Overview

Distribution

Range Description

Panama to Peru, Bolivia, northern Argentina, Paraguay, Brazil, French Guiana, Surinam, Venezuela, and Guyana (Simmons 2005). Distribution expanded to include Espirito Santo in Brazil (Reis et al. 2006). Excluded from dry chaco in Paraguay (Barquez et al. 1999; Lopez 2004)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Most capures in forests and rivers (Barquez pers. comm).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cynomops planirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACTTTATACCTTCTATTCGGTGCTTGAGCAGGAATAGTAGGAACCGCCCTAAGTCTTCTTATCCGGGCTGAATTAGGTCAACCAGGAGCTCTTTTAGGAGATGACCAAATCTACAACGTAGTTGTCACCGCCCATGCCTTTGTAATAATTTTCTTCATAGTTATGCCCATTATAATTGGAGGCTTTGGAAATTGACTAGTACCCCTAATAATTGGTGCCCCAGATATAGCATTTCCACGAATAAATAATATGAGCTTTTGACTCCTTCCCCCCTCATTCCTACTTCTCCTCGCCTCCTCAATAGTTGAAGCCGGAGCTGGGACAGGTTGAACAGTCTACCCCCCTTTAGCTGGTAACTTAGCCCATGCAGGAGCTTCTGTTGATCTAACTATTTTCTCCTTACACTTAGCAGGAGTCTCATCAATCCTAGGAGCTATTAACTTTATTACTACTATTATCAACATAAAACCACCAGCCCTTTCCCAATATCAAACACCTTTATTTGTATGATCCGTACTAATTACAGCTGTACTACTGTTACTTTCTTTACCAGTTTTAGCAGCAGGAATTACAATATTATTAACAGACCGAAACCTAAACACTACTTTTTTCGATCCTGCCGGAGGAGGAGACCCTATCTTATATCAACATCTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cynomops planirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Barquez, R. & Diaz, M.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no information on population.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Research actions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Southern dog-faced bat

The southern dog-faced bat (Cynomops planirostris), is a Central and South American bat species of the family Molossidae.[2][3][4] It is found in northern Argentina, Bolivia, Brazil, Colombia, French Guiana, Guyana, Panama, Peru, Paraguay, Suriname and Venezuela.[1]

References

  1. ^ a b Barquez, R. & Diaz, M. (2008). "Cynomops planirostris". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 22 July 2012. 
  2. ^ Simmons, N. B. (2005). "Order Chiroptera". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 437. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ http://www.natureserve.org/infonatura/
  4. ^ http://www.discoverlife.org/mp/20q?search=Molossops+planirostris
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!