Ecology

Habitat

Depth range based on 22 specimens in 1 taxon.
Water temperature and chemistry ranges based on 17 samples.

Environmental ranges
  Depth range (m): 1 - 233.5
  Temperature range (°C): 18.961 - 27.744
  Nitrate (umol/L): 0.390 - 9.112
  Salinity (PPS): 34.217 - 36.557
  Oxygen (ml/l): 3.657 - 4.844
  Phosphate (umol/l): 0.091 - 0.893
  Silicate (umol/l): 1.328 - 7.363

Graphical representation

Depth range (m): 1 - 233.5

Temperature range (°C): 18.961 - 27.744

Nitrate (umol/L): 0.390 - 9.112

Salinity (PPS): 34.217 - 36.557

Oxygen (ml/l): 3.657 - 4.844

Phosphate (umol/l): 0.091 - 0.893

Silicate (umol/l): 1.328 - 7.363
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neogonodactylus oerstedii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATACTTTATTTTAGGGGCTTGATCAGGAATAGTCGGAACAGCCCTTAGATTAATTATTCGAGCAGAACTAGGACAACCAGGTAGATTAATTGGAGAT---GACCAAATTTACAACGTTGTAGTAACTGCTCACGCTTTCATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCACTTATATTAGGAGCCCCTGATATGGCATTCCCACGGATAAACAATATAAGATTCTGATTATTACCCCCTGCGCTTACTCTTTTACTTTCAAGAGGTATAGTAGAAAGGGGAGTGGGTACTGGATGAACTGTTTATCCTCCCTTATCCGCAGGTATTGCTCATGCGGGGGCTTCAGTTGACTTGGGTATTTTTTCTTTACACATAGCAGGAGCTTCTTCTATTTTAGGGGCAGTAAATTTTATTACTACAGTTATTAATATACGATCTAATGGAATAACTATAGACCGTATACCATTGTTTGTCTGAGCTGTTTTTATTACGGCTATTCTTTTACTTCTTTCCCTTCCTGTCTTAGCAGGTGCAATTACTATACTACTTACTGACCGTAATTTAAATACATCTTTTTTCGATCCTGCCGGGGGAGGAGACCCTGTTCTTTATCAACAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Neogonodactylus oerstedii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!