Overview

Comprehensive Description

Description

Tympanic membrane absent. Skin smooth. Sternum ossified. Pupil of the eye is vertical. Webs between the toes well-developed. Inner metatarsal tubercle of the hind fooot quite large and spade-shaped. No male resonators. Body robust, hind legs short, head large. Dorsal coloration is quite variable, from grey, brown, and yellowish to dark-brown or greenish, with small light spots. Sometimes the coloration is uniform. Belly light, with darker spots. The male is smaller than female. During the reproductive period the male possesses tubercles on the palms and forearms.

  • Gasc, J.-P. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica, Bonn, Germany.
  • Paris, M.G., Martin, C., Dorda, J. and Esteban, M. (1989). Los Anfibios y Reptiles de Madrid. Servicio de Extension Agraria, Ministerio de Agricultura, Madrid.
  • Salvador, A. (1985). Guia de Campo de los Anfibios y Reptiles de la Peninsula Iberica, Islas Baleares y Canarias. Santiago Garcia, Leon.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is present in most of the Iberian Peninsula (except the northern area of the Peninsula and parts of central and northern Portugal), and southern France. There are also isolated populations in western France. It occurs from sea level (France and Spain) up to 1,770m asl (Spain). Its Area Of Occupancy is much smaller than its Extent Of Occurrence, as it is restricted to a specific type of habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

The species inhabits Iberian Peninsula (except for its north), Southeastern and Western France (departments Charente-Maritime, Vendee, north of Gironne, and Loire-Atlantique). The species seems to be most common along the coast of France and in some areas in Spain: Cataluna and Western Andalucia.Pelobates cultripes lives in various open landscapes, such as dunes, agricultural landscapes, fields, meadows etc. Reproduction occurs in stagnant water bodies.

  • Gasc, J.-P. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica, Bonn, Germany.
  • Paris, M.G., Martin, C., Dorda, J. and Esteban, M. (1989). Los Anfibios y Reptiles de Madrid. Servicio de Extension Agraria, Ministerio de Agricultura, Madrid.
  • Salvador, A. (1985). Guia de Campo de los Anfibios y Reptiles de la Peninsula Iberica, Islas Baleares y Canarias. Santiago Garcia, Leon.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

California Central Valley Grasslands Habitat

This taxon is found in the California Central Valley grasslands, which extend approximately 430 miles in central California, paralleling the Sierra Nevada Range to the east and the coastal ranges to the west (averaging 75 miles in longitudinal extent), and stopping abruptly at the Tehachapi Range in the south. Two rivers flow from opposite ends and join around the middle of the valley to form the extensive Sacramento-San Joaquin Delta that flows into San Francisco Bay.

Perennial grasses that were adapted to cool-season growth once dominated the ecoregion. The deep-rooted Purple Needle Grass (Nassella pulchra) was particularly important, although Nodding Needle Grass (Stipa cernua), Wild Ryes (Elymus spp.), Lassen County Bluegrass (Poa limosa), Aristida spp., Crested Hair-grass (Koeleria pyramidata), Deergrass (Muhlenbergia rigens,), and Coast Range Melicgrass (Melica imperfecta) occurred in varying proportions. Most grass growth occurred in the late spring after winter rains and the onset of warmer and sunnier days. Interspersed among the bunchgrasses were a rich array of annual and perennial grasses and forbs, the latter creating extraordinary flowering displays during certain years. Some extensive mass flowerings of the California Poppy (Eschscholzia californica), Lupines (Lupinus spp.), and Exserted Indian Paintbrush (Castilleja exserta) are found in this grassland ecoregion.

Prehistoric grasslands here supported several herbivores including Pronghorn Antelope (Antilocapra americana), elk (including a valley subspecies, the Tule Elk, (Cervus elaphus nannodes), Mule Deer (Odocoileus hemionus), California ground squirrels, gophers, mice, hare, rabbits, and kangaroo rats. Several rodents are endemics or near-endemics to southern valley habitats including the Fresno Kangaroo Rat (Dipodomys nitratoides exilis), Tipton Kangaroo Rat (Dipodomys nitratoides nitratoides), San Joaquin Pocket Mouse (Perognathus inornatus), and Giant Kangaroo Rat (Dipodomys ingens). Predators originally included grizzly bear, gray wolf, coyote, mountain lion, ringtail, bobcat, and the San Joaquin Valley Kit Fox (Vulpes velox), a near-endemic.

The valley and associated delta once supported enormous populations of wintering waterfowl in extensive freshwater marshes. Riparian woodlands acted as important migratory pathways and breeding areas for many neotropical migratory birds. Three species of bird are largely endemic to the Central Valley, surrounding foothills, and portions of the southern coast ranges, namely, the Yellow-billed Magpie (Pica nuttalli), the Tri-colored Blackbird (Agelaius tricolor EN), and Nuttall’s Woodpecker (Picoides nuttallii).

The valley contains a number of reptile species including several endemic or near-endemic species or subspecies such as the San Joaquin Coachwhip (Masticophis flagellum ruddocki), the Blunt-nosed Leopard Lizard (Gambelia sila EN), Gilbert’s Skink (Plestiodon gilberti) and the Sierra Garter Snake (Thamnophis couchii). Lizards present in the ecoregion include: Coast Horned Lizard (Phrynosoma coronatum NT); Western Fence Lizard (Sceloporus occidentalis); Southern Alligator Lizard (Elgaria multicarinata); and the Northern Alligator Lizard (Elgaria coerulea).

There are only a few amphibian species present in the California Central Valley grasslands ecoregion. Special status anuran taxa found here are: Foothill Yellow-legged Frog (Rana boylii NT); Pacific Chorus Frog (Pseudacris regilla); and Western Spadefoot Toad (Pelobates cultripes). The Tiger Salamander (Ambystoma tigrinum) occurs within this ecoregion.

Although many endemic plant species are recognized, especially those associated with vernal pools, e.g. Prickly Spiralgrass (Tuctoria mucronata). A number of invertebrates are known to be restricted to California Central Valley habitats. These include the Delta Green Ground Beetle (Elaphrus viridis CR) known only from a single vernal pool site, and the Valley Elderberry Longhorn Beetle (Desmocerus californicus dimorphus) found only in riparian woodlands of three California counties.

Vernal pool communities occur throughout the Central Valley in seasonally flooded depressions. Several types are recognized including valley pools in basin areas which are typically alkaline or saline, terrace pools on ancient flood terraces of higher ground, and pools on volcanic soils. Vernal pool vegetation is ancient and unique with many habitat and local endemic species. During wet springs, the rims of the pools are encircled by flowers that change in composition as the water recedes. Several aquatic invertebrates are restricted to these unique habitats including a species of fairy shrimp and tadpole shrimp.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
The burrowing habits of this species generally restrict its distribution to areas with sandy or soft soils. It occurs in dunes, oak forest, scrub, cultivated land, and open areas, sometimes close to human habitation. In France it is largely restricted to coastal regions. It breeds in temporary pools and livestock ponds with thick vegetation that occasionally may be brackish. This species has a long larval development period, which makes it vulnerable to introduced predators and desiccation of ponds.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pelobates cultripes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCGTTGACTTTATTCAACAAATCACAAAGACATCGGCACCCTTTATTTAATCTTCGGTGCCTGAGCCGGAATAGTGGGAACAGCTTTAAGCCTATTAATCCGAGCAGAACTTAGTCAGCCAGGAACGCTTCTTGGAGAC---GACCAAATTTATAACGTAATCGTTACCGCACATGCATTCGTAATAATTTTCTTTATAGTGATACCAATCATGATCGGAGGGTTTGGTAATTGACTGATTCCCTTAATAATTGGGGCCCCAGATATGGCATTCCCACGAATGAATAACATAAGCTTCTGACTCTTACCTCCATCTTTCTTACTACTTCTTGCCTCATCAGCAGTAGAATCAGGGGCCGGAACCGGTTGGACTGTGTATCCTCCTTTAGCTGGAAATTTAGCCCATGCAGGAGCATCAGTTGATTTGACCATTTTTTCCCTCCATTTAGCAGGCGTTTCATCAATTCTGGGGGCAATTAACTTTATCACTACCATCTTGAATATGAAACCACCTGCCATAACTCAATACCAAACCCCTCTATTTGTTTGATCGGTTTTAATTACCGCTGTACTTCTACTTCTATCCCTTCCTGTTTTAGCAGCAGGCATTACCATGCTCCTTACAGATCGAAATTTAAACACAACCTTTTTTGACCCAGCAGGAGGAGGAGACCCAGTTCTTTATCAACATTTATTCTGATTCTTTGGTCACCCAGAGGTCTACATTCTTATTCTTCCAGGGTTTGGAATAATTTCCCACATTGTAACCTACTACTCTGGAAAAAAAGAACCTTTTGGTTATATAGGAATAGTTTGAGCAATGATGTCAATTGGCCTCTTAGGATTCATTGTTTGAGCCCACCACATATTTACAGTAGACCTAAATGTCGATACTCGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pelobates cultripes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Pedro Beja, Jaime Bosch, Miguel Tejedo, Miguel Lizana, Iñigo Martínez-Solano, Alfredo Salvador, Mario García-París, Ernesto Recuero Gil, Valentin Pérez-Mellado, Carmen Diaz Paniagua, Marc Cheylan, Rafael Marquez, Philippe Geniez

Reviewer/s
Cox, N. and Temple, H.J. (Global Amphibian Assessment)

Contributor/s

Justification
Listed as Near Threatened because this species is probably in significant decline (but probably at a rate of less than 30% over ten years) because of widespread habitat loss through much of its range and the impacts of invasive predators, thus making the species close to qualifying for Vulnerable.

History
  • 2006
    Near Threatened
    (IUCN 2006)
  • 2006
    Near Threatened
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is generally common in suitable habitat. However, population declines have been observed in most of its range.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

In the northern parts of the range, a short hibernation occurs, whereas in the south aestivation is supposed. Reproduction occurs from October to May, depending on latitude and altitude. Amplexus is pelvic (inquinal). Embryonic and larval development takes about 4-6 months. Some larvae apparently delay their metamorphosis, and attain very large size (to 120 mm). Longevity in this species is estimated to 10-15 years old.Food of adults consists mainly of crawling terrestrial arthropods: carabids, spiders etc.

  • Gasc, J.-P. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica, Bonn, Germany.
  • Paris, M.G., Martin, C., Dorda, J. and Esteban, M. (1989). Los Anfibios y Reptiles de Madrid. Servicio de Extension Agraria, Ministerio de Agricultura, Madrid.
  • Salvador, A. (1985). Guia de Campo de los Anfibios y Reptiles de la Peninsula Iberica, Islas Baleares y Canarias. Santiago Garcia, Leon.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
In Iberia threats include the isolation of populations by agricultural intensification, destruction of wetland habitats (by urban development) and their pollution (with agrochemicals), and introduction of predatory Louisiana crayfish (Procambarus clarkii) and fish (such as Gambusia holbrooki) to breeding areas. Mortality on roads, and tourism development, are causing localized declines in some populations. In France, tourism and wetland drainage are the principal threats to this species. Overall, the severity of the threats to this species appears to be increasing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

The species is generally not threatened, except for some peripheral populations (see above). The main threats are isolation of populations by agriculture, destruction of natural habitats, introduction of fishes in breeding ponds, modification and contamination of wetlands etc.

  • Gasc, J.-P. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica, Bonn, Germany.
  • Paris, M.G., Martin, C., Dorda, J. and Esteban, M. (1989). Los Anfibios y Reptiles de Madrid. Servicio de Extension Agraria, Ministerio de Agricultura, Madrid.
  • Salvador, A. (1985). Guia de Campo de los Anfibios y Reptiles de la Peninsula Iberica, Islas Baleares y Canarias. Santiago Garcia, Leon.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in a number of protected areas, including several NATURA 2000 sites, and is listed on Appendix II of the Bern Convention and on Annex IV of the EU Habitats Directive. It is protected by national legislation in Spain, and is listed in a number of national and subnational Red Data Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Relation to Humans

The species occurs in human neighborhood, but in anthropogenic landscapes its populations undergo certain threats (see above).

  • Gasc, J.-P. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica, Bonn, Germany.
  • Paris, M.G., Martin, C., Dorda, J. and Esteban, M. (1989). Los Anfibios y Reptiles de Madrid. Servicio de Extension Agraria, Ministerio de Agricultura, Madrid.
  • Salvador, A. (1985). Guia de Campo de los Anfibios y Reptiles de la Peninsula Iberica, Islas Baleares y Canarias. Santiago Garcia, Leon.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pelobates cultripes

Pelobates cultripes is a toad species in the family Pelobatidae. It is known under many different common names, including the western spadefoot, Iberian spadefoot toad, Spanish spadefoot toad, and Wagler's spadefoot toad. It is found in parts of France, Spain, and Portugal.[3]

Description[edit]

The hind foot of the Pelobates cultripes

Pelobates cultripes is a big smooth-skinned toad with a silvery gold or greenish eye and a vertical pupil. It has a black spade on the hind foot, hence its name. The edged callus internus of the hind foot is converted to allow digging. The upperside is greyish-yellowish with dark brown or greenish blotches and spots. It grows up to 11 cm and is larger and greener than the common spadefoot, Pelobates fuscus.[4] The tadpoles are larger than those of most other toad species.

Behavior[edit]

This toad is mostly nocturnal, but occasionally vast numbers of it can be seen after rain. It hides in burrows up to 20 cm deep and can dig itself into earth quite fast. When threatened it inflates its body and mews, kitten-like.

It breeds often in temporary water that is sometimes brackish. During mating season males appear first on wet nights at breeding sites, the females arrive later. The length of the breeding period depends on the rainfall and may last a month or only few days. During this time Pelobates cultripes may be partly diurnal. Males grab the females at the loins. Females produce bands of up to 7000 eggs which are up to 100 cm long.[4] They lay them among vegetation or on the pond bottom. The eggs hatch after two weeks and the tadpoles take around 4 to 6 months to develop. The drying up of their pond is, after predation, the most common cause of their death. Young toads are 2 to 3.5 cm long after metamorphosis and take 3 years to reach maturity. This toad may live up to 15 years. Males produce a deep and rapid 'co-co-co' under water which sound like a clucking hen. Females call occasionally too.[4]

Distribution[edit]

This species is found mostly in Spain, Portugal and parts of France. Its range does not overlap with the common spadefoot. It occurs in open areas usually with soft or sandy oils and can be found at elevations up to 1,800 meters.

Tadpole of the western spadefoot
Tadpole in stage of metamorphosis
Young western spadefoot

References[edit]

  1. ^ Martín, C. & Sanchiz, B. (2014). "Pelobates cultripes (Cuvier, 1829)". Lisanfos KMS. Version 1.2. Online reference accessible at http://www.lisanfos.mncn.csic.es/. Museo Nacional de Ciencias Naturales, MNCN-CSIC, Madrid (Spain). Retrieved 3 March 2014. 
  2. ^ "International Union for Conservation of Nature: European List of Amphibians". Office of Protected Resources.  Retrieved April 11, 2011
  3. ^ Frost, Darrel R. (2014). "Pelobates cultripes (Cuvier, 1829)". Amphibian Species of the World: an Online Reference. Version 6.0. American Museum of Natural History. Retrieved 3 March 2014. 
  4. ^ a b c Arnold, Nicholas; Ovenden, Denys (2002). Field Guide Reptiles & Amphibians of Britain & Europe 2. London: HarperCollins. pp. 68–69. ISBN 0-00-219964-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!