Overview
Distribution
Antarctic Ocean, Argentine Basin, Brazil Basin, Chile, Indian Ocean, Subantarctic Waters, Tasman Sea
Trusted
Ecology
Habitat
Depth range based on 247 specimens in 1 taxon.
Water temperature and chemistry ranges based on 241 samples.
Environmental ranges
Depth range (m): 0 - 3660
Temperature range (°C): -1.862 - 3.556
Nitrate (umol/L): 22.800 - 35.169
Salinity (PPS): 33.643 - 34.729
Oxygen (ml/l): 4.109 - 8.084
Phosphate (umol/l): 1.189 - 2.480
Silicate (umol/l): 21.227 - 130.007
Graphical representation
Depth range (m): 0 - 3660
Temperature range (°C): -1.862 - 3.556
Nitrate (umol/L): 22.800 - 35.169
Salinity (PPS): 33.643 - 34.729
Oxygen (ml/l): 4.109 - 8.084
Phosphate (umol/l): 1.189 - 2.480
Silicate (umol/l): 21.227 - 130.007
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 241 samples.
Environmental ranges
Depth range (m): 0 - 3660
Temperature range (°C): -1.862 - 3.556
Nitrate (umol/L): 22.800 - 35.169
Salinity (PPS): 33.643 - 34.729
Oxygen (ml/l): 4.109 - 8.084
Phosphate (umol/l): 1.189 - 2.480
Silicate (umol/l): 21.227 - 130.007
Graphical representation
Depth range (m): 0 - 3660
Temperature range (°C): -1.862 - 3.556
Nitrate (umol/L): 22.800 - 35.169
Salinity (PPS): 33.643 - 34.729
Oxygen (ml/l): 4.109 - 8.084
Phosphate (umol/l): 1.189 - 2.480
Silicate (umol/l): 21.227 - 130.007
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Paraeuchaeta antarctica
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
ATAGCAGGTGCTTGATCAGGTATAGTAGGTACAGGATTAAGAATAATTATTCGGTTAGAGTTGGGCCAAGCAGGTTCTTTAATTGGGGAT---GATCAGATTTATAATGTTATTGTAACGGCACACGCTTTTATTATAATTTTTTTTATAGTTATGCCTATTCTTATTGGAGGGTTTGGTAATTGATTGGTACCTCTAATGTTAGGAGCAGCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTTTTGATACCAGCATTAATTATACTCCTGTCTAGGTCTTTAGTGGAGAGGGGGGCTGGGACAGGCTGAACAGTCTATCCTCCGCTGTCTAGTAATATTGCTCATTCTGGGGGTTCTGTAGATTTTGCTATTTTTTCTCTTCATTTAGCAGGGGTTAGGTCTATTTTAGGGGCTGTGAATTTTATTAGTACTTTAGGAAATCTTCGAGTGTTTGGTATATTGTTAGATCGTGTCCCATTATTCGCGTGATCTGTATTAATCACTGCAGTACTTTTACTGTTGTCTTTGCCTGTGCTAGCTGGGGCAATTACTATACTATTAACAGATCGTAATTTAAATACAACTTTTTATGAT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Paraeuchaeta antarctica
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
