCTACCAGTACTAGCAGCAGGAATTACTATACTTCTTACGGATCGAAATCTAAATACAACCTTTTTTGACCCAGCAGGAGGGGGAGACCCAGTCCTTTATCAACATCTATTTTGATTTTTTGGGCACCCAGAAGTTTATATTCTTATTTTACCAGGCTTTGGGATAATTTCACATATTGTTACCTATTACTCAGGTAAAAAAGAACCCTTCGGCTATATAGGGATAGTATGAGCTATAATATCTATTGGCCTACTTGGCTTTATTGTTTGGGCCCACCATATGTTTACAGTGGACCTCAATGTTGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ascaphus truei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Ascaphus truei is ranked as a species of “Least Concern” on the IUCN Red List but are a “Species of Concern” for the Pacific region on the United States Fish and Wildlife Endangered Species List. The reason behind its status on either list is the fact that tailed frogs may be impacted by logging and construction activities. These practices can negatively alter tailed frogs' habitats by causing stream temperatures to rise and siltation to occur.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson, Michael Adams

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Moderately widespread and locally common in the Pacific Northwest from British Columbia to northwestern California; may be detrimentally affected by habitat changes resulting from timber harvest (depends on surface geology and harvest practices), but exists in many young forests that have been harvested in the past.

Intrinsic Vulnerability: Highly to moderately vulnerable.

Environmental Specificity: Very narrow to narrow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species has many extant occurrences distributed throughout the range. Total population size is unknown but probably exceeds 10,000. It is common in suitable habitat. Its long-term trend is likely relatively stable in terms of extent of occurrence. There has been an unknown degree of decline in population size, area of occupancy, and number/condition of locations. Its short-term population trend is probably declining based on habitat trends, but few population data are available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Probably declining, based on habitat trends; few population data are available.

Global Long Term Trend: Relatively stable to decline of 50%

Comments: Likely relatively stable in extent of occurrence, unknown degree of decline in population size, area of occurrence, and number/condition of occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Ascaphus is non-vocal. Its internal fertilization (an adaption to ensure fertilization in fast moving streams) is unique among frogs. Breeding season lasts from May through September. Eggs are deposited in strings under rocks in fast-moving streams. Tailed frogs are primarily aquatic; adults may emerge to forage on land in cool, wet conditions, especially at night. Larvae take between 1 to 4 years to metamorphose, depending on drainage (Bull and Carter 1996; Wallace and Diller 1998) . Juveniles are sexually mature in 7-8 years. Maximum average Ascaphusdensity per linear meter of stream was 0.162 larvae and 0.035 adults in western Oregon (Bull and Carter 1996). Nussbaum et al (1983) cite densities as high as 1 frog per meter of stream in eastern Washington.

  • Stebbins, R. C. (1985). A Field Guide to Western Reptiles and Amphibians. Houghton Mifflin, Boston.
  • Ford, L.S., and Cannatella, D.C. (1993). ''The major clades of frogs.'' Herpetological Monographs, 7, 94-117.
  • Nussbaum, R. A., Brodie, E. D., Jr., and Storm, R. M. (1983). Amphibians and Reptiles of the Pacific Northwest. University of Idaho Press, Moscow, Idaho.
  • Stebbins, R.C. (1951). Amphibians of Western North America. University of California Press, Berkeley.
  • Bull, E. L. and Carter, B. E. (1996). ''Tailed Frogs: Distribution, ecology, and association with timber harvest in Northeastern Oregon.'' United States Forest Service Research Paper, (497), 1-12.
  • Orchard, S.A. (1992). ''Amphibian population declines in British Columbia.'' Declines in Canadian amphibian populations: designing a national monitoring strategy. C. A. Bishop nd K.E. Petit, eds., Canadian Wildlife Service, 10-13.
  • Wallace, R. L. and Diller, L. V. (1998). ''Length of the larval cycle of Ascaphus truei in coastal streams of the redwood region, northern California.'' Journal of Herpetology, 32(3), 404-409.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It is sensitive to logging and road building (Leonard et al. 1993). Logging and construction practices that increase water temperatures and siltation might have an adverse effect on tailed frog populations (Nussbaum et al. 1983, Welsh and Ollivier 1998). See also Bury and Corn (1988) and Corn and Bury (1989) for information on negative effects of timber harvest. Diller and Wallace (1999) emphasized that current timber harvest practices are not as detrimental as those used in the past. Despite negative effects of logging, this species frequently occurs in many young forests that have been harvested one or more times in the past. Sensitivity to timber harvest might depend on surface geology and harvest practices (Adams and Bury 2002, Welsh and Lind 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: Medium

Comments: Sensitive to logging and road building (Leonard et al. 1993). Logging and construction practices that increase water temperatures and siltation may have an adverse effect on tailed frog populations (Nussbaum et al. 1983, Welsh and Ollivier 1998). See also Bury and Corn (1988) and Corn and Bury (1989) for information on negative effects of timber harvest. Diller and Wallace (1999) emphasized that current timber harvest practices are not as detrimental as those used in the past. Despite negative effects of logging, this species frequently occurs in many young forests that have been harvested one or more times in the past. Sensitivity to timber harvest may depend on surface geology and harvest practices (Adams and Bury 2002, Welsh and Lind 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Not federally listed, but a California Species of Special concern. Habitat modification due to timber harvesting may be a major cause of declines in Ascaphus. Bull and Carter (1996) found that the presence of a tree-lined buffer zone was significantly correlated with Tailed frog abundance, while overall logging level within the watershed showed only a non-significant trend. In British Columbia, conservation plans are difficult to implement, since Tailed Frogs (along with Pacific Giant Salamanders, Dicamptodon tenebrosus) avoid areas with predatory game fish; it is the riparian areas with those game fish that are protected (Orchard 1992).

  • Stebbins, R. C. (1985). A Field Guide to Western Reptiles and Amphibians. Houghton Mifflin, Boston.
  • Ford, L.S., and Cannatella, D.C. (1993). ''The major clades of frogs.'' Herpetological Monographs, 7, 94-117.
  • Nussbaum, R. A., Brodie, E. D., Jr., and Storm, R. M. (1983). Amphibians and Reptiles of the Pacific Northwest. University of Idaho Press, Moscow, Idaho.
  • Stebbins, R.C. (1951). Amphibians of Western North America. University of California Press, Berkeley.
  • Bull, E. L. and Carter, B. E. (1996). ''Tailed Frogs: Distribution, ecology, and association with timber harvest in Northeastern Oregon.'' United States Forest Service Research Paper, (497), 1-12.
  • Orchard, S.A. (1992). ''Amphibian population declines in British Columbia.'' Declines in Canadian amphibian populations: designing a national monitoring strategy. C. A. Bishop nd K.E. Petit, eds., Canadian Wildlife Service, 10-13.
  • Wallace, R. L. and Diller, L. V. (1998). ''Length of the larval cycle of Ascaphus truei in coastal streams of the redwood region, northern California.'' Journal of Herpetology, 32(3), 404-409.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Range includes many national parks and wilderness areas. Maintenance of cool, forested, unsilted streams and stream corridors is a basic conservation need.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Requirements: Maintenance of cool, forested, unsilted streams and stream corridors is a basic conservation need.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Several to many (4-40) occurrences appropriately protected and managed

Comments: Range includes several national parks and wilderness areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known negative impacts of tailed frogs on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Due to the sensitivity of tailed frogs to alterations of their habitat, this stream-dwelling species may serve as an indicator species in assessing ecosystem health.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Nielson et al. (2001) examined phylogeography of A. TRUEI using mtDNA data. Based on the results of this study and on previous allozyme and morphological data, they recommended that the coastal and inland segments of A. TRUEI be recognized as distinct species, A. TRUEI (coastal) and A. MONTANUS (inland). See also Ritland et al. (2000) for information on tailed frog phylogeography based on genetic variation.

Tailed frogs sometimes are placed in the family Leiopelmatidae. Stebbins (1985) placed them in the family Ascaphidae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!