Overview

Comprehensive Description

Description

Rana clamitans is a medium to large bodied frog. Adults in Georgia attain a body length of 86 mm in males and 87 mm in females while those in the north reach 103 mm in males and 105 mm in females. There is a similar clinal increase in body size from low to high altitudes. Dorsal coloration varies extensively, from brown, bronze, or olive to green, bicolor or bluish. The dorsum may have spots, blotches, or vermiculations of dark pigment, but such markings are not present on all individuals. The dorsolateral folds are distinct. Venter is white, sometimes with gray mottling on the throat, jaw margin and hind limbs. The outer surface of the limbs is barred or nearly so. The side of the face is colored bronze or green. There is no light line present on the upper jaw. Toes are webbed extensively, but not to the tips of digits III,IV,V. In males the tympanum is larger than the eye, the thumb and forelimb are enlarged, and the lateral vocal sacs are not externally visible. The skin of northern males is slightly rough and the throat is yellow.

R. c. clamitans and R. c. melanota are subspecies.

Hear calls at the Western Sound Archive.

  • Stewart, M. M. (1963). ''Rana clamitans.'' Catalogue of American Amphibians and Reptiles. American Society of Ichthyologists and Herpetologists, 337.1-337.4.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species can be found throughout eastern USA and adjacent southeastern Canada (Conant and Collins 1991). Introduced in Newfoundland, British Columbia (not mapped here), Washington, Utah, and probably elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Range extends throughout the eastern United States and adjacent southeastern Canada (Conant and Collins 1991). This species has been introduced in Newfoundland, British Columbia (Matsuda et al. 2006), Washington (Jones et al. 2005), Utah, and probably elsewhere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Green frogs (Rana_clamitans) are native only to the Nearctic region. They are found in the United States and Canada from Maine and the Maritime provinces of Canada through the Great Lakes region and into western Ontario and Oklahoma, south to eastern Texas, east into northern Florida and extending up the entire east coast of the United States.

Biogeographic Regions: nearctic (Native )

  • Harding, J. 1997. Amphibians and Reptiles of the Great Lakes Region. Ann Arbor, Michigan: The University of Michigan Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Found from the northern shore of the Gulf of St. Lawrence to central Florida, and from the Atlantic Coast to eastern Texas and southeastern Manitoba. Notably absent from the central Illinois Prairie. Found from the coastal lowlands to elevations of more than 1950m. Introduced populations have been established in Newfoundland, Utah, Washington and British Columbia.

  • Stewart, M. M. (1963). ''Rana clamitans.'' Catalogue of American Amphibians and Reptiles. American Society of Ichthyologists and Herpetologists, 337.1-337.4.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Physical Description

Morphology

Physical Description

Green frogs are green, greenish brown, brownish, yellowish green, and olive, with some rare individuals being blue. They are generally brighter in front with small, random black spots. Their legs have dark bands across them and their skin is yellowish or white below the bands. Males usually have a bright yellow throat. Their tympanum ( visible external ear on the side of their heads) is large. The tympanum is much larger than the eye in males and is the same size as the eye in females. They have a well defined back ridge that extends from the back of the eye and continues the length of their body. Their toes are well webbed and their first fingers do not extend beyond their second fingers. The adults are 7.5 to 12.5 cm in length (3 to 5 inches).

Range length: 7.5 to 12.5 cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

  • Jordan, D. 1929. Manual of the Vertebrate Animals. New York: World Book Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 10 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It can be found on the margins of virtually any body of permanent or semi-permanent water; young may use temporary pools. It may disperse from water in wet weather, especially at night. It seeks cover under objects on land, underground, or in water when inactive. Eggs and larvae develop in shallow, slow- or non-flowing water.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Green frogs inhabit virtually any body of permanent or semipermanent water, as well as vernal pools, and juveniles regularly use nearby small temporary pools and puddles. Individuals may disperse from water in wet weather, especially at night. In winter, they shelter under objects on land, underground, or in water. Many overwinter in flowing water of small streams. Wintering sites may be in breeding areas or commonly several hundred meters away. Breeding sites are in shallow, slow- or nonflowing water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Green frogs are found in a wide variety of habitats that surround most inland waters, including swamps, wooded swamps, ponds, lakes, marshes, bogs, banks of slow moving rivers and streams, sloughs, and impoundments. Young frogs may disperse into wooded areas or meadows when it rains. Green frogs hibernate through the winter in the mud at the bottom of a body of water.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: taiga ; savanna or grassland ; forest

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh ; swamp ; bog

  • Tyning, T. 1990. Stokes Nature Guides: A guide to Amphibians and Reptiles. Boston, MA: Little, Brown and Company.
  • Harding, J., J. Holman. 1992. Michigan Frogs, Toads, and Salamanders. East Lansing, Michigan: Michigan State University Museum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

In New York, migrates up to 560 m from breeding ponds to overwintering sites (Lamoureux and Madison 1999). Daily movements <10 m for 80% of recaptures in one study. See Mazerolle (2001) for information on activity, movement patterns, and body size of frogs in fragmented peat bogs in New Brunswick.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Metamorphosed frogs eat various small, mainly terrestrial, invertebrates; occasionally small amphibians. Larvae eat suspended matter, organic debris, algae, plant tissue, and minute organisms in water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Green frogs are primarily carnivores and eat a wide variety of insecta and other invertebrates from both land and water, such as Stylommatophora, gastropoda, Astacoidea, Araneae, Diptera, lepidoptera, lepidoptera, and lepidoptera. They also eat other vertebrates, such as small serpentes and anura. Green frogs practice "sit and wait" hunting and therefore eat whatever comes within reach. Tadpoles mainly eat diatoms, algae, and tiny amounts of small animals such as zooplankton (Copepoda and Cladocera).

Animal Foods: amphibians; reptiles; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic crustaceans; zooplankton

Plant Foods: algae

  • Jenssen, T. 1967. Food Habits of the Green Frog, Rana clamitans, before and during metamorphosis.. Copeia, 1967: 214-218.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Green frogs are common and abundant and serve as a food source for many other animals. They also eat large quantities of insects and other animals, thus impacting their populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Green frogs are preyed upon by a variety of animals. Tadpoles and eggs are eaten by Hirudinea, Odonata larvae, other aquatic insecta, actinopterygii, testudines, and ardeidae. Adult frogs are eaten by larger anura, turtles, serpentes, herons, other Ciconiiformes, procyon lotor, lontra canadensis, mustela vison, and humans.

Green frogs often look much like Rana septentrionalis where the two species occur together. This may be a form of mimicry because mink frogs have a musky skin secretion that makes them foul tasting to many predators. Green frogs do not have a foul taste, so may be taking advantage of their resemblance to mink frogs to avoid being preyed upon.

Known Predators:

  • leeches (Hirudinea)
  • dragonfly larvae (Odonata)
  • other aquatic insects (Insecta)
  • fish (Actinopterygii)
  • turtles (Testudines)
  • herons (Ardeidae)
  • snakes (Serpentes)
  • larger frogs (Anura)
  • other wading birds (Ciconiiformes)
  • raccoons (Procyon_lotor)
  • norther river otters (Lontra_canadensis)
  • American minks (Mustela_vison)
  • humans (Homo_sapiens)

Anti-predator Adaptations: mimic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Represented by many and/or large occurrences throughout most of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population is unknown but likely exceeds 1,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

See Hecnar and M'Closkey (1997) for information on the dynamics of populations in 160 ponds in Ontario.

When approached along the edge of a pond, green frogs often leap into the water while emitting a loud squeenk call. Usually they soon return to shore and then often allow close approach if one moves slowly.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Green frogs produce as many as six different calls. Males attracting a mate give an advertisement call and a high-intensity advertisement call. Their advertisement call has been compared to the pluck of a loose banjo string. Male frogs defending a territory from an intruding male usually give aggressive calls and growls. The release call is given by non-receptive females and by males accidentally grabbed by another male. Finally, the alert call is given by males and females when startled or attacked by a predator.

Green frogs have an excellent sense of vision and use this to detect and capture prey.

Communication Channels: acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Green frogs are inactive during cold weather in winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

Eggs hatch in 3 to 7 days. After hatching, green frog tadpoles are usually green with small black dots and often have yellow bellies. It can take them anywhere from 3 to 22 months to begin metamorphosis into full grown frogs. Some undergo this transition before the winter, but many tadpoles go into hibernation and wait until the spring to transform. Green frogs reach their maximum size when they are 4 to 5 years old.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan in the wild is unknown, but captive animals can live to 10 years.

Range lifespan

Status: captivity:
10 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10 years (captivity) Observations: In the wild these animals live up to 6 years but they have been reported to live up to 10 years in captivity (http://www.pwrc.usgs.gov/neparc/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding occurs in spring or summer. In the north, males call mainly in late spring and early summer (mostly May to August). In the south, breeding may occur as early as March. Adult females deposit 1-2 clutches of up to several thousand eggs. Larvae emerge from jelly in 3-7 days. In the south, larvae from early clutches may metamorphose in a few months, larvae from late clutches overwinter before metamorphosing, as do most larvae in the northern part of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Female green frogs choose their mates based on the desirability of their territories for egg laying. Satellite males may also be present during the breeding period of green frogs. A satellite male is described as a smaller male, unable to acquire and defend territories, and it is often found in areas protected by a larger male. The satellite male will wait for the opportunity to mate with a female that is responding to the larger more dominant male frog's vocalizations.

Mating System: polygynous

Breeding takes place in late spring. Variation in temperature and region can influence actual breeding times. The length of the breeding season is 1 to 3 months and occurs in a variety of habitats, such as swamps, ponds, marshes, bogs, and slow moving streams. During breeding each female may lay 1000 to 5000 eggs in clusters that float on the water surface or hang from water plants. Multiple egg clutches are possible, but the second egg clutch is usually smaller, with about 1000 to 1500 eggs. Eggs hatch in 3 to 5 days and complete the tadpole stage of development in 3 to 22 months.

Breeding interval: Green frogs can have two or more clutches per season, with the second clutch producing significantly fewer eggs.

Breeding season: Green frogs breed in late spring.

Range number of offspring: 1000 to 5000.

Range time to hatching: 3 to 5 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Female green frogs nurture their eggs inside their bodies before they are laid and fertilized. Once the eggs are laid, there is no further parental involvement in their development.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female)

  • Tyning, T. 1990. Stokes Nature Guides: A guide to Amphibians and Reptiles. Boston, MA: Little, Brown and Company.
  • Harding, J., J. Holman. 1992. Michigan Frogs, Toads, and Salamanders. East Lansing, Michigan: Michigan State University Museum.
  • Wells, K. 1976. Multiple egg clutches in the green frog (Rana clamitans). Herpetologica, 32(1): 85-87.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rana clamitans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATATTTAGTCTTCGGCGCCTGAGCCGGGATAGTCGGAACAGCCTTAAGTCTGCTTATTCGCGCAGAATTAAGCCAACCAGGAACCCTCCTTGGCGACGACCAAATCTATAATGTCATCGTTACTGCTCACGCATTCGTAATAATTTTCTTCATAGTTATGCCTATTCTAATTGGAGGCTTTGGAAACTGACTAGTCCCCCTAATGATTGGGGCCCCTGATATGGCCTTCCCTCGAATAAATAATATGAGCTTTTGACTTCTCCCTCCATCCTTCTTTCTTCTGCTAGCTTCTTCCACAGTTGAAGCCGGGGCTGGCACAGGCTGAACAGTCTACCCCCCTCTAGCTGGAAACCTCGCCCATGCAGGCCCATCTGTAGATTTAGCTATCTTCTCACTACATTTAGCTGGGGTATCCTCTATTCTAGGGGCTATTAATTTTATTACTACAATTATTAACATAAAACCATCCTCAACTACACAATACCAAACACCTCTATTTGTCTGATCAGTCTTAATCACCGCAGTTCTACTACTTTTATCTCTCCCAGTACTAGCTGCCGGAATTACTATACTCCTCACAGATCGAAACCTAAACACCACATTTTTCGACCCTGCAGGAGGTGGAGATCCTGTTCTCTACCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rana clamitans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 48
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Moderate to broad.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Green frogs are abundant throughout all of their range. Although limb deformities and other abnomalities have been reported in green frog populations, possibly as a result of water contamination, they are still numerous and widespread.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Thousands of populations are abundant and stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: For an example of stability on a large scale, see Hecnar and M'Closkey (1997).

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: Low

Comments: Locally threatened by habitat loss/degradation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation methods are needed. It occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative effects of green frogs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Green frogs are sometimes hunted for food by humans. Though they are typically too small to be economically important as frog legs, they are harvested for them sometimes. They are used by the scientific community in research and for educational purposes in biology classrooms.

Positive Impacts: food ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lithobates clamitans

The green frog (Lithobates clamitans[4]) is a species of frog native to the eastern half of the United States and Canada. The two subspecies are the bronze frog and the northern green frog.

Description[edit]

This species is a mid-sized true frog. Adult green frogs range from 5–10 cm (2.0–3.9 in) in body length (snout to vent, excluding the hind legs). The typical body weight of this species is from 28 to 85 g (0.99 to 3.00 oz).[5][6] The sexes are sexually dimorphic in a few ways: mature females are typically larger than males, the male tympanum is twice the diameter of the eye, whereas in females, the tympanum diameter is about the same as that of the eye, and males have bright yellow throats. The dorsolateral ridges, prominent, seam-like skin folds that run down the sides of the back, distinguish the green frog from the bullfrog, which entirely lacks them.

Habitat[edit]

Green frogs live wherever shallow freshwater ponds, road-side ditches, lakes, swamps, streams, and brooks are found. Most often seen resting along the shore, they leap into the water when approached. By inhabiting an ecotone, in this case the terrestrial and aquatic habitat boundary, green frogs (and other aquatic ranid frogs), by employing a simple leap, leave behind their many and faster terrestrial enemies that cannot similarly cross that boundary.

Behavior[edit]

Adult green frogs are highly aquatic, but juveniles will sometimes go overland when the grass and soil are wet. This species is usually diurnal, although their calls are sometimes heard at night during hotter weather.

Reproduction[edit]

Green frog pair in amplexus: Note large tympanum of male, on top, and small tympanum of the female

Green frogs breed in semipermanent or permanent fresh water. Males call from and defend territories. The distinctive call sounds like a plucked banjo string, usually given as a single note, but sometimes repeated.

The breeding season is from April to August.

Actual mating involves amplexus, whereby the male grasps the female with his forelimbs posterior to her forelimbs. The female releases her eggs and the male simultaneously releases sperm which swim to the egg mass. Fertilization takes place in the water. A single egg clutch may consist of 1000 to 7000 eggs, which may be attached to submerged vegetation.

Green frog tadpoles are olive green and iridescent creamy-white below. Metamorphosis can occur within the same breeding season or tadpoles may overwinter to metamorphose the next summer. Males become sexually mature at one year, females may mature in either two or three years.

Feeding[edit]

Green frogs will attempt to eat any mouth-sized animal they can capture, including insects, spiders, fish, crayfish, shrimp, other frogs, tadpoles, small snakes, birds, and snails. Tadpoles graze on algae and water plants.


Conservation status[edit]

The green frog is one of the most abundant frogs wherever it occurs and has no known problems. Green frogs are protected by the law in some US states.

Subspecies[edit]

The two recognized subspecies of L. clamitans are:

Gallery[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!