Overview

Brief Summary

Chelobasis bicolor

Oblong-elongate; pronotal and elytral markings extremely variable. Head: frontal horn narrows to apex,  apex rounded or truncate; depressed between eyes; vertex and frons impunctate; clypeus micropunctate.  Antennae: antennomere 1 robust, thickened, with projection on inner apical margin, flattened ventrally,  projection reaches to near apex of 2; 2 cylindrical, short, 1/2 length of 3; 3 cylindrical, longest, as long as 1 and  2 combined; 4-7 each subequal in length; 8-10 transverse, wider and shorter than preceding; 11 rounded at  apex; 1-10 with scattered setae, 11 setose. Pronotum: transverse; lateral margin sinuate; anterior angle  rounded; posterior angle acute, with large punctures; slightly depressed at base; pronotal length 1.7-2.1 mm (n=20); pronotal width 2.9-3.4 mm. Scutellum: elongate triangle; alutaceous. Elytron: oblong, parallel;  apices cojointly rounded; punctate striate; lateral and apical margins smooth; humerus rounded, not produced;  punctures moderately impressed; rows tend to coalesce at apex; elytral length 7.0-9.1 mm; elytral width 4.3-  4.4 mm. Venter: pro- and mesocoxae large, globular; prosternal process acute at apex, expanded behind  procoxae. Leg: tibia broadly expanded at apex; pro- and mesotibiae toothed along apical margin; metatibia  with row of stiff setae on apical margin; femur sparsely punctate. Total length: 10.1-11.3 mm.  Larva. (from Maulik 1931). Total length 9–13.5 mm. Total width 5.5–7.0 mm. Body flat, upper surface  somewhat convex longitudinally; sides expanded into interlacing flaps which have a fringe of fine setae;  ovoid. Head: covered from above by two overlapping expansions; epicranial lobes bifurcate; antennae well  developed, three segmented; mandible tridentate; maxillary palps with two segments; labial palps with one  segment; four ocelli placed near outer margin of each antenna; legs widely separated; spiracles visible from  above, spiracle 8 larger than others.

Larval host plant. Wild banana; Heliconia sp. (Heliconiaceae); Musa sp. (Musaceae). Adults have been collected on Heliconia sp., Heliconia curtispatha Peterson, Heliconia imbricata (Kuntze)  Baker, Heliconia irrasa R.R. Sm., Heliconia latispatha Benth.,Heliconia metallica Planch. & Linden, Heliconia platystachys Baker, Heliconia  tortuosa Griggs, Heliconia vaginalis Benth., and Heliconia wagneriana Peterson, Heliconia cathaeta  R. R. Sm., Calathea latifolia Klotzsch, (Marantaceae).

  • Staines CL (2009) A review of the genus Chelobasis Gray, 1832 (Coleoptera: Chrysomelidae: Cassidinae). Zootaxa 2033: 58–68.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Charles L. Staines

Supplier: Carlos Garcia-Robledo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chelobasis bicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCACCATCAATTTTCTTCCTTCTAATAAGAAGAATAATCGAAAGAGGAGCAGGAACAGGATGAACGGTTTATCCCCCTCTATCGTCAAACATCGCCCATAGAGGCGCATCCGTCGATCTAACTATTTTCAGGCTCCATCTAGCAGGAATCTCATCAATTCTCGGAGCAATTAACTTTATTTCCACAATTATAAATATACGACCCCAAGGAATAAATATAGAAAAATCAACCTTATTTTCCTGAGCAGTATTAATTACCGCAATTTTACTACTCTTATCACTACCAGTTCTAGCAGGTGCAATCACTATACTTTTAACAGACCGTAATTTAAACACCTCCTTCTTCGACCCCGCGGGGGGGGGAGACCCAATTCTCTATCAACATTTATTTTGATTTTTTGGACACCCTGAAGTTTACATTCTAATTTTACCAGGCTTCGGAATAATCTCCCATATCATTGGTCAAGAGAGAGGAAAAAAAGAAACTTTTGGAGTACTAGGTATAATTTACGCAATAATAGCAATTGGAATTCTAGGATTTGTAGTATGGGCCCATCACATATTTACTGTAGGAATGGACGTTGATACCCGGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chelobasis bicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!