Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Comprehensive Description

Description

A small dendrobatid species (18-22 mm) with granular skin (Savage 2002). The typical color of the back and the upper arms is bright orange (Savage 2002). The belly, lower arms and the hind legs are green to blue-green (Savage 2002). Calling males have a black vocal pouch (Goodman 1971). In the area of Quepos, Costa Rica, this species has an olive-colored dorsum (Meyer 1996).

A stage 28 tadpole was collected after deposition was observed and was described by van Wijngaarden and Bolaños (1992). Total length at stage 28 was 17.8 mm and body length was 5.8 mm. For a different specimen at stage 39 the total length was 25 mm and the body length was 8.5 mm. Tail length was consistently 67% of body length from stage 25 to stage 39. The tadpole has a depressed body. The snout is rounded in dorsal view at all stages, but different specimens varied in profile from "edge-shaped" at stage 25 to rounded at stages 26-34, to truncate in stages 27 and 39. Nostrils are dorsal and are directed laterally. Eyes are dorsal and directed dorsolaterally. Mouth is anteroventral. Oral disc is not emarginate. Dental formula is 1[1]/1. Labial teeth are present in a single anterior row (A1) and single posterior row (P1); A1 is irregularly interrupted while P1 is continuous and longer than A1. Anterior jaw sheath is widely arched with slender marginal processes and finely serrated; the posterior jaw sheath is also arched and finely serrated. Jaw sheath keratinization was incomplete at stages 25-27. Single row of large marginal papillae borders the posterior labium. The spiracle is low and sinistral and the vent is medial. Tail fins are equal in height; the dorsal tail fin does not extend onto the body. Tail tip is attenuated in the specimen described by van Wijngaarden and Bolaños 1992, but has been reported as rounded by other workers (Silverstone 1975; see van Wijngaarden and Bolaños 1992). Meyer (1993) observed that the tadpoles have epidermal tubes at the tail base, the function of which is unknown, but van Wijngaarden and Bolaños (1992) did not report this feature.

According to van Wijngaarden and Bolaños (1992), the only sympatric congener of O. granulifera is Dendrobates auratus and the larger tadpoles of D. auratus have a denticle formula of 2(1)(2)/3 and two rows of smaller papillae, in contrast to those of O. granulifera, where the denticle formula is 1[1]/1 and there is a single row of large papillae. Myers et al. (1995) also reported Oophaga pumilio to be in sympatry with O. granulifera.

In life and in preservative, tadpole coloration is suffused with gray that lightens from the dorsum to the venter (van Wijngaarden and Bolaños 1992).

A Spanish-language species account can be found at the website of Instituto Nacional de Biodiversidad (INBio).

The karotype is 2n=20 (Rasotto et al. 1987).

This species was transferred to the genus Oophaga by Grant et al. (2006) and subsequently back to the genus Dendrobates by Santos et al. (2009). In 2011, the genus Dendrobates was subdivided into seven genera, including the new genus Oophaga by Brown et al (2011).

  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Silverstone, P. A. (1975). ''A revision of the poison-arrow frogs of the genus Dendrobates Wagler.'' Natural History Museum of Los Angeles County, Scientific Bulletin, 21, 1-55.
  • Santos, J. C., Coloma, L. A., Summers, K., Caldwell, J. P., Ree, R., and Cannatella, D. C. (2009). ''Amazonian amphibian diversity is primarily derived from late Miocene Andean lineages.'' PLoS Biology, 7(3), e1000056.
  • Crump, M. (1972). ''Territoriality and mating behavior in Dendrobates granuliferus (Anura: Dendrobatidae).'' Herpetologica, 28, 195-198.
  • Daly, J. W., Brown, G. B., and Mensah-Dwumah, M. (1978). ''Classification of skin alkaloids from neotropical poison-dart frogs (Dendrobatidae).'' Toxicon, 16, 163-188.
  • Goodman, D. (1971). ''Territorial behavior in a neotropical frog, Dendrobates granuliferus.'' Copeia, 1971, 365-370.
  • Meyer, E. (1996). ''Eine oliv-gelbe Variante von Dendrobates granuliferus aus dem zentral-pazifischen Tiefland Costa Ricas: erste Beobachtungen zur Fortpflanzungsbiologie. .'' Herpetofauna (Weinstadt), 18, 21-27.
  • Miller, J. R. B., and McFarlane, D. A. (2007). ''A preliminary investigation into Hayne estimates of poison dart frog (Anura: Dendrobatidae) densities in recovering tropical forest habitat in Costa Rica.'' Herpetological Conservation and Biology, 3(2), 289-294.
  • Myers, C. W., Daly, J.W., Garraffo, H.M., Wisnieski, A., and Cover, J.F., Jr. (1995). ''Discovery of the Costa Rican poison frog Dendrobates granuliferus in sympatry with Dendrobates pumilio, and comments on taxonomic use of skin alkaloids.'' , 14(3144), 1-21.
  • Rasotto, M. B., Cardellini, P., and Sala, M. (1987). ''Karyotypes of five species of Dendrobatidae (Anura: Amphibia).'' Herpetologica, 43(2), 177-182.
  • Summers, K. (2000). ''Mating and aggressive behaviour in dendrobatid frogs from Corcovado National Park, Costa Rica: a comparative study.'' Behavior, 137, 7-24.
  • van Wijngaarden, R., and van Gool, S. (1994). ''Site fidelity and territoriality in the dendrobatid frog Dendrobates granuliferus.'' Amphibia-Reptilia, 15, 171-181.
  • Brown J.L., Twomey E., Amézquita A., De Souza M.B., Caldwell J.P., Lötters S., Von May R., Melo-Sampaio P.R., Mejía-Vargas D., Perez-Peña P., Pepper M., Poelman E.H., Sanchez-Rodriguez M., and Summers K. (2011). ''A taxonomic revision of the Neotropical poison frog genus Ranitomeya (Amphibia: Dendrobatidae).'' Zootaxa, 3083, 1-120.
  • Ibañez, R., Solí­s, F., Jaramillo, C. and Rand, S. (2000). ''An overview of the herpetology of Panama.'' Mesoamerican Herpetology: Systematics, Zoogeography and Conservation. Johnson, J. D., Webb, R. G. and Flores-Villela, O. A., eds., The University of Texas at El Paso, El Paso, Texas, 159-170.
  • Bolaños, F. (1990). 1990): Actividad de Canto y Territorialidad en Dendrobates granuliferus Taylor 1958. Thesis. Universidad de Costa Rica, Sistema de Estudios de Posgrado, Ciudad Universitaria , Costa Rica.
  • Meyer, E. (1992). ''Erfolgreiche Nachzucht von Dendrobates granuliferus Taylor, 1958. Cría exitosa en cautividad de Dendrobates granuliferus Taylor, 1958.'' Herpetofauna, 14, 11-21.
  • Meyer, E. (1993). ''Fortpflanzung und Brutpflegeverhalten von Dendrobates granuliferus Taylor, 1958 aus Costa Rica (Amphibia: Dendrobatidae).'' Veröffentlichung - Naturhistorisches Museum Schleussingen Btholdsbrg, Schleusingen, 7/8, 113-142.
  • Meyer, E. (1996). Ã-kologie und Biogeographie des zentralamerikanischen Pfeilgiftfrosches Dendrobates granuliferus TAYLOR. Dissertation, University of Ulm, Ulm, Germany.
  • van Wijngaarden, R., and Bolaños, F. (1992). ''Parental care in Dendrobates granuliferus (Anura: Dendrobatidae), with a description of the tadpole.'' Journal of Herpetology, 26(1), 102-105.
  • Grant, T., Frost, D. R., Caldwell, J. P., Gagliardo, R., Haddad, C. F. B., Kok, P. J. R., Means, D. B., Noonan, B. P., Schargel, W. E., and Wheeler, W. C. (2006). ''Phylogenetic systematics of dart-poison frogs and their relatives (Amphibia: Athesphatanura: Dendrobatidae).'' Bulletin of the American Museum of Natural History, (299), 1-262.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs in the lowlands of south-western Costa Rica, adjacent south-western Panama, and possibly in south-eastern Costa Rica, from 20-100m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Oophaga granulifera occurs mainly in southwestern Costa Rica, on low mountains near Puntarenas, Costa Rica, at elevations from 20 m - 100 m above sea level (Meyer 1992, 1993; Savage 2002; Stuart et al. 2008). Its range extends down into the adjacent southwestern region of Panama (Young et al. 1999; Ibañez et al. 2000). It has also been found in much smaller numbers along the Atlantic Coast, in a region of southeastern Costa Rica adjacent to Panama (Myers et al. 1995). It occurs in humid lowland forest, near streams, and has been reported from both undisturbed primary forest (Meyer et al. 1993; Miller and McFarlane 2008) and secondary forest (van Wijngaarden and Bolaños 1992; Miller and McFarlane 2008) as well as plantations (Stuart et al. 2008) and bamboo habitat (Miller and McFarlane 2008). However, it appears to be far more common in primary forest (Meyer et al. 1993; Miller and McFarlane 2008).

  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Silverstone, P. A. (1975). ''A revision of the poison-arrow frogs of the genus Dendrobates Wagler.'' Natural History Museum of Los Angeles County, Scientific Bulletin, 21, 1-55.
  • Santos, J. C., Coloma, L. A., Summers, K., Caldwell, J. P., Ree, R., and Cannatella, D. C. (2009). ''Amazonian amphibian diversity is primarily derived from late Miocene Andean lineages.'' PLoS Biology, 7(3), e1000056.
  • Crump, M. (1972). ''Territoriality and mating behavior in Dendrobates granuliferus (Anura: Dendrobatidae).'' Herpetologica, 28, 195-198.
  • Daly, J. W., Brown, G. B., and Mensah-Dwumah, M. (1978). ''Classification of skin alkaloids from neotropical poison-dart frogs (Dendrobatidae).'' Toxicon, 16, 163-188.
  • Goodman, D. (1971). ''Territorial behavior in a neotropical frog, Dendrobates granuliferus.'' Copeia, 1971, 365-370.
  • Meyer, E. (1996). ''Eine oliv-gelbe Variante von Dendrobates granuliferus aus dem zentral-pazifischen Tiefland Costa Ricas: erste Beobachtungen zur Fortpflanzungsbiologie. .'' Herpetofauna (Weinstadt), 18, 21-27.
  • Miller, J. R. B., and McFarlane, D. A. (2007). ''A preliminary investigation into Hayne estimates of poison dart frog (Anura: Dendrobatidae) densities in recovering tropical forest habitat in Costa Rica.'' Herpetological Conservation and Biology, 3(2), 289-294.
  • Myers, C. W., Daly, J.W., Garraffo, H.M., Wisnieski, A., and Cover, J.F., Jr. (1995). ''Discovery of the Costa Rican poison frog Dendrobates granuliferus in sympatry with Dendrobates pumilio, and comments on taxonomic use of skin alkaloids.'' , 14(3144), 1-21.
  • Rasotto, M. B., Cardellini, P., and Sala, M. (1987). ''Karyotypes of five species of Dendrobatidae (Anura: Amphibia).'' Herpetologica, 43(2), 177-182.
  • Summers, K. (2000). ''Mating and aggressive behaviour in dendrobatid frogs from Corcovado National Park, Costa Rica: a comparative study.'' Behavior, 137, 7-24.
  • van Wijngaarden, R., and van Gool, S. (1994). ''Site fidelity and territoriality in the dendrobatid frog Dendrobates granuliferus.'' Amphibia-Reptilia, 15, 171-181.
  • Brown J.L., Twomey E., Amézquita A., De Souza M.B., Caldwell J.P., Lötters S., Von May R., Melo-Sampaio P.R., Mejía-Vargas D., Perez-Peña P., Pepper M., Poelman E.H., Sanchez-Rodriguez M., and Summers K. (2011). ''A taxonomic revision of the Neotropical poison frog genus Ranitomeya (Amphibia: Dendrobatidae).'' Zootaxa, 3083, 1-120.
  • Ibañez, R., Solí­s, F., Jaramillo, C. and Rand, S. (2000). ''An overview of the herpetology of Panama.'' Mesoamerican Herpetology: Systematics, Zoogeography and Conservation. Johnson, J. D., Webb, R. G. and Flores-Villela, O. A., eds., The University of Texas at El Paso, El Paso, Texas, 159-170.
  • Bolaños, F. (1990). 1990): Actividad de Canto y Territorialidad en Dendrobates granuliferus Taylor 1958. Thesis. Universidad de Costa Rica, Sistema de Estudios de Posgrado, Ciudad Universitaria , Costa Rica.
  • Meyer, E. (1992). ''Erfolgreiche Nachzucht von Dendrobates granuliferus Taylor, 1958. Cría exitosa en cautividad de Dendrobates granuliferus Taylor, 1958.'' Herpetofauna, 14, 11-21.
  • Meyer, E. (1993). ''Fortpflanzung und Brutpflegeverhalten von Dendrobates granuliferus Taylor, 1958 aus Costa Rica (Amphibia: Dendrobatidae).'' Veröffentlichung - Naturhistorisches Museum Schleussingen Btholdsbrg, Schleusingen, 7/8, 113-142.
  • Meyer, E. (1996). Ã-kologie und Biogeographie des zentralamerikanischen Pfeilgiftfrosches Dendrobates granuliferus TAYLOR. Dissertation, University of Ulm, Ulm, Germany.
  • van Wijngaarden, R., and Bolaños, F. (1992). ''Parental care in Dendrobates granuliferus (Anura: Dendrobatidae), with a description of the tadpole.'' Journal of Herpetology, 26(1), 102-105.
  • Grant, T., Frost, D. R., Caldwell, J. P., Gagliardo, R., Haddad, C. F. B., Kok, P. J. R., Means, D. B., Noonan, B. P., Schargel, W. E., and Wheeler, W. C. (2006). ''Phylogenetic systematics of dart-poison frogs and their relatives (Amphibia: Athesphatanura: Dendrobatidae).'' Bulletin of the American Museum of Natural History, (299), 1-262.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Identification

Adult

Species description based on Savage (2002).  A small poison frog (males to 25 mm). Male's throats are green or black; the throat of females is red.

Dorsal

Dorsal coloration is variable. Most individuals are red, except for the hind limbs, which are a vibrant bluish-green. Other individuals are yellow or green or red all over; yellow or green individuals with or without some reddish coloration on the arms (Savage 2002). The dorsal skin is granular.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A diurnal, terrestrial species most often found in relatively undisturbed humid lowland forest, but also recorded from secondary forest and plantations. Eggs are deposited on the forest floor and the female transports the tadpoles to bromeliads to complete metamorphosis.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat

Lowland forest below 100 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Diet

Diet

The diet consists of numerous types of small arthropods,including ants (Savage 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Ecology

Oophaga granulifera is diurnal (Savage 2002). It inhabits leaf litter, but is often found climbing trees and shrubs, or along stream margins (Savage 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Call

A harsh series of "chirps" (Myers and Daly 1976, Myers et al 1995).

Behavior and communication

Males are territorial, and will engage in wrestling bouts with intruding males if necessary (Crump, 1972, van Wijngaarden and van Gool 1994). Males guard eggs until they hatch, at which time the female returns to transport them to phytotelmata to continue development (Savage 2002). Females deposit unfertilized eggs for tadpoles to consume (Savage 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Life History

Breeding season

Breeding occurs during the rainy season (Savage 2002). Males call from vegetation in the forest during the early part of the day and late in the afternoon (Savage 2002). Males and females engage in ritualistic courtship behaviors (Crump 1972). Amplexus occurs with the two individuals joining their vents and facing in opposite directions (Crump 1972).

Egg

Females lay 2-4 eggs at a time (Savage 2002).

Tadpole

The tadpole is small, with a very long tail with almost no tail fins (Savage 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physiology and Cell Biology

Cell Biology

Karyotype

Karyotype

2N = 20 (Rasotto, Cardellini and Sala 1987)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oophaga granulifera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACCCTATATCTAGTGTTTGGGGCATGAGCTGGGATAGTTGGTACAGCTCTAAGCCTTCTCATCCGAGCAGAACTGAGCCAGCCTGGGGCCCTTTTAGGTGAC---GACCAAATCTACAATGTAGTCGTCACTGCCCATGCCTTCGTAATAATTTTTTTTATGGTTATACCCATTCTAATTGGAGGCTTTGGTAACTGACTTGTCCCCCTAATAATCGGCGCCCCTGATATGGCCTTCCCTCGAATGAATAACATAAGCTTTTGATTGCTTCCCCCATCTTTCCTCCTCCTACTAGCTTCCGCTGGGGTAGAAGCTGGAGCAGGGACAGGGTGAACTGTATATCCACCCCTCGCAGGAAACCTAGCCCATGCCGGCCCTTCAGTAGACCTAACCATCTTTTCTCTCCACCTAGCTGGCGTTTCATCTATCCTCGGGGCAATCAACTTTATTACCACAACTCTGAACATAAAGCCCCCTTCTCTAACACAATATCAAACTCCTCTTTTTGTTTGATCTGTCTTAATCACAGCAGTCCTACTTCTTCTGTCTCTTCCAGTGCTAGCTGCAGGCATCACCATACTATTAACCGACCGAAATCTTAATACAACCTTTTTTGACCCTGCCGGAGGAGGTGATCCAGTCCTCTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oophaga granulifera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B1ab(iii)

Version
3.1

Year Assessed
2004

Assessor/s
Frank Solís, Roberto Ibáñez, Gerardo Chaves, Jay Savage, César Jaramillo, Querube Fuenmayor, Federico Bolaños

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Vulnerable because its Extent of Occurrence is less than 20,000 km2, its distribution is severely fragmented, and there is continuing decline in the extent and quality of its habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is common in Costa Rica.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Like most other dendrobatid frogs, the Granular Poison Frog is diurnal and terrestrial, protected from predation by its aposematic coloration. This species is highly territorial (Goodman 1971; Crump 1972; Bolaños 1990; van Wijngaarden and van Gool 1994), showing male-male physical aggression (Goodman 1971; Crump 1972). Territoriality in this species involves defending calling sites and oviposition sites (Bolaños 1990), and is vocally mediated (van Wijngaarden and van Gool 1994). Color recognition may not be a key factor in male-male or intraspecies recognition in O. granulifera, since an O. granulifera male was observed to attack both a female O. granulifera and a similar-sized but cryptically-colored Eleutherodactylus that were positioned near a loudspeaker during the playback of male vocalizations (van Wijngaarden and van Gool 1994).

Although Myers and Daly (1976) characterized this species as calling "incessantly," Bolaños et al. (1990) found a bimodal calling pattern, with the most active calling period in early morning and a second calling period in the last hour before dusk. Males observed in a three-week study by van Wijngaarden and van Gool (1994) had one to three fixed calling sites and occupied those sites more frequently between the hours of 5 am and 10 am than after 10 am. Calling sites are elevated, 0.7 m to 1.5 m above the ground (van Wijngaarden and van Gool 1994; Crump 1972; Goodman 1971). Meyer (1993) states that the courtship call is distinguished from that of other dendrobatid species by its long notes, while Myers and Daly (1976) describe the advertisement call as a "chirp" call rather than the buzz call used by some other species of dendrobatids. According to Myers and Daly (1976), chirp calls are a series of harsh and not well-modulated notes, with rapid pulses that cannot be resolved on wide-band sound spectrograms. Meyer (1996) noted differences in advertisement call structure among south to central Costa Rican populationsof this species.

During the rainy season, receptive females approach calling males, who then lead the females to an oviposition site (Crump 1972; van Wijngaarden and van Gool 1994). Males sometimes continue to call softly while leading the female (van Wijngaarden and van Gool 1994). Eggs are laid on dead, curled-up leaves that are elevated and covered by other leaves; oviposition sites were observed to be in twig forks at 0.15-0.2 m above ground, between stones on a boulder at 0.5 m, and in a bromeliad leaf axil, about 2.5 m above the calling site on a tree (van Wijngaarden and van Gool 1994). Clutches laid by members of the D. histrionicus species group usually consist of 3-4 eggs (Crump 1972; van Wijngaarden and van Gool 1994). Males attend the clutch and perform hydric brooding on a daily basis, moistening the eggs periodically with water from the bladder (Meyer 1992; Meyer 1993). Females continue to lay small clutches of fertilized eggs until the first clutch hatches (Meyer 1993). At that point the female transports her tadpoles to water-filled sites in plants (Meyer 1993). Tadpoles are usually transported one at a time but occasionally a female will transport two tadpoles at once (van Wijngaarden and Bolaños 1992). Tadpole brooding sites observed in the wild by van Wijngaarden and Bolaños (1992) included a leaf axil of a Heliconia plant, 0.15 m above the ground; the broken stem of a palm tree, 0.8 m above ground; leaf axils of various species of Dieffenbachia plants, 0.6-0.95 m above ground; the broken stem of a shrub, 1.5 m above ground; and in a bromeliad (Guzmania sp.), 3.0 m above ground. For the six observed Dieffenbachia tadpole brooding sites, the mean water volume was found to be 2.4 ml (van Wijngaarden and Bolaños 1992). Tadpoles were generally found singly (n=10), but on one occasion two tadpoles were found in the same brooding site (van Wijngaarden and Bolaños 1992).

Larvae are oophagous; the female visits each plant axil and lays unfertilized eggs to provide nutrition for the growing tadpoles (Meyer 1993). The tadpoles perform a complicated swimming behavior that appears to signal the female to lay the nutritive eggs (Meyer 1993). In the wild, under natural conditions, development takes approximately 80 days; in captivity when fed with chicken egg yolk, development requires about 200 days, and some of the captive larvae are only able to metamorphose when also fed thyroxin (Meyer 1993).

During the dry season (January to April) it is difficult to find any individuals. Bolaños et al. (1990), during a one-year study, found that O. granulifera left the study area in the dry season but returned in the wet season.

  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Silverstone, P. A. (1975). ''A revision of the poison-arrow frogs of the genus Dendrobates Wagler.'' Natural History Museum of Los Angeles County, Scientific Bulletin, 21, 1-55.
  • Santos, J. C., Coloma, L. A., Summers, K., Caldwell, J. P., Ree, R., and Cannatella, D. C. (2009). ''Amazonian amphibian diversity is primarily derived from late Miocene Andean lineages.'' PLoS Biology, 7(3), e1000056.
  • Crump, M. (1972). ''Territoriality and mating behavior in Dendrobates granuliferus (Anura: Dendrobatidae).'' Herpetologica, 28, 195-198.
  • Daly, J. W., Brown, G. B., and Mensah-Dwumah, M. (1978). ''Classification of skin alkaloids from neotropical poison-dart frogs (Dendrobatidae).'' Toxicon, 16, 163-188.
  • Goodman, D. (1971). ''Territorial behavior in a neotropical frog, Dendrobates granuliferus.'' Copeia, 1971, 365-370.
  • Meyer, E. (1996). ''Eine oliv-gelbe Variante von Dendrobates granuliferus aus dem zentral-pazifischen Tiefland Costa Ricas: erste Beobachtungen zur Fortpflanzungsbiologie. .'' Herpetofauna (Weinstadt), 18, 21-27.
  • Miller, J. R. B., and McFarlane, D. A. (2007). ''A preliminary investigation into Hayne estimates of poison dart frog (Anura: Dendrobatidae) densities in recovering tropical forest habitat in Costa Rica.'' Herpetological Conservation and Biology, 3(2), 289-294.
  • Myers, C. W., Daly, J.W., Garraffo, H.M., Wisnieski, A., and Cover, J.F., Jr. (1995). ''Discovery of the Costa Rican poison frog Dendrobates granuliferus in sympatry with Dendrobates pumilio, and comments on taxonomic use of skin alkaloids.'' , 14(3144), 1-21.
  • Rasotto, M. B., Cardellini, P., and Sala, M. (1987). ''Karyotypes of five species of Dendrobatidae (Anura: Amphibia).'' Herpetologica, 43(2), 177-182.
  • Summers, K. (2000). ''Mating and aggressive behaviour in dendrobatid frogs from Corcovado National Park, Costa Rica: a comparative study.'' Behavior, 137, 7-24.
  • van Wijngaarden, R., and van Gool, S. (1994). ''Site fidelity and territoriality in the dendrobatid frog Dendrobates granuliferus.'' Amphibia-Reptilia, 15, 171-181.
  • Brown J.L., Twomey E., Amézquita A., De Souza M.B., Caldwell J.P., Lötters S., Von May R., Melo-Sampaio P.R., Mejía-Vargas D., Perez-Peña P., Pepper M., Poelman E.H., Sanchez-Rodriguez M., and Summers K. (2011). ''A taxonomic revision of the Neotropical poison frog genus Ranitomeya (Amphibia: Dendrobatidae).'' Zootaxa, 3083, 1-120.
  • Ibañez, R., Solí­s, F., Jaramillo, C. and Rand, S. (2000). ''An overview of the herpetology of Panama.'' Mesoamerican Herpetology: Systematics, Zoogeography and Conservation. Johnson, J. D., Webb, R. G. and Flores-Villela, O. A., eds., The University of Texas at El Paso, El Paso, Texas, 159-170.
  • Bolaños, F. (1990). 1990): Actividad de Canto y Territorialidad en Dendrobates granuliferus Taylor 1958. Thesis. Universidad de Costa Rica, Sistema de Estudios de Posgrado, Ciudad Universitaria , Costa Rica.
  • Meyer, E. (1992). ''Erfolgreiche Nachzucht von Dendrobates granuliferus Taylor, 1958. Cría exitosa en cautividad de Dendrobates granuliferus Taylor, 1958.'' Herpetofauna, 14, 11-21.
  • Meyer, E. (1993). ''Fortpflanzung und Brutpflegeverhalten von Dendrobates granuliferus Taylor, 1958 aus Costa Rica (Amphibia: Dendrobatidae).'' Veröffentlichung - Naturhistorisches Museum Schleussingen Btholdsbrg, Schleusingen, 7/8, 113-142.
  • Meyer, E. (1996). Ã-kologie und Biogeographie des zentralamerikanischen Pfeilgiftfrosches Dendrobates granuliferus TAYLOR. Dissertation, University of Ulm, Ulm, Germany.
  • van Wijngaarden, R., and Bolaños, F. (1992). ''Parental care in Dendrobates granuliferus (Anura: Dendrobatidae), with a description of the tadpole.'' Journal of Herpetology, 26(1), 102-105.
  • Grant, T., Frost, D. R., Caldwell, J. P., Gagliardo, R., Haddad, C. F. B., Kok, P. J. R., Means, D. B., Noonan, B. P., Schargel, W. E., and Wheeler, W. C. (2006). ''Phylogenetic systematics of dart-poison frogs and their relatives (Amphibia: Athesphatanura: Dendrobatidae).'' Bulletin of the American Museum of Natural History, (299), 1-262.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The major threat is habitat loss due to agriculture, selective logging, and human settlement. The current level of offtake of specimens for the international trade is unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Although Oophaga granulifera is still relatively common in southwestern Costa Rica, its population is declining (Stuart et al. 2008). In southeastern Costa Rica it is considerably less common than its congener O. pumilio, with Myers et al. (1995) observing only four individuals of O. granulifera for every hundred O. pumilio. The habitat of this species is fragmented, and is under threat of becoming further fragmented due to forest destruction (Stuart et al. 2008). Logging, agriculture, and expanding human settlement thus present the greatest threats (Stuart et al. 2008). Although Meyer et al. (1993) did not find this species outside of closed primary rainforest or away from fast-flowing streams, it has been reported from secondary forest (van Wijngaarden and Bolaños 1992) and plantations as well (Stuart et al. 2008). However, Miller and McFarlane (2007) reported that densities were considerably lower in secondary forest and considered secondary forest likely to be unsuitable habitat. The range overlaps with several protected areas, including Parque Nacional Corcovado (Summers 2000) and the Firestone Reserve (Miller and McFarlane 2008) in Costa Rica.

  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Silverstone, P. A. (1975). ''A revision of the poison-arrow frogs of the genus Dendrobates Wagler.'' Natural History Museum of Los Angeles County, Scientific Bulletin, 21, 1-55.
  • Santos, J. C., Coloma, L. A., Summers, K., Caldwell, J. P., Ree, R., and Cannatella, D. C. (2009). ''Amazonian amphibian diversity is primarily derived from late Miocene Andean lineages.'' PLoS Biology, 7(3), e1000056.
  • Crump, M. (1972). ''Territoriality and mating behavior in Dendrobates granuliferus (Anura: Dendrobatidae).'' Herpetologica, 28, 195-198.
  • Daly, J. W., Brown, G. B., and Mensah-Dwumah, M. (1978). ''Classification of skin alkaloids from neotropical poison-dart frogs (Dendrobatidae).'' Toxicon, 16, 163-188.
  • Goodman, D. (1971). ''Territorial behavior in a neotropical frog, Dendrobates granuliferus.'' Copeia, 1971, 365-370.
  • Meyer, E. (1996). ''Eine oliv-gelbe Variante von Dendrobates granuliferus aus dem zentral-pazifischen Tiefland Costa Ricas: erste Beobachtungen zur Fortpflanzungsbiologie. .'' Herpetofauna (Weinstadt), 18, 21-27.
  • Miller, J. R. B., and McFarlane, D. A. (2007). ''A preliminary investigation into Hayne estimates of poison dart frog (Anura: Dendrobatidae) densities in recovering tropical forest habitat in Costa Rica.'' Herpetological Conservation and Biology, 3(2), 289-294.
  • Myers, C. W., Daly, J.W., Garraffo, H.M., Wisnieski, A., and Cover, J.F., Jr. (1995). ''Discovery of the Costa Rican poison frog Dendrobates granuliferus in sympatry with Dendrobates pumilio, and comments on taxonomic use of skin alkaloids.'' , 14(3144), 1-21.
  • Rasotto, M. B., Cardellini, P., and Sala, M. (1987). ''Karyotypes of five species of Dendrobatidae (Anura: Amphibia).'' Herpetologica, 43(2), 177-182.
  • Summers, K. (2000). ''Mating and aggressive behaviour in dendrobatid frogs from Corcovado National Park, Costa Rica: a comparative study.'' Behavior, 137, 7-24.
  • van Wijngaarden, R., and van Gool, S. (1994). ''Site fidelity and territoriality in the dendrobatid frog Dendrobates granuliferus.'' Amphibia-Reptilia, 15, 171-181.
  • Brown J.L., Twomey E., Amézquita A., De Souza M.B., Caldwell J.P., Lötters S., Von May R., Melo-Sampaio P.R., Mejía-Vargas D., Perez-Peña P., Pepper M., Poelman E.H., Sanchez-Rodriguez M., and Summers K. (2011). ''A taxonomic revision of the Neotropical poison frog genus Ranitomeya (Amphibia: Dendrobatidae).'' Zootaxa, 3083, 1-120.
  • Ibañez, R., Solí­s, F., Jaramillo, C. and Rand, S. (2000). ''An overview of the herpetology of Panama.'' Mesoamerican Herpetology: Systematics, Zoogeography and Conservation. Johnson, J. D., Webb, R. G. and Flores-Villela, O. A., eds., The University of Texas at El Paso, El Paso, Texas, 159-170.
  • Bolaños, F. (1990). 1990): Actividad de Canto y Territorialidad en Dendrobates granuliferus Taylor 1958. Thesis. Universidad de Costa Rica, Sistema de Estudios de Posgrado, Ciudad Universitaria , Costa Rica.
  • Meyer, E. (1992). ''Erfolgreiche Nachzucht von Dendrobates granuliferus Taylor, 1958. Cría exitosa en cautividad de Dendrobates granuliferus Taylor, 1958.'' Herpetofauna, 14, 11-21.
  • Meyer, E. (1993). ''Fortpflanzung und Brutpflegeverhalten von Dendrobates granuliferus Taylor, 1958 aus Costa Rica (Amphibia: Dendrobatidae).'' Veröffentlichung - Naturhistorisches Museum Schleussingen Btholdsbrg, Schleusingen, 7/8, 113-142.
  • Meyer, E. (1996). Ã-kologie und Biogeographie des zentralamerikanischen Pfeilgiftfrosches Dendrobates granuliferus TAYLOR. Dissertation, University of Ulm, Ulm, Germany.
  • van Wijngaarden, R., and Bolaños, F. (1992). ''Parental care in Dendrobates granuliferus (Anura: Dendrobatidae), with a description of the tadpole.'' Journal of Herpetology, 26(1), 102-105.
  • Grant, T., Frost, D. R., Caldwell, J. P., Gagliardo, R., Haddad, C. F. B., Kok, P. J. R., Means, D. B., Noonan, B. P., Schargel, W. E., and Wheeler, W. C. (2006). ''Phylogenetic systematics of dart-poison frogs and their relatives (Amphibia: Athesphatanura: Dendrobatidae).'' Bulletin of the American Museum of Natural History, (299), 1-262.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is present in several protected areas, including Parque Nacional Corcovado.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Relation to Humans

Oophaga granulifera is captured for the pet trade, despite the toxicity of its skin (see Daly et al. 1978 and numerous other publications by Daly and Myers for toxins found in this species). Captive breeding of O. granulifera was accomplished for the first time in 1992 (Meyer 1992).

  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Silverstone, P. A. (1975). ''A revision of the poison-arrow frogs of the genus Dendrobates Wagler.'' Natural History Museum of Los Angeles County, Scientific Bulletin, 21, 1-55.
  • Santos, J. C., Coloma, L. A., Summers, K., Caldwell, J. P., Ree, R., and Cannatella, D. C. (2009). ''Amazonian amphibian diversity is primarily derived from late Miocene Andean lineages.'' PLoS Biology, 7(3), e1000056.
  • Crump, M. (1972). ''Territoriality and mating behavior in Dendrobates granuliferus (Anura: Dendrobatidae).'' Herpetologica, 28, 195-198.
  • Daly, J. W., Brown, G. B., and Mensah-Dwumah, M. (1978). ''Classification of skin alkaloids from neotropical poison-dart frogs (Dendrobatidae).'' Toxicon, 16, 163-188.
  • Goodman, D. (1971). ''Territorial behavior in a neotropical frog, Dendrobates granuliferus.'' Copeia, 1971, 365-370.
  • Meyer, E. (1996). ''Eine oliv-gelbe Variante von Dendrobates granuliferus aus dem zentral-pazifischen Tiefland Costa Ricas: erste Beobachtungen zur Fortpflanzungsbiologie. .'' Herpetofauna (Weinstadt), 18, 21-27.
  • Miller, J. R. B., and McFarlane, D. A. (2007). ''A preliminary investigation into Hayne estimates of poison dart frog (Anura: Dendrobatidae) densities in recovering tropical forest habitat in Costa Rica.'' Herpetological Conservation and Biology, 3(2), 289-294.
  • Myers, C. W., Daly, J.W., Garraffo, H.M., Wisnieski, A., and Cover, J.F., Jr. (1995). ''Discovery of the Costa Rican poison frog Dendrobates granuliferus in sympatry with Dendrobates pumilio, and comments on taxonomic use of skin alkaloids.'' , 14(3144), 1-21.
  • Rasotto, M. B., Cardellini, P., and Sala, M. (1987). ''Karyotypes of five species of Dendrobatidae (Anura: Amphibia).'' Herpetologica, 43(2), 177-182.
  • Summers, K. (2000). ''Mating and aggressive behaviour in dendrobatid frogs from Corcovado National Park, Costa Rica: a comparative study.'' Behavior, 137, 7-24.
  • van Wijngaarden, R., and van Gool, S. (1994). ''Site fidelity and territoriality in the dendrobatid frog Dendrobates granuliferus.'' Amphibia-Reptilia, 15, 171-181.
  • Brown J.L., Twomey E., Amézquita A., De Souza M.B., Caldwell J.P., Lötters S., Von May R., Melo-Sampaio P.R., Mejía-Vargas D., Perez-Peña P., Pepper M., Poelman E.H., Sanchez-Rodriguez M., and Summers K. (2011). ''A taxonomic revision of the Neotropical poison frog genus Ranitomeya (Amphibia: Dendrobatidae).'' Zootaxa, 3083, 1-120.
  • Ibañez, R., Solí­s, F., Jaramillo, C. and Rand, S. (2000). ''An overview of the herpetology of Panama.'' Mesoamerican Herpetology: Systematics, Zoogeography and Conservation. Johnson, J. D., Webb, R. G. and Flores-Villela, O. A., eds., The University of Texas at El Paso, El Paso, Texas, 159-170.
  • Bolaños, F. (1990). 1990): Actividad de Canto y Territorialidad en Dendrobates granuliferus Taylor 1958. Thesis. Universidad de Costa Rica, Sistema de Estudios de Posgrado, Ciudad Universitaria , Costa Rica.
  • Meyer, E. (1992). ''Erfolgreiche Nachzucht von Dendrobates granuliferus Taylor, 1958. Cría exitosa en cautividad de Dendrobates granuliferus Taylor, 1958.'' Herpetofauna, 14, 11-21.
  • Meyer, E. (1993). ''Fortpflanzung und Brutpflegeverhalten von Dendrobates granuliferus Taylor, 1958 aus Costa Rica (Amphibia: Dendrobatidae).'' Veröffentlichung - Naturhistorisches Museum Schleussingen Btholdsbrg, Schleusingen, 7/8, 113-142.
  • Meyer, E. (1996). Ã-kologie und Biogeographie des zentralamerikanischen Pfeilgiftfrosches Dendrobates granuliferus TAYLOR. Dissertation, University of Ulm, Ulm, Germany.
  • van Wijngaarden, R., and Bolaños, F. (1992). ''Parental care in Dendrobates granuliferus (Anura: Dendrobatidae), with a description of the tadpole.'' Journal of Herpetology, 26(1), 102-105.
  • Grant, T., Frost, D. R., Caldwell, J. P., Gagliardo, R., Haddad, C. F. B., Kok, P. J. R., Means, D. B., Noonan, B. P., Schargel, W. E., and Wheeler, W. C. (2006). ''Phylogenetic systematics of dart-poison frogs and their relatives (Amphibia: Athesphatanura: Dendrobatidae).'' Bulletin of the American Museum of Natural History, (299), 1-262.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Granular poison frog

The granular poison frog (Oophaga granulifera) is a species of frog in the family Dendrobatidae, found in Costa Rica and Panama.[1] Its natural habitats are subtropical or tropical, moist, lowland forests, but it is threatened by habitat loss.[1] This frog has been reclassified from Dendrobates granuliferus to Oophaga granulifera.

Description[edit]

The granular poison frog is a small frog with slender limbs growing to about 20 mm (0.8 in). Its skin is finely granulated and its colour is typically bright orange head, body and upper arms and bluish-green underparts, legs and lower arms. In the vicinity of Quepos, Costa Rica, there is a colour morph in which the orange colour is replaced with olive green.[2]

Distribution and habitat[edit]

The granular poison frog is native to Costa Rica and Panama. Its range extends from southwestern Costa Rica through the adjacent area of south-western Panama at heights of up to 100 m (328 ft) above sea level. It may also occur in south-eastern Costa Rica. It inhabits the leaf litter of the floor of humid low altitude forests.[1]

Behaviour[edit]

The granular poison frog is a diurnal terrestrial species. Breeding takes place in the rainy season and the female lays groups of three or four eggs in curled up dead leaves, under stones, in twig forks and in leaf axils just above the ground. The male guards the eggs and keeps them moist with his urine. When they hatch, the female carries the tadpoles singly to temporary water bodies such as hollows in trees, leaf axils of species such as Dieffenbachia and to bromeliads, at heights of a metre or two off the ground. The volume of water in these cavities averages 2.4 ml (0.084 imp fl oz; 0.081 US fl oz). The female feeds the tadpoles on an ongoing basis by laying unfertilised eggs in the water bodies.[2]

The frog is an aposematic animal, and it uses poison only for self-defense from predators. Its bright colors are used as a warning signal to all possible predators. Experimental studies in Costa Rica suggest the male granular poison frog spends the majority of its time and energy defending its calling site. These warning signals are more vocal (acoustic) than visual. If an encroaching male granular poison frog were to dare approach too closely, these frogs have no qualms about engaging physically. The lengths they will go to defend their territory epitomize their unique aggressive behavior.[3]

Status[edit]

The IUCN has listed this species as being "Vulnerable" because its range is relatively small, its numbers seem to be declining and it is threatened by destruction of its rainforest habitat.[1]

References[edit]

  1. ^ a b c d e Frank Solís, Roberto Ibáñez, Gerardo Chaves, Jay Savage, César Jaramillo, Querube Fuenmayor, Federico Bolaños (2008). "Oophaga granulifera". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved 2013-12-22. 
  2. ^ a b Kellie Whittaker and Ketti Augusztiny (2011-11-09). "Oophaga granulifera". AmphibiaWeb. Retrieved 2013-12-22. 
  3. ^ Amphibian rescue Information about the granular poison frog
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!