Overview

Distribution

Range Description

This species is known from the Iquitos and Yurimaguas Region, Loreto, northeastern Perú, and from two sites in Ecuador. A lowland species found below 200 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This diurnal frog occurs in primary and secondary lowland tropical rainforest; it is mostly terrestrial but also climbs tree trunks (Rodríguez and Duellman, 1994). It breeds in phytotelms, and may be found in mature secondary forest.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ranitomeya reticulata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACCCTATACTTAGTCTTTGGGGCCTGGGCCGGAATGGTCGGTACAGCCCTCAGTCTACTAATTCGAGCTGAATTGAGCCAGCCTGGGGCACTCCTCGGAGAC---GACCAAATCTACAACGTTATCGTAACTGCCCACGCCTTTGTTATGATTTTTTTTATAGTTATACCAATTTTGATCGGCGGGTTCGGCAACTGGCTGGTCCCTTTAATGATTGGGGCCCCCGATATGGCTTTTCCCCGAATAAACAATATGAGCTTCTGACTTCTCCCCCCTTCATTTCTTCTTCTCTTAGCCTCAGCCGGAGTAGAAGCAGGGGCTGGAACAGGTTGAACCGTGTACCCCCCTCTTGCAGGCAATTTAGCTCATGCTGGCCCCTCAGTCGACCTTACCGTCTTTTCCCTCCATCTAGCCGGGATTTCCTCTATTCTAGGCGCAATTAACTTCATTACCACTACCCTTAACATGAAGCCTCCCTCTCTGACTCAGTACCAGACCCCATTATTCGTCTGATCAGTCTTAATTACAGCTGTCCTGCTTCTTCTTTCTCTACCAGTCCTAGCTGCAGGAATCACAATACTCCTAACCGACCGAAACCTAAACACCACCTTCTTTGACCCAGCCGGAGGGGGAGACCCAGTCCTTTACCAACATCTTTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ranitomeya reticulata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Javier Icochea, Luis A. Coloma, Santiago Ron, Karl-Heinz Jungfer, Ariadne Angulo, Diego Cisneros-Heredia

Reviewer/s
Stuart, S.N., Chanson, J.S., Cox, N.A. & Young, B.E.(Global Amphibian Assessment Coordinating Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is locally abundant in Peru, rare in Ecuador.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Currently there are no major threats; it is a widespread species with large areas of suitable habitat remaining. Illegal trade in this species has been observed (from 1987 to 1995), possibly caused through confusion of this species with a legally exportable species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is present in Alpahuayo Mishana Reserve (Peru). In Peru there is National legislation to treat as "Situación Indeterminada" (Decreto Supremo N° 013-99-AG, May-19-1999). This species should remain listed on CITES to prevent unsustainable trade. It is illegal to export the species from either Ecuador or Peru.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-backed poison frog

The Red-backed Poison Frog (Ranitomeya reticulata)[1] is a species of frog in the family Dendrobatidae. It is an arboreal insectivorous species, and is the second-most poisonous species in the genus, after R. variabilis. Like many species of small, poisonous frogs native to South America, it is grouped with the poison dart frogs, and is a moderately toxic species, containing poison capable of causing serious injury to humans, and death in animals such as chickens. R. reticulata is native to Peru and Ecuador.[1]

Poison[edit]

The red-backed poison frog is a moderately toxic dendrobatid, and is the second-most poisonous of the frogs in the Ranitomeya genus. Its toxins are used as the frog's natural defense mechanisms, making them inedible to many, if not most, of the predators in its natural area. To advertise its poison and further reduce the risk of injury, the red-backed poison frog displays its brilliant warning colors, especially its red-orange back, for which it is named. Like all dendrobatids, it does not manufacture its poison itself, but rather is theorized to take the toxins from the ants, mites, and beetles on which it lives. It absorbs the insects' poisons into its body, which is immune to the poison. The poison is stored in skin glands just beneath the frog's epidermis. The poison seeps through open wounds and orifices, and, it is believed, through the pores. This defense is especially effective against mammalian and avian predators, and, to a lesser extent, reptilian ones. Amazonian ground snakes have a limited resistance to the poison, and occasionally will attack such frogs.

Description[edit]

R. reticulata climbing a tree.

Ranitomeya reticulata is one of the smaller species of poison dart frogs, hence its inclusion in the "thumbnail" species group. Males can reach approximately 12 mm in length from snout to vent, while the larger females may reach 15 or even 20 mm long. Like all poison dart frogs, R. reticulata are vividly coloured and patterned, which advertises their poison. Red-backed poison dart frogs have black legs with a cobalt or sky-blue mesh pattern, a black belly, and a back that ranges from fiery orange to scarlet in color, hence the common name. Like all arboreal frogs, R. reticulata possess suckerlike disks on their toes which makes their grip adhesive. As they are very small, they often attempt to advertise their poison by flaunting such colors or by ascending trees to escape from predators. If isolated from any form of escape, R. reticulata will use their poison as a defense mechanism. R. reticulata are more slimly built than many dendrobatids, which combined with their small size, gives them the ability to squeeze into minute hiding places.

Reproduction[edit]

R. reticulata naturally live in groups of five or six. At the end of the wet season, several of these groups join in large breeding gatherings. As with other poison dart frogs, the males court the females by calling to capture their attention, and then by gently stroking and licking them. A female will signal that she is sufficiently impressed by stamping her hind feet. The two frogs will then mate.

R. reticulata

The fact that the breeding season begins at the end of the wet season ensures that the eggs will be laid at the beginning of the next wet season, ensuring that the young will have a steady supply of water to keep them alive. Once the eggs hatch, the male carries the baby tadpoles into the canopy. The tadpoles have a water-soluble adhesive mucus that helps them stick to their father's back. The male R. reticulata will deposit the tadpoles into the tiny pools that accumulate in the centre of bromeliads. The female will then feed the tadpoles with infertile eggs that she lays into the water. Once the tadpoles become froglets, they are led by their parents to an existing group of red-backed poison frogs. While the young froglets are accepted by all members of the group, only their parents will look after the young frogs.

As pets[edit]

R. reticulata is considered a species for advanced dart hobbyists only. Their small size, breeding difficulties, and generally difficult care relative to other darts shows through high mortality rates with novice keepers. These difficulties are also the reason that the frog is fairly uncommon in the dart frog hobby and command a price upwards of $125–150 U.S. dollars per frog. It is also recommended to only keep them in pairs unless the tank size is substantial (55 gallons or larger), as there are many witness accounts and anecdotal reports of heavy same-sex aggression in smaller enclosures.

See also[edit]

References[edit]

  1. ^ a b Icochea, J., et al. 2004. Ranitomeya reticulata. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 31 May 2013.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!