Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Comprehensive Description

Description

Dendrobates auratus can be identified by their calligraphic brillant green markings on a black background on their dorsal side (Caldwell and Summers 2003). Ventrally, they are marbled or spotted with yellow, blue, or green on dark background (Guyer and Donnelly 2005). Among populations there are variation in both hue (ranging from white to blue-green) and pattern (from thick stripes to dots) (Caldwell and Summers 2003). Dendrobates auratus has a smooth upper surface with a head that is relatively long. The snout truncates to slightly rounded (Savage 2002). Dendrobates auratus is the largest poison-dart frog in Costa Rica, with adult females ranging from 27.0-42.0 mm and adult males ranging from 25.0-39.5 mm (Leenders 2001).

A Spanish-language species account can be found at the website of Instituto Nacional de Biodiversidad (INBio).

  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • Guyer, C., and Donnelly, M. A. (2005). Amphibians and Reptiles of La Selva, Costa Rica and the Caribbean Slope: A Comprehensive Guide. University of California Press, Berkeley.
  • Caldwell, J. P., and Summers, K. D. (2003). ''Green poison frog, Dendrobates auratus.'' Grzimek's Animal Life Encyclopedia, Volume 6, Amphibians. 2nd edition. M. Hutchins, W. E. Duellman, and N. Schlager, eds., Gale Group, Farmington Hills, Michigan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Dendrobates auratus can be found in Central and South America, from Nicaragua and Costa Rica to southeastern Brazil and Bolivia. They were also introduced in Hawaii by humans, and have flourished there. (  http://ecology.miningco.com/library/weekly/aa012598.htm)

Biogeographic Regions: neotropical (Native ); oceanic islands (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs in the humid lowlands from southeastern Nicaragua on the Atlantic slope and southeastern Costa Rica on the Pacific versant to northwestern Colombia (Golfo de Uraba on the Caribbean coast and the lower Atrato River drainage and Bahia Solano on the Pacific coast) (sea level up to 1,000m asl). In 1932, 206 specimens of D. auratus from Taboga or Taboguilla Islands, Panama were released in the upper Manoa Valley, Oahu, Hawaii in an attempt to control non-native insects (Silverstone, 1975; McKeown, 1996). A few feral populations of D. auratus descended from these animals still persist in the mountains and valleys of Oahu.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Humid lowlands from southeastern Nicaragua on the Atlantic slope and southeastern Costa Rica on the Pacific versant to northwestern Colombia (sea level to 1,000 m asl). In 1932, 206 specimens of D. auratus from Taboga or Taboguilla Islands, Panama were released in the upper Manoa Valley, Oahu, Hawaii in an attempt to control non-native insects (Silverstone, 1975; McKeown, 1996). A few feral populations of D. auratus descended from these animals still persist in the mountains and valleys of Oahu.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

This species can be found on the Caribbean slopes from southern Nicaragua to extreme eastern Panama, and on the Pacific slopes from the Osa Peninsula, Costa Rica to Colombia (Guyer and Donnelly 2005). It lives in lowlands, primarily rainforest (Caldwell and Summers 2003). It is a shy species, found deep in the forest interior (Leenders 2001).

  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • Guyer, C., and Donnelly, M. A. (2005). Amphibians and Reptiles of La Selva, Costa Rica and the Caribbean Slope: A Comprehensive Guide. University of California Press, Berkeley.
  • Caldwell, J. P., and Summers, K. D. (2003). ''Green poison frog, Dendrobates auratus.'' Grzimek's Animal Life Encyclopedia, Volume 6, Amphibians. 2nd edition. M. Hutchins, W. E. Duellman, and N. Schlager, eds., Gale Group, Farmington Hills, Michigan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Countries

Countries

Colombia, Costa Rica, Nicaragua, Panama. Introduced in Hawaii, USA.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dendrobates auratus has many color variants. Most of them are black and either green or light blue, with the black in bands or spots. The Hawaiian frogs are metallic green or brownish-black. The adults are approximately 4 cm long. As is true of most frogs, adults have a fused head and trunk with no tail. Tadpoles use gills to breathe, unlike the adults, which breathe through lungs. Tadpoles also lack legs and have tails, which is appropriate for their watery habitat. Another important physical characteristic of D. auratus is the poison glands located throughout the surface of their body. Their bright colors are believed to encourage predators with color vision to avoid the frogs. The boldly contrasting patterns may be aposematic to predators that lack color vision, although this has not been proven. Approximately 90 alkaloids have been identified from all species of dendrobatids <.. (Myers & Daly, 1976)

Average length: 4 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; polymorphic ; poisonous

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 4 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Identification

Adult

Species description based on Ibanez et al (1999) and Savage (2002).  A small, brightly colored frog. Males to 40 mm, females to 42 mm.

Dorsal

The dorsum is brown or black with bright green, blue, yellow or cream-colored markings (including spots, stripes, bands, blotches). Birkhahn et al (1994), Gray (2000), and Patrick and Sasa (2009) describe color and pattern variation in this species. Gray (2000) suggested that the bright coloration is important in visual communication in this species, rather than functioning as aposematic coloration.

Eye

The iris is black.

Extremities

Hands and feet have no webbing. Fingers and toes have small discs at the tips.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Dendrobates auratus
Catalog Number: USNM 10307
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Taboga Island, Gulf of Panama, Panama
  • Holotype: Girard, C. 1854. Proc. Acad. Nat. Sci. Philadelphia. 7 (6): 226.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Dendrobates auratus adults are found on the floor of rain forests. They prefer locations near small streams or pools. The tadpoles live in these small pools or streams. Where the frogs live in the heavily populated areas of Hawaii, the eggs are often deposited in broken beer bottles or old cans instead of the usual puddle. (Whitfield 1984)

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Aquatic Biomes: rivers and streams; temporary pools

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It is an arboreal and terrestrial diurnal species of humid lowland and submontane forest. It is also found in dense secondary growth and cocoa plantations (Kitasako, 1967). The adults are often associated large buttressed trees. Males are essentially non-territorial, but occasionally engage in aggressive competition (Wells, 1978). The species is polygynous; females actively compete for males and attempt to guard their mate from others. The species shows a high degree of paternal care. After oviposition upon leaf-litter the male guards and cares for the clutch of three to 13 eggs (Silverstone, 1975; Schafer, 1981; Heselhaus, 1992). On hatching (13-16 days in captivity) the tadpoles are carried by the male to a stagnant water body in a tree-hole, the leaf axil of a bromeliad (up to 30m from the forest floor), or a small ground pool (Eaton, 1941; van Wijngaarden, 1990). Wild tadpoles feed on protozoans and rotifers, and metamorphose after 39-89 days; in captivity, sexual maturity is attained at between six and 15 months (Eaton, 1941; Silverstone, 1975; Summers, 1990; Zimmermann and Zimmermann, 1994). A reduction in the number of egg clutches and tadpoles maintained by the male results in a more rapid development of the eggs and higher growth rate of tadpoles (Wells, 1978; Summers, 1990). Longevity of at least six years reported in captivity (Zimmermann and Zimmermann, 1994).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: An arboreal and terrestrial diurnal species of humid lowland and montane forest; also found in dense secondary growth and cocoa plantations (Kitasako, 1967. Adults are often associated large buttressed trees. Males are essentially non-territorial, but occasionally engage in aggressive competition (Wells, 1978). D. auratus is polygynous; females actively compete for males and attempt to guard their mate from others. The species shows a high degree of paternal care. After oviposition upon leaf litter the male guards and cares for the clutch of three to 13 eggs (Silverstone, 1975; Schafer, 1981; Heselhaus, 1992). On hatching (13 to 16 days in captivity) the tadpoles are carried by the male to a stagnant waterbody in a tree-hole, the leaf axil of a bromeliad (up to 30 m from the forest floor), or a small ground pool (Eaton, 1941; van Wijngaarden, 1990) Wild tadpoles feed on protozoans and rotifers, and metamorphose after 39 to 89 days; in captivity, sexual maturity is attained at between six and 15 months (Eaton, 1941; Silverstone, 1975; Summers, 1990; Zimmermann and Zimmermann, 1994). A reduction in the number of egg clutches and tadpoles maintained by the male results in a more rapid development of the eggs and higher growth rate of tadpoles (Wells, 1978; Summers, 1990). Longevity of at least six years reported in captivity (Zimmermann and Zimmermann, 1994). In Hawaii: well-foliated moist valleys; usually in moist places; on ground and in bushes. Usually under shelter late spring - early fall. Sometimes observed in standing water (rain-filled debris, depression in rock). Eggs are deposited in moist places on land, transported on dorsum of male to standing water (usually a small water-filled cavity) where development is completed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat

Lowland rainforest to 800 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Dendrobates auratus individuals prey on small invertebrates. Most notably, these frogs eat ants that have high quantities of alkaloids in their tissues. The frogs can sequester those alkaloids in their skin, which is what makes them poisonous. Dendrobates auratus individuals kept in captivity and fed a diet of insects without alkaloids will lose their toxicity. These frogs capture their prey by using their sticky, retractible tongues as well as their excellent eyesight. (Obst 1988)

Animal Foods: insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Adults eat insects obtained on ground. Females may eat eggs from clutches of other females. Large larvae may eat their smaller siblings.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

Diet

Dendrobates auratus eats small arthropods, including ants (Toft 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Poison dart frogs are important predators of small invertebrates.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dendrobates auratus avoids predation through their aposematic coloration and extremely toxic skin secretions.

Anti-predator Adaptations: aposematic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Dendrobates auratus preys on:
non-insect arthropods
Arthropoda
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Ecology

This species is active during the day (Dunn 1941, Ibanez et al 1999). Predators of adult D. auratus include motmots (Master 1999) and theroposid spiders (Gray 2000). Tadpoles are consumed by grapsid crabs (Gray and Christy 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Little is known of communication in this species. Males use vocalizations to attract females for mating and advertise territories. It is also possible that visual displays, tactile stimuli, and chemical cues are involved. They use their excellent vision to capture prey.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

Call

A quiet buzzing sound (Dunn 1941, Ibanez et al 1999, Savage 2002).

Behavior and communication

Males actively defend territories (Savage 2002). Because male availability is limited when they are caring for clutches, females often compete for males, wrestling away other females (Savage 2002). Likewise, females generally take the leading role during courtship, although both males and females have been observed to hop around and touch the other sex (Wells 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: In Hawaii, most active in open during cooler months (November-April); most active during and just after rainstorms (McKeown 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History

Breeding season

Breeding occurs throughout the rainy season (Ibanez et al 1999). Wells (1978) provides a description of some courtship behavior. A male was seen calling and courting a female in Cerro Chucanti during the dry season (in March 2010; Hughey and Touchon, pers. obs.).

Egg

Eggs are laid in the leaf litter and cared for by males (Summers 1989). Clutches are very small (Savage 2002), and may contain just two eggs (Dunn 1941). Upon hatching, tadpoles are carried by the males to small bodies of water (e.g. bromeliads or tree holes), where they develop (Eaton 1941).

Tadpole

Tadpoles are medium-sized and black (Savage 2002, Eaton 1941). The body is oval-shaped with a longish tail with small tail fins (Savage 2002). Tadpoles cannibalize other individuals, but also consume aquatic invertebrates present in phytotelmata (Caldwell and Arajuo 1998, Fincke 1999).

Metamorph juvenile

Metamorphosis can take as long as 43 days (Dunn 1941, Eaton 1941). Froglets develop green coloration almost immediatedly after metamorphosis (Pope 1941, Eaton 1941).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Longevity is not well-known.

Average lifespan

Status: captivity:
8.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.5 years (captivity) Observations: Record longevity of this species belongs to a 20.5-years-of-age specimen at Woodland Park Zoo in Seattle (http://www.zoo.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Male frogs go through an elaborate ritual to attract mates. The male first fight among themselves to establish territories, which are then fixed for the remainder of the mating season. The male then attracts a female with vocalizations consisting of trilling sounds. Part of mating behavior involves the frogs rubbing against each other.

Mating System: polygynous

Once the courtship ritual is completed, the female lays up to six eggs in a small pool of water. The eggs are encased in a gelatinous substance for protection.  The mating season of D. auratus occurs throughout the entire rainy season of the rain forest, from mid-July through mid-September.

Breeding interval: Breeding may occur more than once yearly.

Breeding season: Reproduction occurs during the rainy season, July to September.

Range number of offspring: 6 (high) .

Average time to independence: 8 weeks.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

During the two week development period, the male returns to the eggs periodically to check on them. Once the tadpoles hatch, they climb onto the males back and he carries them to a place suitable for further development, such as a lake or a stream. For the duration of this trip, the tadpoles are attached to the males back by a mucus secretion, which is soluble only in water so that there is no chance of them accidentally falling off. Once they are at their final destination, the tadpoles are on their own. They take an additional six weeks to develop into adult frogs. (Mattison 1987)

Parental Investment: altricial ; male parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Female courts male. Male tends eggs about 10-13 days (until after hatching), occas. moistens them with fluid from bladder, transports larvae on dorsum to standing water. Female produces several clutches annually.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Evolotion

Biogeography and systematics of the poison dart frog group have been work out by Clough and Summers (2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Physiology

Toxins produced in the skin contain various alkaloids (Daly et al 1992, Daly et al 2002, Daly et al 2003). These toxins are derived from ants and other invertebrates that these frogs consume (Daly et al 2000, Daly et al 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cell Biology

Karyotype

Karyotype

2N = 18 (Rasotto et al 1987)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendrobates auratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTCTATTTAGTGTTTGGGGCATGAGCCGGAATAGTCGGTACAGCCCTCAGCCTTTTAATTCGAGCAGAATTAAGCCAGCCTGGCGCTCTTCTAGGCGAC---GATCAAATCTACAATGTAATCGTCACTGCTCATGCCTTTGTAATAATCTTTTTTATAGTAATACCCATTCTAATTGGGGGATTTGGAAACTGACTTGTCCCTCTAATAATCGGAGCCCCGGACATAGCCTTTCCCCGTATAAACAATATAAGCTTCTGACTACTCCCCCCATCTTTTCTGCTACTCTTAGCTTCAGCTGGGGTCGAAGCCGGAGCTGGAACGGGCTGAACTGTTTATCCTCCCCTTGCAGGAAACTTAGCTCATGCTGGCCCATCTGTAGACTTAACCATTTTTTCCCTCCACTTAGCAGGAGTCTCATCTATTTTAGGGGCAATCAATTTTATTACTACAACCCTCAACATAAAACCCCCTTCTCTAACACAATACCAAACCCCCCTATTTGTCTGATCCGTACTAATTACAGCTGTACTGCTACTTCTCTCCTTGCCAGTTCTGGCTGCAGGCATCACTATACTCCTCACTGATCGAAACTTAAACACCACCTTTTTCGACCCTGCCGGAGGTGGCGACCCAGTTCTTTACCAACACCTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dendrobates auratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Dendrobates auratus are not currently listed as in danger. However, with the destruction of their habitat, tropical rain forests, it is now likely that in a short time they will be in trouble. In fact, it is speculated that members of the genus Dendrobates will be the first poison dart frogs to be put on the endanged list of a major conservation organization such as CITES or ESA.

http://ecology.miningco.com/library/weekly/aa012598.htm)

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Solís, F., Ibáñez, R., Jaramillo, C., Chaves, G., Savage, J., Köhler, G., Jungfer, K., Bolívar, W. & Bolaños, F.

Reviewer/s
Stuart, S.N., Chanson, J.S., Cox, N.A. & Young, B.E.

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is an abundant species that is often seen and regularly recorded throughout its range. There is great geographic variation in the appearance of this species; over 15 distinct colour morphs of wild D. auratus have been recorded. (Heselhaus, 1992). The blue morph of D. auratus present on the Pacific side of Panama is believed to be threatened with extinction (Heselhaus, 1992).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

These frogs forage during the day (Guyer and Donnelly 2005). They move by a series of hops, stopping briefly and hopping again when disturbed. They are excellent climbers with individuals climbing to 45 m above the ground (Savage 2002).

Males are territorial at high population densities but may not be at low populaton densities (Caldwell and Summers 2003). The male call is a high-pitched, insect-like buzz sounding like "cheez-cheez-cheez" (Leenders 2001). The call averages 3.5 kHz in frequency, and can last from two to four seconds followed by a five-second pause (Savage 2002). Males can mate with many females and care for offspring of different females simultaneously (Caldwell and Summers 2003). Females court the males and wrestle other females and chase them from their territories (Savage 2002). This behavior increases male reproductive success but puts survival success of offspring in jeopardy, since females do not defend their territories (Caldwell and Summers 2003). A single male can mate with up to six females (Savage 2002). After being selected by the females, the males then lead the females to the nest site made from leaf litter and the females lay four to six eggs there (Guyer and Donnelly 2005). The male visits the eggs periodically over the incubation period to shed water, remove fungus, and rotate the eggs. After the eggs hatch, the tadpoles crawl up on the male's back (Savage 2002). The male then transports the tadpoles to small pools of water, usually found in tree holes (Caldwell and Summers 2003). If some eggs hatch earlier than others, the tadpoles that are born first may practice cannibalism by eating the smaller tadpoles.

The tadpoles' diet consist of algae, detritus, protozoans, insect larvae, and each other (Leenders 2001). Tadpoles are moderate-sized and can reach 30 mm (Savage, 2002). The adults' diets consist mainly of tiny ants and mites but they also prey on beetles, flies, and springtails (Caldwell and Summers 2003). They are known to have a life-span of eight years in captivity but it is much lower in the wild (Leenders 2001).

  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • Guyer, C., and Donnelly, M. A. (2005). Amphibians and Reptiles of La Selva, Costa Rica and the Caribbean Slope: A Comprehensive Guide. University of California Press, Berkeley.
  • Caldwell, J. P., and Summers, K. D. (2003). ''Green poison frog, Dendrobates auratus.'' Grzimek's Animal Life Encyclopedia, Volume 6, Amphibians. 2nd edition. M. Hutchins, W. E. Duellman, and N. Schlager, eds., Gale Group, Farmington Hills, Michigan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There is a general loss of suitably wooded areas and collection for the international pet trade. Owing to the apparently low fecundity of this species, the possibility exists that over harvesting, especially in the more rare morphs, might contribute to localized population declines. Approximately 18,500 specimens of D. auratus were reported in trade over the period 1991 to 1996. The great majority of specimens were live animals, exported from Nicaragua, and presumably destined for the herpetological pet market. The USA was by far the largest single importer of D. auratus (about 15,000 animals in total) during this period. It is believed that the trade in Nicaragua was decreasing by 2002 because of over collection. McKeown (1996) states that populations on Oahu are highly sensitive to destruction of their habitat and over collection. Museum specimens of this species have been found to have chytrid fungi, the current impact of this pathogen on D. auratus is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: General loss of suitably wooded areas and collection for the international pet trade. Owing to the apparently low fecundity of this species, the possibility exists that overharvesting, especially of the rarer morphs, may contribute to localised population declines. Approximately 18,500 specimens of D. auratus were reported in trade over the period 1991 to 1996. The great majority of specimens were live animals, exported from Nicaragua, and presumably destined for the herpetological pet market. The USA was by far the largest single importer of D. auratus (~15,000 animals in total) during this period. It is believed that the trade in Nicaragua was decreasing in 2002 because of overcollection (GAA workshop). McKeown (1996) states that populations on Oahu are highly sensitive to destruction of their habitat and overcollection. Museum specimens of this species have been found to have chytrid fungi, the current impact of this pathogen on D. auratus is not known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

This species is not threatened (Caldwell and Summers 2003).

  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • Guyer, C., and Donnelly, M. A. (2005). Amphibians and Reptiles of La Selva, Costa Rica and the Caribbean Slope: A Comprehensive Guide. University of California Press, Berkeley.
  • Caldwell, J. P., and Summers, K. D. (2003). ''Green poison frog, Dendrobates auratus.'' Grzimek's Animal Life Encyclopedia, Volume 6, Amphibians. 2nd edition. M. Hutchins, W. E. Duellman, and N. Schlager, eds., Gale Group, Farmington Hills, Michigan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix II of CITES, and the species occurs within many protected areas. Within Colombia, Decree INDERENA No. 39 of 9 July, 1985, forbids the collection of Dendrobates spp. from the wild for breeding (or other) purposes. Nicaragua has established CITES export quotas for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no negative impacts of these frogs on humans, although the skin of these frogs is highly toxic and unprotected contact can be dangerous.

Negative Impacts: injures humans (poisonous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dendrobates auratus have long been used by local peoples to provide poison for their weapons. Currently the possibility of various medicines being derived from the frogs is being explored. Pharmaceutical companies are investigating the possibilities of a painkiller, ABT-594, being developd from a compound called epibatidine, which is found in D. auratus. The drug has the potential to be approximately 200 times more potent than morphine in blocking pain in animals, yet shows no sign of side effects of addiction. Since there have been over 80 alkaloids discovered from the 20 species of dendrobatids, there is much more research being conducted, especially on the effects of the alkaloids on neurological and muscular disorders. These frogs are also bred in captivity and sold extensively in the exotic pet trade. People enjoy them as pets because they are so colorful, and although they provide a challenge to owners, they do fairly well in captivity. (Merickel 1998)

Positive Impacts: pet trade ; body parts are source of valuable material; source of medicine or drug ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Source of arrow poison for indigenous people in native range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Relation to Humans

This species is popular in the pet trade due to its bright colors (Leenders 2001).

  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • Guyer, C., and Donnelly, M. A. (2005). Amphibians and Reptiles of La Selva, Costa Rica and the Caribbean Slope: A Comprehensive Guide. University of California Press, Berkeley.
  • Caldwell, J. P., and Summers, K. D. (2003). ''Green poison frog, Dendrobates auratus.'' Grzimek's Animal Life Encyclopedia, Volume 6, Amphibians. 2nd edition. M. Hutchins, W. E. Duellman, and N. Schlager, eds., Gale Group, Farmington Hills, Michigan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Green and black poison dart frog

Dendrobates auratus, also known as the green and black poison dart frog or the green and black poison arrow frog, and sometimes mint poison frog (not to be confused with the mint-green color morph of Phyllobates terribilis), is a brightly colored member of the order Anura native to Central America and northwestern parts of South America. It is one of the most variable of all poison dart frogs next to Dendrobates tinctorius and some Oophaga spp. It is considered to be of least concern from a conservation standpoint by the International Union for Conservation of Nature (IUCN).

Poison[edit]

The green-and-black poison frog, while not the most toxic poison dart frog, is still a highly toxic animal. The very small amount of poison the frog possesses is still enough to make a human ill. Like most poison dart frogs, however, the green-and-black poison dart frog will only release its poison if it feels that it is threatened, and wild specimens can be handled if the human holding it is calm and relaxed. The green-and-black poison frog, as with all poison dart frogs, loses its toxicity in captivity due to a change in diet. This has led scientists to believe that the green-and-black poison frog actually takes its poison from the mites it feeds on.[1]

Description[edit]

The mint poison frog is in all ways an average poison dart frog. Males reach about 0.75 inch long; females are slightly larger, up to an inch long or bigger. As the common name "mint poison dart frog" suggests, the green-and-black poison frog typically has mint-green coloration; however, they can also be forest, lime, emerald green, turquoise, pale yellow, or even cobalt blue. Many also have splotches of dark colors, ranging from wood brown to black. The green-and-black poison frog is one of the most variable of all poison frogs in appearance. Some have black or brown splotches, others are dappled, or have "splashes" of black, like Oophaga sylvaticus.

D. auratus is semiarboreal, hunting, courting, and sleeping in the trees, but as it is a small frog, it cannot jump far enough to span the distances between trees, so it returns to the ground to travel. To assist in climbing, the mint poison dart frog has small, sucker-like discs on the ends of its toes, which create a slight suction as the frogs climb, making their grip mildly adhesive (although some individuals do have difficulty climbing).

Reproduction[edit]

Like all poison dart frogs, green-and-black poison dart frogs gather in large groups before mating. They squabble over territories; eventually each individual male frog clears a small patch for himself. Females wander among the males, the latter then attempt to impress the former with their bird-like mating calls. Once a male has caught the attention of a female, he leads her to a site he has selected for egg deposition. The female lays her eggs, which he then fertilizes. In approximately 14 days, these hatch into tadpoles.[2] Their parents (typically the male) then carry the tadpoles into the canopy, with the tadpoles sticking to the mucus on their parents' backs. The parents then deposit their tadpoles into the small pools of water that accumulate in the center of bromeliads, and guard the tadpoles while they feed on algae and small invertebrates that inhabit the tiny pool.

As pets[edit]

Green-and-black poison dart frogs are popular exotic pets due to their small size, bright colors, and intriguing behavior. As with all frogs, they have permeable skin and should not be handled whenever possible. If it is imperative to move them, handling should be done with extreme care and with clean hands. Their small size makes them fearful of animals much larger than themselves, such as humans, and will attempt to escape if handled. To prevent escape, many frog keepers move their amphibians in fine-meshed nets or with cupped hands. A partly terrestrial, partly arboreal enclosure should also be provided.Poison dart frogs may be small, but is very active and needs a suitably large terrarium (usually 100 x 60 x 60 centimeters) with a high level of humidity. Live plants should also be added to provide hiding places, and bromeliads in the event the frogs breed.

Osa Peninsula, Costa Rica

References[edit]

  1. ^ http://news.nationalgeographic.com/news/2007/05/070514-poison-frogs.html
  2. ^ Sihler, A., Sihler, G. Poison Dart Frogs (Complete Herp Care).TFH Publications. 2007. ISBN 978-0-7938-2893-7.
  • Frank Solís, Roberto Ibáñez, César Jaramillo, Gerardo Chaves, Jay Savage, Gunther Köhler, Karl-Heinz Jungfer, Wilmar Bolívar, Federico Bolaños (2008). Dendrobates auratus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 22 February 2009. Database entry includes a range map and justification for why this species is of least concern
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!