Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Physical Description

Type Information

Type for Andrena sigmundi Cockerell, 1902
Catalog Number: USNM 533731
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female;
Preparation: Pinned
Locality: Milwaukee, Wis., Wisconsin, United States
  • Type: 1902. Canadian Entomologist. 34: 45.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Andrena sigmundi in Illinois

Andrena sigmundi Cockerell: Andrenidae (Andreninae), Hymenoptera
(observations are from Graenicher, Krombein et al., and Barrett & Helenurm; according to Krombein et al., this insect is an oligolege of Salix spp.)

Asteraceae: Antennaria neglecta [unsp] (Gr), Taraxacum officinale (Kr); Brassicaceae: Barbarea vulgaris (Kr); Cornaceae: Cornus canadensis (BH); Ericaceae: Vaccinium angustifolium (Kr); Fabaceae: Melilotus alba (Kr); Liliaceae: Smilacina stellata (Gr); Rosaceae: Amelanchier laevis (Kr), Fragaria virginiana (Kr), Prunus virginiana (Kr), Waldsteinia fragarioides (Kr); Salicaceae: Salix bebbiana [stam cp] olg (Kr), Salix discolor [stam cp] olg (Kr)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Andrena sigmundi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATACTATACTTTATCTTCGCAATATGAGCAGGAATAATAGGAGCCTCACTAAGATTCATTATTCGAATAGAATTGAGAAATCCAGGCAGATGAATCAATAATGATCAAATCTATAATTCAATCGTAACATCCCACGCTTTCATTATAATTTTCTTCATAGTAATACCATTCATAATCGGAGGTTTCGGAAACTGACTCACACCGTTAATATTAGGAGCGCCCGACATGGCTTTCCCGCGAATAAACAATATAAGTTTCTGACTACTCCCCCCATCAATTTTAATTATTTTATTTAGAATAATTTTAAATTCAGGATCAGGTACAGGATGAACAGTATACCCCCCCTTATCATCATACTCATACCACCCATCATCATCAGTTGATTTAACAATTTTTTCATTACATATTGCAGGTGTATCATCAATCATAGGAGCAATTAATTTTATTGTAACAATTCTTAGTATAAAAAATATTTCAATAAACTATGATCAACTCCCACTATTCCCATGATCAGTATTTATTACCACAATTCTATTATTAATCTCTCTACCAGTTTTAGCCGGAGCCATCACAATATTACTATCAGACCGTAACTTAAATTCATCATTCTTTGACCCAATAGGAGGAGGAGATCCAATTCTATATCAACATCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Andrena sigmundi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!