Overview
Distribution
Non-Arctic, temperate waters
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
FAO fishing area 67, North East Pacific, North West Atlantic
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
Institute of Ocean Science Zooplankton Database
http://www.marinespecies.org/copepoda/aphia.php?p=sourcedetails&id=150286
Trusted
Ecology
Habitat
Found in inshore and coastal areas.
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): 200 - 200
Temperature range (°C): 4.095 - 4.095
Nitrate (umol/L): 31.975 - 31.975
Salinity (PPS): 33.803 - 33.803
Oxygen (ml/l): 3.309 - 3.309
Phosphate (umol/l): 2.372 - 2.372
Silicate (umol/l): 65.871 - 65.871
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): 200 - 200
Temperature range (°C): 4.095 - 4.095
Nitrate (umol/L): 31.975 - 31.975
Salinity (PPS): 33.803 - 33.803
Oxygen (ml/l): 3.309 - 3.309
Phosphate (umol/l): 2.372 - 2.372
Silicate (umol/l): 65.871 - 65.871
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Pseudocalanus moultoni
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TTAATAGCTGGGGCATGGGCAGGTATGATTGGTACAGGCTTAAGAATAATTATTCGAATAGAATTGGGTCAGGCTGGATCACTAATCGGGGAT---GACCAAATTTATAATGTAGTTGTTACTGCGCATGCGTTTATCATAATTTTTTTTATAGTTATACCAATTTTAATTGGAGGTTTTGGTAATTGACTAGTCCCCCTTATATTAGGGGCAGCAGATATAGCCTTTCCTCGTATAAATAACATAAGATTTTGATTTTTAATGCCAGCCTTGATCATGTTACTTTCAAGATCCTTAGTTGAGAGAGGAGCTGGGACGGGGTGGACAGTTTATCCTCCACTATCAAGAAATATCGCGCATGCAGGAGGTTCTGTTGACTTTGCTATTTTTTCACTACATTTGGCTGGTGTGAGATCTATTTTAGGCGCTGTAAATTTTATTAGTACTCTAGGGAATTTACGAGTATTTGGAATACTTTTAGATCAAATACCATTGTTTGCATGATCTGTCTTGGTGACAGCTGTTTTACTATTATTATCTTTACCAGTGTTAGCTGGTGCAATTACAATATTGTTAACAGACCGTAACTTAAACACTTCTTTTTATGAT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Pseudocalanus moultoni
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
