Overview

Comprehensive Description

Description

Hyla regilla is a small frog, about 3/4 to 2 inches, that has expanded toe disks and a black eye-stripe (Stebbins 1985). The stripe runs from the tip of the snout posteriorly through the eye to the forelimb insertion (Grismer 2002). The stripe is hard to see in dark frogs, but it is always present. The dorsal coloration is highly variable, and could be gray, tan, green, brown, or black, and it may change color from dark to light within a few minutes. It often has a triangular dark spot on the head and dark spots on the back and legs, and the clarity of these spots changes as the frog changes its color phase. Its limbs are crossbanded or blotched with dark color, and the posterior has a yellow or orange color, especially on the under surfaces of the limbs, the rear of the femur, and in the groin. Males have a wrinkled and dusky throat. When the male’s vocal sac is deflated, often 8 to 12 longitudinal folds are present (Stebbins 1985). It has webbed hind toes with a margin of the web between successive toes. Skin is usually smooth with a few tubercles but occasionally quite rough. It has a round tympanum, that is anywhere from 1/4 to slightly over 1/2 the size of the eye opening, located in the eye stripe. The thenar tubercle is elongated and ovoid, while the palmar tubercle is made of 3 small, closely associated tubercles totaling the size of the thenar tubercle (Stebbins 1951).

A similar species, Hyla cadaverina, the California Treefrog, usually does not have an eye-stripe, has larger toe pads, and more fully webbed hind toes. H. cadaverina is also rarely green. Another similar species, Hyla eximia, the Mountain Treefrog, the eye-stripe extends beyond the shoulder and webbing is reduced (Stebbins 1985).

It is certain that there are isolated populations of H. regilla in many unexplored canyons of the Sierra la Giganta that harbor hidden permanent springs. In some water systems west of San Ignacio, there is evidence that H. regilla is being displaced by the bullfrog, Rana catesbeiana (Grismer 2002).

See another account at californiaherps.com.

  • Grismer, L. L. (2002). Amphibians and Reptiles of Baja California. University of California Press, Berkeley.
  • Livezey, R. L., and Wright, A. H. (1947). ''A synoptic key to the salientian eggs of the United States.'' American Midland Naturalist, 37, 179-222.
  • Smith, R.E. (1940). ''Mating and oviposition in the Pacific Coast tree toad.'' Science, 92(2391), 379-380.
  • Stebbins, R. C. (1972). Amphibians and Reptiles of California. University of California Press, Berkeley, Los Angeles, London.
  • Stebbins, R. C. (1985). A Field Guide to Western Reptiles and Amphibians. Houghton Mifflin, Boston.
  • Stebbins, R.C. (1951). Amphibians of Western North America. University of California Press, Berkeley.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pacific treefrogs (Pseudacris regilla) are common throughout North America, west of the Rocky Mountains. Their geographic range extends from southern British Columbia, Canada, south through Washington, Oregon, and California, to Baja California, Mexico. Their eastern-most portion of their geographic range extends into Nevada, Idaho, and Montana. Pacific treefrogs also have been reported in deserts of southern California, where they are thought to have been introduced.

Biogeographic Regions: nearctic (Introduced , Native )

  • Elliott, L., C. Gerhardt, C. Davidson. 2009. The Frogs and Toads of North America. Ithica, New York: NatureSound Studio.
  • Ripplinger, J., R. Wagner. 2004. Phylogeography of northern populations of the Pacific treefrog, Pseudacris regilla. Northwestern Naturalist, 85/3: 118-125.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs from southern British Columbia in Canada through the USA to Baja California, Mexico, then east to Montana, Idaho, and Nevada. It also occurs on the Channel Islands off southern California (Behler and King 1979). Desert populations in southern California were probably introduced. It is introduced on Queen Charlotte Islands, British Columbia (Reimchen 1990), Canada. It was recently found on Revillagigedo Island in Alexander Archipelago, Alaska, where it is probably breeding and was possibly introduced (Waters 1992). It occurs from sea level to over 3,000m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) The range of P. regilla (sensu lato) extends from southern British Columbia in Canada southward through the United States to southern Baja California, Mexico, and east to Montana, Idaho, and Nevada. The species also occurs on the Channel Islands off southern California (Stebbins 2003). Desert populations in southern California probably were introduced, as were some populations in Arizona. An introduced population occurs in the Queen Charlotte Islands, British Columbia (Reimchen 1990), Canada, and on Revillagigedo Island in Alexander Archipelago, Alaska, where it was introduced in 1960 and is breeding (Waters 1992, Hodge 2004). Overall elevational range extends from sea level to around 3,540 meters (Stebbins 2003).

Under the taxonomic arrangement proposed by Recuero et al. (2006), the distributions of the species in the P. regilla complex presumably would be approximately as follows (Recuero et al. did not provide distributional details):

P. regilla: extreme southern Alaska (introduced), British Coumbia, Washington, western Oregon, and northern California.

P. sierra: central California, Nevada, eastern Oregon, Idaho, western Montana, and presumably extreme northwestern Utah (extirpated?).

P. hypochondriaca: southern California, southern Nevada, southwestern Utah (extirpated?), and western Arizona south to southern Baja California.

This frog is well distributed along 90 km of the lower Colorado River and its backwaters from Davis Camp, just below Davis Dam, to Castle Rock in upper Lake Havasu, but the native versus exotic status of these populations is unclear (Rorabaugh et al. 2004). In Arizona, this species has been recorded as an apparent introduction at Middle Spring and a nearby stock tank in the Virgin Mountains, Mohave County, and at two central Arizona plant nurseries (Rorabaugh et al. 2004). It persisted for at least 19 years and successfully bred at one nursery, where it was reportedly introduced on ornamental plants imported from San Diego (Rorabaugh et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Distributed from mainland British Columbia and Vancouver Island through Washington, Oregon, California, and the tip of Baja California. H. regilla can be found on Catalina, Santa Rosa, and Santa Cruz, islands off the coast of southern California, and on Isla Cedros, an island off the west coast of central Baja California. Distribution also goes east to eastern Nevada and western Montana. It lives in habitats from sea level to 11,000 feet in the Sierra Nevada (Grisner 2002). It seeks cover in many places, including rock fissures, under bark, in vegetation along streams, in rodent and other burrows, in nooks and crannies in buildings, and in culverts. It can be found in springs, ponds, irrigation canals, streams, and other bodies of water, but it has also been found as far as ½ mile from water (Stebbins 1951). Out of the water, it frequents habitats like grassland, chaparral, woodland, desert oases, forest, and farmland (Stebbins 1985).

  • Grismer, L. L. (2002). Amphibians and Reptiles of Baja California. University of California Press, Berkeley.
  • Livezey, R. L., and Wright, A. H. (1947). ''A synoptic key to the salientian eggs of the United States.'' American Midland Naturalist, 37, 179-222.
  • Smith, R.E. (1940). ''Mating and oviposition in the Pacific Coast tree toad.'' Science, 92(2391), 379-380.
  • Stebbins, R. C. (1972). Amphibians and Reptiles of California. University of California Press, Berkeley, Los Angeles, London.
  • Stebbins, R. C. (1985). A Field Guide to Western Reptiles and Amphibians. Houghton Mifflin, Boston.
  • Stebbins, R.C. (1951). Amphibians of Western North America. University of California Press, Berkeley.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Pacific treefrogs are a small, slender frogs with large toe pads. They have smooth skin that varies in color from light-brown to bright-green. Pacific tree frogs with red or brown backs also have been reported, but are thought to be rare. This species typically has darker markings on its body, including stripes on its dorsal surface and sides of its heads, which vary in intensity and in some individuals may be nearly absent. A dark triangular marking between the eyes is also common. Generally, a line of broken spots extends down the ventral surface to the groin area. The legs, arms, and feet are generally darker than the rest of the body. Within their natural range, Pacific treefrogs are the only frogs with padded toes and dark markings. Pacific treefrogs can change their body color depending on environmental conditions and need for camouflage to avoid predation. Recent research suggests that P. regilla changes color seasonally to match the presence or lack of green foliage. Color variation has also been associated changes in mean temperature. At high temperatures, these frogs often turn a shade of yellow. Under cooler temperatures, they return to their more typical darker colors. Males often are slightly different in color than females. Their upper body can be a dark gray olive color and may have a brown band extending through the eye and a yellow stripe along the upper lip. Females may be similar to males in color, but with little to no yellow stripe on the groin. During breeding season, it is easier to distinguish males from females by their different colored throats. Females have a smooth white throat while males have a dark brown or yellow throat with wrinkled skin.

Adult body size in Pacific treefrogs ranges from 2.5 to 4.8 cm. Mature females tend to be larger than males, which is not uncommon for anurans. Body mass of newly hatched tadpoles is, on average, 0.24. After 30 days, weight increases to between 0.35 and 0.45 g, which is more typical of adult Pacific treefrogs.

Pacific treefrogs, Sierran treefrogs, and Californian treefrogs were once considered a single species and referred to as Baja treefrogs (Pseudacris hypochondriaca). These species were later reclassified primarily due to differences in geographic ranges. These three species look very similar, except for the bumpy skin of the Sierran and Californian treefrogs.

Average mass: 0.35 g.

Range length: 2.5 to 4.8 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger; sexes colored or patterned differently

  • Awbrey, F. 1978. Social interaction among chorusing Pacific tree frogs, Hyla regilla. Copeia, 1978/2: 208-214.
  • Bernard, M. 2005. "Natural History of the Pacific Chorus Frog Pseudacris regilla" (On-line). Accessed April 03, 2011 at http://www.mister-toad.com/PacificTreeFrog.html.
  • Brattstrom, B., J. Warren. 1955. Observations on the ecology and behavior of the Pacific treefrog, Hyla regilla. Copeia, 1955/3: 181-191.
  • Holman, J. 2003. Fossil Frogs and Toads of North America. Bloomington, IN: Indiana University Press.
  • Morey, S. 1990. Microhabitat selection and predation in the Pacific treefrog, Pseudacris regilla. Journal of Herpetology, 24/3: 292-296.
  • Nussbaum, R., B. Edumund, R. Storm. 1983. Amphibians and Reptiles of the Pacific Northwest. Idaho: The University Press of Idaho.
  • Sparling, D., G. Fellers. 2009. Toxicity of two insecticides to California, USA, anurans and its relevance to declining amphibian populations. Environmental Toxicology and Chemistry, 28/8: 1696-1703.
  • Stebbins, R. 1951. Amphibians of western North America. London, England: Cambridge University Press.
  • Wente, W., J. Phillips. 2005. Seasonal color change in a population of Pacific treefrogs (Pseudacris regilla). Journal of Herpetology, 39/1: 161-165.
  • Wright, A., A. Wright. 1949. Handbook of frogs and toads of the United States and Canada. Ithaca, New York: Comstock Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 5 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Lectotype; Syntype for Pseudacris regilla
Catalog Number: USNM 9182
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Puget Sound, Locality In Multiple Counties, Washington, United States, North America
  • Lectotype: Jameson, D. L., et al. 1966. Proc. Calif. Acad. Sci. 33 (19): 553.; Baird, S. F. & Girard, C. 1852. Proc. Acad. Nat. Sci. Philadelphia. 6: 174.; Syntype: Jameson, D. L., et al. 1966. Proc. Calif. Acad. Sci. 33 (19): 553.; Baird, S. F. & Girard, C. 1852. Proc. Acad. Nat. Sci. Philadelphia. 6: 174.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Pseudacris regilla
Catalog Number: USNM 15409
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Sacramento River, Locality In Multiple Counties, California, United States, North America
  • Paralectotype: Jameson, D. L., et al. 1966. Proc. Calif. Acad. Sci. 33 (19): 553.; Baird, S. F. & Girard, C. 1852. Proc. Acad. Nat. Sci. Philadelphia. 6: 174.; Syntype: Jameson, D. L., et al. 1966. Proc. Calif. Acad. Sci. 33 (19): 553.; Baird, S. F. & Girard, C. 1852. Proc. Acad. Nat. Sci. Philadelphia. 6: 174.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Pacific treefrogs occur in a variety of habitats, including mesic and xeric forests, high altitude mountains, and desert steppe. Most commonly, they occur in moist environments, especially in low vegetation near water. Typically, they are found near lakes, ponds, rivers and streams. They can also be found in residential areas. Outside of breeding season, they often are seen near large, which is thought to provide shelter from predators. Pacific treefrogs are tolerant of rapid changes in weather and varying climatic conditions. Populations extend across a broad elevational range, from sea level to nearly 3500 m; however, most populations occur around 914 m above seal level.

Range elevation: 0 to 3500 m.

Average elevation: 914 m.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: savanna or grassland ; chaparral ; forest

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh ; swamp ; bog

Other Habitat Features: suburban

  • Jameson, D. 1966. Rate of weight loss of tree frogs at various temperatures and humidities. Ecology, 47/4: 605-613.
  • Stebbins, R. 2003. A Field Guide to Western Reptiles and Amphibians. Singapore: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found in a wide variety of habitats including grassland, chaparral, woodland, forests and farmland. It is usually found among low vegetation near water. It breeds in marshes, lakes, ponds, ditches, reservoirs and slow-moving streams (Stebbins 1985). It lays eggs on submerged plant stems or on the bottom. It sometimes breeds in weakly brackish water.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Pacific treefrogs occupy a wide variety of habitats, including grassland, chaparral, woodland, forest, and farmland. They live on land except during the breeding season. Females deposit eggs in shallow water of marshes, lakes, ponds, ditches, reservoirs and slow-moving streams (Stebbins 2003), sometimes in weakly brackish water (Gardner, 1995, Herpetological Review 26:32).

Pacific treefrogs spend most of their time on the ground, but after the breeding season they commonly bask on the leaves of broad-leaved evergreen shrubs far from water, and sometimes they climb high into trees.

See Munger et al. (1998) for quantitative information on habitat in southwestern Idaho.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Individuals migrate up to several hundred meters between breeding sites and nonbreeding upland habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

As tadpoles, Pacific treefrongs consume a variety of aquatic invertebrates and detritus. They mostly feed on algae, bacteria, and floating vegetative debris. Adults primarily consume terrestrial invertebrates, with only 4.8% of their diet coming from aquatic sources. Adults usually feed at night on invertebrate species, often consuming great quantities of flying insects. During breeding season, adults may feed during the day. Adults capture insects by extending their tongues. The tongue is coated by a sticky secretion that traps the insect, along with any debris or dirt near the insect. Food items are typically swallowed whole.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: algae

Other Foods: detritus ; microbes

Primary Diet: carnivore (Insectivore ); herbivore (Algivore)

  • Hothem, R., A. Meckstroth, K. Wegner, M. Jennings, J. Crayon. 2009. Diets of three species of Anurans from the Cache Creek Watershed, California, USA. Journal of Herpetology, 43/2: 275-283.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Known to eat beetles, flies, spiders, ants, and ispopods, etc. Larvae scape periphyton off rocks, eat filamentous algae and epiphytic diatoms in floating mats, bottom feed on benthic detritus, and surface feed on films of diatoms and pollen (Kupferberg et al., Copeia 1994:446-457).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Pacific treefrogs are insectivorous and may help control a number of insect pest species throught their geographic range. In addition, a number of different species depend on Pacific treefrogs as their primary prey. There is no information on the potential parasites of this species.

  • Watkins, T. 1996. Predator-mediated selection on burst swimming performance in tadpoles of the Pacific tree frog, Pseudacris regilla. Physiological Zoology, 69/1: 154-167.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Garter snakes are known predators of Pacific treefrogs. Other predators include other species of frogs, raccoons, Virginia opossums, fish, and birds. Their primary defense against predators is to remain motionless, though this technique is only effective if the frog matches its environment very well. They also tend to hide in areas of tall grass or jump into water when threatened. The primary predator of Pacific treefrog tadpoles is mosquitofish. Research has shown that even when presented with mosquito larva, mosquitofish often prefer treefrog tadpoles. Other predators on tadpoles include numerous species of fish and some aquatic invertebrates.

The best defense of Pacific treefrogs against predation is their camouflage. The coloration of their dorsal surface varies from shades of brown to shades of green. They tend to stay in habitats that have coloring similar to their bodies. Recent studies have shown that Pacific treefrogs can vary their coloring based on the presence or absence of green foliage. In addition, during spring and summer, when green foliage is abundant, these frogs tend to be greenish in color; in fall and winter, they tend to be shades of brown.

Known Predators:

  • garter snakes (Thamnophis elegans)
  • mosquitofish (Gambusia affinis)

Anti-predator Adaptations: cryptic

  • Goodsell, J., L. Kats. 1999. Effect of introduced mosquitofish on Pacific treefrogs and the role of alternative prey. Conservation Biology, 13/4: 921-924.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Weitzel and Panik (1993) reported on a northwestern Nevada population that exibited long-term persistence despite periodic catastrophic flooding and stream dry-ups that prevented successful reproduction in some years.

Larvae are preyed upon by carnivorous aquatic insects, bullfrogs, garter snakes, and many birds and mammals. Important predators on adults include garter snakes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Pacific treefrogs have a very rapid call that has been described as a “kreck-ek” noise. The rapid call is called the chorus note; this serves to bring individuals in the area together for breeding. Pacific treefrogs also have an encounter call that warns other males not to get too close during mating season. This differs from their normal call, which is lower pitched and longer. Research has shown that males avoid overlapping calls in order to increase each male’s chance to attract a mate. Typically, up to three males can call without overlapping, if timing is well synchronized. Pacific treefrogs have well developed senses of sight, smell, and hearing. Hearing is particularly well-developed, as these frogs must be able to call to each other during mating season.

Communication Channels: visual ; tactile ; acoustic

Other Communication Modes: choruses

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Like many terrestrial amphibians, these frogs are inactive during freezing weather and extreme drought.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Breeding season for P. regilla extends from January to mid-May. During this time, females lay eggs which are brown and yellow. Males externally fertilize the eggs, which are usually laid in gently moving water, in clutches of 5 to 70 eggs, and must be kept moist.

Pacific treefrog tadpoles are of medium size, typically about 46.6 mm long, and brown in color. Tadpole tails are not flagellated. Pacific tree frogs show rapid growth during the first summer after hatching. Tadpoles undergo metamorphosis between 50 and 80 days of age. During the metamorphosis, individuals typically measure between 12 and 15 mm long. Within two months of metamorphosis, individuals approximately double in length. Newly metamorphosed frogs leave the breeding area and seek habitats similar to that of an adult frog. Pacific treefrogs reach sexual maturity quickly and participate in the first mating chorus following their hatching.

Development - Life Cycle: metamorphosis

  • Jameson, D. 1956. Growth, dispersal and survival of the Pacific tree frog. Copeia, 1956/1: 25-29.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Little is known about the lifespan of Pacific treefrogs, either in the wild or in captivity. There is record of a captive Pacific treefrog that lived for 9 years. Other chorus frogs in the genus Pseudacris have an average lifespan of approximately 5 years in the wild. Closely related mountain chorus frogs P. brachyphona live for approximately 7 years in the wild.

Range lifespan

Status: captivity:
9 (high) years.

  • Blaustein, A., L. Belden, D. Olson, D. Green, T. Root, J. Kiesecker. 2001. Amphibian breeding and climate change. Conservation Biology, 15/16: 1804-1809.
  • Green, N. 1938. The Breeding Habits of Pseudacris Brachyphona (Cope) with a Description of the Eggs and Tadpole. Copeia, 1938/2: 79-82.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding occurs seasonally for Pacific tree frogs and typically occurs from winter to spring. This species is polygynous. During the breeding season, males often are found near small bodies of waters, particularly ponds, where they begin to sing. Females are attracted to males based on their calls and their different colored throats. Females prefer males that initiate calling. Once attracted, females move towards males. Males continue calling for several minutes, followed by several minutes of silence. Males continues this pattern until females are in their immediate vicinity.

Mating System: polygynous

Pseudacris regilla attracts mates using a choral song. Males call to females as loudly as possible and produce a croak so loud that they sound as though they are produced by multiple males. These sounds can be heard by numerous females. Once a female approaches, the male stops singing and attempts amplexus, a pseudocopulation act during which the male grasps the female with hist forelegs. Breeding takes place at night, near shallow water, typically after rainfall. Mating season usually extends from December to May, although some variation occurs. Altitude often affects the length of the breeding season.

Male Pacific tree frogs are occasionally aggressive during breeding season. They produce a warning call if another male approaches too closely. If the intruding male does not leave the area, the two frogs may fight until one departs. In addition, while attracting females, males can extend vocal pouches on their lower jaw, which helps in calling females. The act of copulation takes place in water. They are oviparous, and once the female enters the water, the male grasps her and helps to thrust out the eggs as he fertilizes them. Eggs are laid in small ponds or puddles. Typical broods range from 5 to 70 eggs. A jelly-like substance is left with the eggs to maintain moisture. Eggs remain in shallow water, often near twigs or leaves. Once reproduction is complete, both the male and female leave the water. Eggs hatch in three to four weeks, and within three to seven days, offspring develop into tadpoles. Development time varies with the temperature of the environment. Once they emerge from the egg, offspring use the jelly-like substance carried with the egg to sustain them for the first two to three days. Tadpoles then swim to shallow waters and ingest nearly any edible food item. When tadpoles reach three months of age, they metamorphose into froglets. This typically occurs between July and September.Research shows that as water temperature increases, development time decreases. In general, Pacific treefrogs reach sexual maturity in 1 to 2 years.

Breeding interval: Pseudacris regilla breeds once per year.

Breeding season: Pseudacris regilla breeds from January to May.

Range number of offspring: 5 to 70.

Average time to hatching: 3.5 weeks.

Average age at sexual or reproductive maturity (female): 1 to 2 years.

Average age at sexual or reproductive maturity (male): 1 to 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Once females lay eggs in the water, both males and females abandon the eggs. There is no parental investment.

Parental Investment: no parental involvement

  • Awbrey, F. 1978. Social interaction among chorusing Pacific tree frogs, Hyla regilla. Copeia, 1978/2: 208-214.
  • Brenowitz, E., G. Rose. 1999. Female choice and plasticity of male calling behaviour in the Pacific treefrog. Animal Behavior, 57/6: 1337-1342.
  • Dickerson, M. 1906. The Frog Book. New York: Doubleday, Page and Company.
  • Goin, C., O. Goin, G. Zug. 1978. Introduction to Herpetology. San Francisco, CA: W.H. Freeman and Company.
  • Grinnell, J., T. Storer. 1924. Animal Life in the Yosemite. Berkeley, CA: University of Berkeley Press.
  • Noble, K. 1931. The Biology of Amphibia. New York, NY: McGraw-Hill Book Company, Inc..
  • Nussbaum, R., B. Edumund, R. Storm. 1983. Amphibians and Reptiles of the Pacific Northwest. Idaho: The University Press of Idaho.
  • Oliver, J. 1955. The Natural History of North American Amphibians and Reptiles. Princeton, NJ: D. Van Nostrand Company, Inc..
  • Pickwell, G. 1931. Western Nature Study: Frogs, Toads, Salamanders. San Jose, CA: San Jose State College Press.
  • Pickwell, G. 1947. Amphibians and Reptiles of the Pacific States. Stanford, CA: Stanford University Press.
  • Schaub, D., J. Larsen, Jr. 1978. The reproductive ecology of the Pacific treefrog (Hyla regilla). Herpetologica, 34/4: 409-416.
  • Whitney, C., J. Krebs. 1975. Mate selection in Pacific tree frogs. Nature, 255: 325-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding occurs generally in winter or spring (sometimes in summer), with the earliest breeding occurring in lowland areas in the southern part of the range: mid-May to early August in northern California, January-June in southern California, late April-early May in northern Idaho. Eggs are laid in packets of about 20-80, hatch in 3-5 weeks in western Oregon. Larvae metamorphose into tiny frogs within about 2-3 months. In northern Idaho, metamorphosis occurred in mid- to late summer (Schaub and Larsen 1978). Most breeders are at least 2 years old, but some individuals may mature in less than 1 year in western Oregon (Nussbaum et al. 1983). Multiple clutches per year have been documented in southern California (Perrill and Daniel 1983).

Calling frequently occurs outside the breeding season and far away from breeding sites.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudacris regilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GTTACCGCTCACGCCTTTGTAATAATTTTCTTTATAGTTATACCCATCCTAATCGGGGGTTTTGGAAATTGACTAATTCCTTTAATA---ATTGGGGCCCCAGACATGGCCTTTCCCCGAATAAATAATATAAGTTTTTGACTTCTCCCACCATCTTTTCTTCTCCTCCTAGCATCTGCAGGAGTAGAAGCTGGAGCCGGTACGGGCTGAACTGTATACCCACCACTTGCTGGCAACCTAGCTCACGCCGGACCCTCAGTTGATTTA---ACTATTTTTTCTTTACACCTTGCAGGTGTGTCTTCAATTTTAGGAGCCATTAATTTTATCACCACTATTCTTAATATAAAACCCCCTTCCGTAACTCAGTATCAAACACCACTATTTGTATGATCCGTACTAATTACTGCAGTATTACTTCTTCTGTCTTTACCAGTTCTAGCTGCA---GGCATTACAATATTACTTACAGATCGAAATTTAAACACAACATTTTTTGACCCGGCAGGCGGAGGAGACCCTGTTCTGTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pseudacris regilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Pacific treefrogs are classified as a species of least concern on the IUCN's Red List of Threatened Species. They have a broad geographic range and are the most common frog in the United States, west of the Rocky Mountains. The greatest current threat to Pacific treefrogs appears to be increased predation from non-native mosquitofish; however, this threat does not occur throughout the entirety of the Pacific treefrogs geographic range.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson, Georgina Santos-Barrera

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category. Recuero et al. (2006) proposed that this species be split into three species; all of these would be Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Moderate to broad.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There are many occurrences of this highly abundant species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Breeding: H. regilla breeds over a long period of time, from January to the middle of May, in marshes, ponds, lakes, reservoirs, roadside ditches, and slow streams (Stebbins 1985). In interior British Colombia, it may breed in June and July also. Later breeding occurs in higher altitudes. Around January, at the beginning of the breeding season, large numbers of vociferous males congregate at transient rain pools and more permanent bodies of water. The females do not enter the water until later, when they are ready to lay. Usually, females enter in the late afternoon or early evening, and mating and egg laying usually occurs by the following morning. Females enter either by themselves or in small groups, so there are many more males than females, making immediate mating probable. Usually, there is a preliminary period of clasping that lasts anywhere from 4 to 24 hours in a laboratory, and probably about 4 to 10 hours in nature. The male tightly grips the female with is forelimbs, but does not contact her with his body behind his pectoral region except when inseminating eggs. The male’s legs are flexed in a sitting pose, and insemination occurs at the moment of the extrusion of the eggs. The male discharges a quantity of transparent semen by bringing his cloacal aperture close to that of the female. With a quick, firm extension, the male slides his feet posteriorly over the sides and hips of the female, then retracts to his previous position. Simultaneously, the female extrudes a clutch of eggs into the cloud of sperm. The female sometimes scratches the substratum on which the eggs are going to be deposited before releasing the eggs. As the female extrudes the eggs, her cloaca is brought close to this surface and their attachment is effected. The eggs may be removed from her cloaca by her tarsi through flexor-extensor reflexes. The interval between layings is usually 2 to 10 minutes, but could be longer. After oviposition, the frogs separate. Amplexus is pectoral, and may last from 8 to 40 hours or longer (Smith 1940).

Eggs: Clusters of eggs are deposited in a pond’s shallow water, usually at depths above 4 inches. The clusters can be attached to sticks, leaves, vegetation, or other objects, and they can also be found floating on the surface, usually attached to objects. Eggs are usually laid in loose clusters of irregular shape, and the cluster has 2 gelatinous envelopes. The outer envelope is 4.78 to 6.7 mm and is sticky, and the inner envelope is 1.88 to 2.70 mm. Each packet usually has 22 to 25 eggs, but could have anywhere from 5 to 60 eggs. As the layings near an end, the number of eggs per clutch can decrease to 3 or 4, or even single eggs (Livezey and Wright 1947).

Larva: The tadpole is about 45 mm long, full and deep-bodied, and has a fairly long tail, about 2 times the head and body length. The labial tooth row formula is 2/3, and the spiracle is sinistral, directed posteriorly (Grismer 2002). The general color is blackish and yellowish brown to dark brown with heavy black spots. Below, it is whitish with bronze or copper tinges. The tail is mottled with black, and the iris is golden, with a darker area anterior and posterior to the pupil (Stebbins 1951).

Call: H. regilla is the most commonly heard frog species on the Pacific coast. The calls last for about 1 second and are often uttered in sequence. Each 1-second call consists of a loud, two-parted 'kreck-ek', with rising inflection in the last syllable. H. regilla has a round vocal sac (Stebbins 1985). While singing, a male may float with his limbs outstretched and his globular pouch extended to or beyond his chin (Stebbins 1951).

Food: H. regilla eats insects, including leaf-hoppers, spring-tails, flies, stoneflies, ants, wasps, beetles, and caterpillars, It also eats spiders, isopods, and snails (Stebbins 1972).

Behavior: H. regilla is mainly nocturnal, but it is also active in the daytime. Sometimes, at low elevations, it is active throughout the year. It is a good climber, but usually stays near the ground. It has a great capacity for color change, and a change from an unspotted dark coloration through a medium light colored phase with spots to an unspotted light phase may take about 8 to 10 minutes (Stebbins 1951).

  • Grismer, L. L. (2002). Amphibians and Reptiles of Baja California. University of California Press, Berkeley.
  • Livezey, R. L., and Wright, A. H. (1947). ''A synoptic key to the salientian eggs of the United States.'' American Midland Naturalist, 37, 179-222.
  • Smith, R.E. (1940). ''Mating and oviposition in the Pacific Coast tree toad.'' Science, 92(2391), 379-380.
  • Stebbins, R. C. (1972). Amphibians and Reptiles of California. University of California Press, Berkeley, Los Angeles, London.
  • Stebbins, R. C. (1985). A Field Guide to Western Reptiles and Amphibians. Houghton Mifflin, Boston.
  • Stebbins, R.C. (1951). Amphibians of Western North America. University of California Press, Berkeley.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Introduced mosquito fish (Gambusia affinis) prey heavily on larvae and might negatively affect this species' populations (Goodsell and Kats 1999). However, this is not a pervasive threat. It is sometimes found in the international pet trade but at levels that do not currently constitute a major threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: Medium

Comments: Introduced mosquitofish (GAMBUSIA AFFINIS) prey heavily on larvae and may negatively affect P. REGILLA populations (Goodsell and Kats 1999). However, this is not a pervasive threat. In lakes in the Sierra Nevada, H. regilla distribution and abundance were negatively related to non-native trout presence (Matthews et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species' range overlaps numerous protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of Pseudacris regilla on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As an insectivore, Pseudacris regilla likely helps control insect pest species throughout their geographic range.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pacific tree frog

The Pacific tree frog (Pseudacris regilla), also known as the Pacific chorus frog, has a range from the West Coast of the United States (from Northern California, Oregon, and Washington) to British Columbia in Canada and extreme southern Alaska.[2] They live from sea level to more than 10,000 feet in many types of habitats, reproducing in aquatic settings. They occur in shades of greens or browns and can change colors over periods of hours and weeks.

Taxonomy[edit]

The naming of this frog has a very confusing history. First, the frog was moved from the genus Hyla to the genus Pseudacris in 1986.[2] Then, in 2006, Recuero et al. split the frog into three species.[3] Recuero et al. attached the name Pseudacris regilla with the central component, Pseudacris hypochondriaca with southern (Baja Californian) component, and Pseudacris pacifica with northern component. However, if this split is accepted, the correct name (i.e., the oldest available name) for the northern component is Pseudacris regilla and for the central one Pseudacris sierra. This revision remains controversial.[4] The Amphibian Species of the World 6.0 recognizes the split, but uses the name Pseudacris regilla for the northern component,[2] the definition followed in this article.

Anatomy and morphology[edit]

A Pacific tree frog (green morph) sitting on a sunflower leaf stem, Nanoose Bay British Columbia

The Pacific tree frog grows up to 2 in from snout to urostyle. The males are usually smaller than the females and have a dark patch on their throats. The dark patch is the vocal sac, which stretches out when the male is calling. Pacific tree frogs can be a number of different colors, including green, tan, reddish, gray, brown, cream, and black, but most are a shade of green or brown, with pale or white bellies. They have a variety of dark and spotty markings on their backs and sides and can be identified by a black or dark brown eye stripe that stretches from the nose, across the eye, and back to the shoulder. They can change color seasonally to better match their environments. Their skin is covered in small bumps. They have long legs compared to their bodies and they tend to be slender. Their toes are long and only very slightly webbed. On the end of each toe is a round, sticky toe pad or disk used for climbing and sticking to surfaces.

Distribution, habitat and ecology[edit]

Pacific tree frogs are common on the Pacific coast of Oregon and Washington, but they are found from extreme northern California to British Columbia. A small population also exists in a pond on Revillagigedo Island near Ketchikan, Alaska, having been intentionally introduced there in the 1960s.[5] They are found upland in ponds, streams, lakes and sometimes even further away from water; their habitat includes a wide variety of climate and vegetation from sea level to high altitudes. The Pacific tree frog makes its home in riparian habitat, as well as woodlands, grassland, chaparral, pasture land, and even urban areas including back yard ponds. Eggs of the Pacific tree frog may be consumed by the rough-skinned newt[6] and other amphibians.

Reproduction, development and behavior[edit]

The Pacific tree frog begins mating in early winter to early spring. Since these frogs are so widespread geographically, their breeding season is thought to be determined by local conditions. When it is time, the males migrate to the water. They then make a call at the same time, calling "ooh-yeeh" or ribbiting loudly. This lures the females to the water and they mate. The females lay their eggs in clumps of 10-90, and usually put them on and under vegetation and leaf litter in the pond. Females usually lay their eggs in shallow, calm water that has little action around it. If they survive, embryos will hatch into tadpoles within one to three weeks. The tadpoles feed on periphyton, filamentous algae, diatoms, and pollen in or on the surface of the water. They feed using suction, and a beak-like structure that helps scrape vegetation off surfaces.

Metamorphosis usually follows about two to two and a half months later, but experience raising these tadpoles shows that some may delay metamorphosis, changing up to five months after hatching. The survival rate of these delayed metamorphs is lower, and the evolutionary utility of this delayed metamorphosis is uncertain. It may be related to the prevalence of fire in their natural ecosystem.

During the final stages of transformation when the tadpoles have four limbs and a tail, they stop feeding for a short time while their mouths widen and their digestive systems adjust from herbivorous to carnivorous.

For the most part, Pacific tree frogs are nocturnal, but they have been spotted during the day. These frogs spend a lot of time hiding under rotten logs, rocks, long grasses, and leaf litter, where they are very difficult to see unless they move. When they hunt, their toe pads allow them to climb on vegetation and other surfaces where they are to ambush their prey. Much of their diets consists of spiders, beetles, flies, ants, and other insects and arthropods; they can and do eat insects that are almost as large as they are, and will expand their bodies slightly to accommodate these meals.

Pacific tree frogs mature quickly, and are usually mate the season after metamorphosis. Predators include snakes, raccoons, herons, egrets, and other small mammals and reptiles.

When they sense potential food nearby, they commonly twitch a toe to attract it within easy reach of their tongues. They can live up to 9 years in captivity.

They produce several call types.[7] These include the males' advertisement call, commonly described as “ribbit” or “crek-ek”, as well as an encounter trill call. The cre-ek call can be quite loud and can thus be heard from very far away. Males also produce a “dry land call”, a long cre-ee-ee-eeek, that can be heard anytime in the year except during the coldest and driest periods. Pacific tree frogs are the most commonly heard frogs along much of the West Coast of the United States.

Green and brown color morphs[edit]

One of the most interesting features of these frogs is their ability to change color from brown to green. Previously, adults were thought to occur in two different fixed colors. Now, some of them have been found to be able to change between the two. They can also change from lighter to darker, shift from patterned markings to pure colors and vice versa, and even display combinations of colors, brown/green being the most frequent.

These color-changing morphs are triggered not by color change in their environments, but a change in background brightness. This type of environmental change would be caused by seasonal fluctuation. A full change in the dorsal coloration of a color morph can take from weeks to months, but initial changes can occur in just a few hours. This has been shown to be a very useful cryptic survival feature for these frogs.

Skin color is produced via pigment cells called chromatophores. Three types of chromatophores are commonly found in amphibians: Xanthophores, which contain yellow, orange, or red pigments and are found uppermost on the dermis; iridophores, which lie below the xanthophores and function by reflecting and scattering white light up through them (in the case of Pseudacris regilla and many other North American frogs, iridophores reflect blue light through the yellow pigment cells above to create a green frog) and melanophores, which are the deepest pigment cells and are responsible for the presence of black and brown pigments.

A rare, recessive "blue morph" is known. One is housed at the Humboldt State University Natural History Museum in Arcata, California. [1] This mutation might inhibit the xanthophores' ability to produce yellow pigments, thus the normally green frog (possibly of the color-unchanging type) appears blue.

Side view showing a color variant.
Green Morph.

Homing[edit]

Research was done on Pacific tree frogs to discover if they have homing instincts and what was their main source for knowing where their home was. To find the answer, these frogs were marked and moved 300 yards away from their pond. Several days later, the researchers did a recapture on the original pond in which 66.3% of the frogs were recaptured, indicating there was some source of homing instinct. This was made apparent again when 24 frogs were placed into a larger pond, and 20 of those frogs returned to their original pond. The frogs' movement patterns and olfactory, auditory, and kinesthetic senses could be explanations for the homing, but not a single factor was able to explain the results, indicating that these frogs might be using all or a combination of these factors for homing.[8]

Conservation status[edit]

These frogs are the most common frogs on the West Coast of North America. Although Pacific tree frogs remain abundant, some other species found in the same areas, such as California red-legged frogs, are declining. Most populations of tree frogs appear healthy, and they have no concern or conservation status.

Regional importance[edit]

In 2007, the Pacific tree frog was named the state amphibian of the State of Washington.[9] It is also a very important species in all of the regions where it is found because it is a keystone species. Many other species, such as garter snakes, depend upon its abundance as a prey item for their survival.

References[edit]

  1. ^ Geoffrey Hammerson, Georgina Santos-Barrera (2004). "Pseudacris regilla". IUCN Red List of Threatened Species. Version 2014.2. International Union for Conservation of Nature. Retrieved 3 September 2014. 
  2. ^ a b c Frost, Darrel R. (2014). "Pseudacris regilla (Baird and Girard, 1852)". Amphibian Species of the World: an Online Reference. Version 6.0. American Museum of Natural History. Retrieved 3 September 2014. 
  3. ^ Recuero, Ernesto; Martínez-Solano, Íñigo; Parra-Olea, Gabriela; García-París, Mario (2006). "Phylogeography of Pseudacris regilla (Anura: Hylidae) in western North America, with a proposal for a new taxonomic rearrangement". Molecular Phylogenetics and Evolution 39 (2): 293–304. doi:10.1016/j.ympev.2005.10.011. 
  4. ^ Dodd, C. K., Jr. 2013. Frogs of the United States and Canada. Volume 1. xxxi + 460.
  5. ^ S.O. MacDonald. "Pacific Chorus Frog". The Amphibians and Reptiles of Alaska. A Field Handbook. Retrieved 3 September 2014. 
  6. ^ C. Michael Hogan (2008) Rough-skinned Newt (Taricha granulosa), Globaltwitcher, ed. Nicklas Stromberg
  7. ^ Hallock, L.A. and McAllister, K.R. (February 2005). "Pacific Treefrog". Washington Sate Department of Natural Resources. Retrieved 11 January 2013. 
  8. ^ Jameson, David L. 1957. Population structure and homing responses in the Pacific Tree Frog. American Society of Ichthyologist and Herpetologists. Copeia. 1957 No. 3 pp. 221–228
  9. ^ Symbols of Washington State
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Recuero et al. (2006) examined patterns of mtDNA variation (including new samples and additional samples presented by Ripplinger and Wagner 2004) and reviewed available allozyme data for Pseudacris regilla (sensu lato). They concluded that P. regilla should be partitioned into three species, P. regilla, P. sierra, and P. hypochondriaca (the original proposal included different names based on taxonomic errors that were subsequently corrected). The authors did not provide detailed maps or descriptions of the ranges of the three proposed species and did not describe the contact zones between P. sierra and the other two species.

This species formerly was included in the genus Hyla; it was transferred to the genus Pseudacris by Hedges (1986), based on allozyme data (see also Highton 1991). Cocroft (1994) analyzed morphological and biochemical data and concluded that the Hyla regilla-Hyla cadaverina clade does not arise within the clade containing Pseudacris (traditional sense), P. ocularis, and P. crucifer; he suggested that the most conservation approach may be to leave regilla and cadaverina in the genus Hyla until their relationships are more clearly resolved. da Silva (1997) recommended that for now Hedges' (1986) definition of Pseudacris should be maintained.

Highton (2000) reviewed available allozyme data from Case et al. (1975) and concluded that P. regilla likely encompasses more than one species but that further range-wide study is needed to clarify the situation.

A molecular phylogeny of Pseudacris based on mtDNA data (Moriarty and Cannatella 2004) revealed four strongly supported clades within Pseudacris: (1) A West Coast Clade containing regilla and cadaverina, (2) a Fat Frog Clade including ornata, streckeri, and illinoensis, (3) a Crucifer Clade consisting of crucifer and ocularis, and (4) a Trilling Frog Clade containing all other Pseudacris. Within the Trilling Frog Clade, brimleyi and brachyphona form the sister group to the Nigrita Clade: nigrita, feriarum, triseriata, kalmi, clarkii, and maculata. The Nigrita Clade shows geographic division into three clades: (1) populations of maculata and triseriata west of the Mississippi River and Canadian populations, (2) southeastern United States populations of feriarum and nigrita, and (3) northeastern United States populations of feriarum, kalmi, and triseriata. Current taxonomy does not reflect the phylogenetic relationships among populations of the Nigrita Clade (Moriarty and Canatella 2004). For example, the molecular data appear to indicate that triseriata, maculata, and clarkii in the western United States are conspecific, but the authors indicated that further sampling and analysis of the Trilling Frog Clade are needed before their relationships can be determined and an appropriate taxonomy established. Moriarty and Cannatella (2004) found that subspecific epithets for crucifer (crucifer and bartramiana) and nigrita (nigrita and verrucosa) are uninformative, and they therefore discouraged recognition of these subspecies. They concluded that further study is needed to determine if illinoensis warrants status as a distinct species. Molecular data were consistent with retention of regilla, cadaverina, ocularis, and crucifer in the genus Pseudacris.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!