Overview

Distribution

Non-Arctic, temperate waters
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Found in inshore and coastal areas.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 200 - 200
  Temperature range (°C): 4.095 - 4.095
  Nitrate (umol/L): 31.975 - 31.975
  Salinity (PPS): 33.803 - 33.803
  Oxygen (ml/l): 3.309 - 3.309
  Phosphate (umol/l): 2.372 - 2.372
  Silicate (umol/l): 65.871 - 65.871
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudocalanus moultoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTAATAGCTGGGGCATGGGCAGGTATGATTGGTACAGGCTTAAGAATAATTATTCGAATAGAATTGGGTCAGGCTGGATCACTAATCGGGGAT---GACCAAATTTATAATGTAGTTGTTACTGCGCATGCGTTTATCATAATTTTTTTTATAGTTATACCAATTTTAATTGGAGGTTTTGGTAATTGACTAGTCCCCCTTATATTAGGGGCAGCAGATATAGCCTTTCCTCGTATAAATAACATAAGATTTTGATTTTTAATGCCAGCCTTGATCATGTTACTTTCAAGATCCTTAGTTGAGAGAGGAGCTGGGACGGGGTGGACAGTTTATCCTCCACTATCAAGAAATATCGCGCATGCAGGAGGTTCTGTTGACTTTGCTATTTTTTCACTACATTTGGCTGGTGTGAGATCTATTTTAGGCGCTGTAAATTTTATTAGTACTCTAGGGAATTTACGAGTATTTGGAATACTTTTAGATCAAATACCATTGTTTGCATGATCTGTCTTGGTGACAGCTGTTTTACTATTATTATCTTTACCAGTGTTAGCTGGTGCAATTACAATATTGTTAACAGACCGTAACTTAAACACTTCTTTTTATGAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pseudocalanus moultoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!