Articles on this page are available in 1 other language: Chinese (Simplified) (2) (learn more)

Overview

Comprehensive Description

Summary

"
Habit

Colonial

Habitat

Spaces behind the old wooden boxes on wall, crevice in rocks

Niche

Crevices in temples, caves, deserted buildings. Up to 923m.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This very widely distributed species is found throughout much of South Asia, southern and central China, most of mainland Southeast Asia, and much of insular Southeast Asia. In South Asia, this species is very widely distributed and is presently known from India (Andhra Pradesh, Goa, Karnataka, Madhya Pradesh, Maharashtra, Meghalaya, Punjab, Rajasthan, Tamil Nadu, Uttar Pradesh and West Bengal) and Sri Lanka (Central and Western Provinces) (Molur et al. 2002). It has been recorded from sea level to an elevation of 950 m asl. The species is likely to be found in Bangladesh (Srinivasulu and Srinivasulu 2005). In China it has been recorded from Gansu, Yunnan, Hainan, Guangxi, Guangdong, Hong Kong, and Guizhou (Smith and Xie 2008). It is present in Myanmar, Thailand, western Cambodia and Peninsular Malaysia in mainland Southeast Asia. Within insular Southeast Asia it is wide ranging, and is found on the islands of Sumatra, Java, Bali and Lombok (all to Indonesia), Borneo (Brunei, Indonesia and Malaysia), and the Philippines. In the Philippines there are records from Leyte, Luzon (Cagayan, Isabela, Pampanga, and Rizal provinces), Mindanao (Cotabato) (Taylor 1934), Cebu and Negros (Heaney et al. 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"
Global distribution

India, Myanmar, Sri Lanka

Known presence in Protected Areas

None

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Colonial
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species can form large colonies of thousands of bats that typically roost in caves, but can also be found in crevices in rocks, old disused buildings and temples. Populations generally forage close to roost sites, and have been recorded hunting in forested areas and over rice fields. It is a high and fast flyer that feeds on insects and other invertebrates.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Habitat

"
Habitat

Spaces behind the old wooden boxes on wall, crevice in rocks

Niche

Crevices in temples, caves, deserted buildings. Up to 923m.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaerephon plicatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTCTATACCTCCTATTCGGCGCTTGAGCAGGAATAGTAGGAACCGCCCTAAGTCTTCTTATCCGAGCTGAATTAGGTCAGCCAGGAGCTCTCTTAGGAGACGATCAAATCTACAATGTAATTGTCACCGCCCATGCTTTCGTAATAATTTTCTTCATAGTAATACCCATTATAATTGGAGGCTTCGGAAATTGACTAGTCCCACTGATAATTGGTGCCCCCGATATAGCTTTCCCACGAATAAATAATATAAGCTTCTGACTCCTCCCTCCATCTTTCTTATTACTACTGGCCTCTTCCATAGTTGAGGCCGGGGCTGGAACAGGCTGAACAGTCTATCCTCCTTTAGCTGGAAATCTCGCCCATGCAGGAGCTTCCGTTGATTTAACCATCTTTTCACTACATCTAGCAGGTGTCTCTTCTATTCTAGGTGCTATCAATTTTATTACTACTATTATTAACATAAAACCACCAGCCCTCTCACAATACCAGACACCATTATTTGTATGATCTGTACTAATTACAGCTGTACTGCTCTTACTATCTCTACCAGTTTTAGCAGCTGGTATTACAATACTATTAACAGATCGAAATCTAAACACCACCTTCTTTGACCCTGCCGGAGGAGGAGACCCTATCCTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaerephon plicatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Csorba, G., Bumrungsri, S., Francis, C., Bates, P., Ong, P., Gumal, M., Kingston, T., Heaney, L., Balete, D., Molur, S. & Srinivasulu, C.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Cox, N. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern because of its wide distribution, large population, occurrence in a number of protected areas, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is a widespread but localized species which occurs in large colonies usually in caves. In South Asia, this species is widespread in its range in India, but is found in few locations. The Sri Lankan population is stable (W. Yapa pers. comm.) (Molur et al. 2002). In China, colonies ranging from a few hundred to more than 200,000 have been reported (Smith and Xie 2008). In Peninsula Malaysia the species is common and widespread although there are very few recent records. The total population in Thailand is around eight million, with a single population of over two million individuals (S. Bumrungsri pers. comm. 2006); it is a very abundant species in Myanmar (P. Bates pers. comm. 2006).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stable in the past. Future trends not known.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
In South Asia, the habitat of this species is being deforested for timber, firewood and conversion to agricultural use. It is also threatened due to extraction and mining activities (Molur et al. 2002). In mainland Southeast Asia, a colony of 300,000 bats was destroyed in northern Myanmar as a result of limestone extraction for cement manufacture (P. Bates pers. comm.), and a colony of hundreds of thousands of bats was eradicated as pests in Phnom Pehn, Cambodia (P. Bates pers. comm. 2006). In the Philippines, this was formerly among the most abundant bats in some large caves. However, virtually all of the known large colonies have now been extirpated, including the loss of a very large colony from Leyte in 1984 (L. Heaney pers. comm. 2006). The remaining population is probably declining due to forest loss, disturbance in caves (guano mining, hunting), and tourism (Heaney et al., 1998). The only recent reports since 1980 are from northern Luzon (Danielsen et al. 1994; Heaney et al. 1998), and two recent records from Cebu (L. Heaney pers. comm. 2006). It parts of its range, such as Lao PDR and Borneo, overharvesting of this species for food is leading to significant population declines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Habitat loss, mining. The influence on the population well understood, not reversible and have not ceased to be a threat."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In South Asia, there are no direct conservation measures in place for this species and it has not been recorded from any protected areas in South Asia. Protection of key roost sites, surveys and habitat management are urgently recommended along with public awareness (Molur et al. 2002). In Southeast Asia, while many large colonies are protected in countries such as Myanmar and Thailand by villagers and monks (P. Bates and S. Bumrungsri pers. comm. 2006), and the species has been recorded from a number of protected areas, there is a need to protect key roosting sites and to undertake population surveys in areas of previous decline (eg. Philippines).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Risk Statement

"
Habitat status

Stable in area

Data quality

Field study, literature; Observed, inferred.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Wrinkle-lipped free-tailed bat

The wrinkle-lipped free-tailed bat (Chaerephon plicata) is a species of bat in the family Molossidae. It is found in Bangladesh, Bhutan, Cambodia, China, Cocos (Keeling) Islands, India, Indonesia, Laos, Malaysia, Myanmar, Nepal, the Philippines, Sri Lanka, Thailand, and Vietnam.

See also[edit source | edit]

References[edit source | edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!