Articles on this page are available in 1 other language: Chinese (Simplified) (5) (learn more)

Overview

Comprehensive Description

Description

European free-tailed bat is a large strong bat. Fur on the upperparts of the body dense, soft, plush-like, long on neck, and paler on the underparts. Hairs extend onto wings and base of flight membrane. Ears large, rounded and broad. The inner sides of ear directed downwards, close to each other but tips disconnected. Wings very long, narrow, but not broad, vary in color from grayish-brown to black. Face distinctive with long, wrinkled muzzle. Upper lip with vertical fissures interspersed with short hairs. Tragus square with rounded angles and large antitragus. Feet strong, as long as half the tibia length. Tail long and extends beyond the flight membrane.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

It is mainly a Palaearctic species, although the south-eastern edge of its range extends into the Indomalayan region. It is well known in the Mediterranean basin, occuring from Portugal, Spain eastwards through southern Europe to the Balkans, Turkey, Israel, Palestine and Jordan. In North Africa it has been recorded from Morocco, Algeria, Tunisa, Libya and Egypt. It is possibly present on Madeira (to Portugal) as there was a supposed old record, but it has not been recorded from there again. It occurs on all the Canary Islands (to Spain) except for Fuerteventura and Lanzarote. It is also recorded from a number of Mediterranean islands (Hutson 1999, Simmons 2005).

Populations in Japan, Taiwan and Korea are now considered to be a separate species, T. insignis (Simmons 2005). It occurs from sea level to 3,100 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution in Egypt

Narrow (Cairo and Sinai).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Body length 122–139 mm, forearm 54.7–69.9 mm, 5th digit 55-59 mm, 3rd digit 102-115 mm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It usually forages at 10 to 50 m above the ground over temperate to semi-desert habitats, although it also occurs in humid habitats in some areas (e.g., Turkey: A. Altiparmak pers. comm. 2005). It feeds on aerial drifts of insects including moths and neuropterans. Summer and winter roosts: fissures and hollows in rock outcrops, quarries and cliffs. Common in some urban areas, roosts also in artificial structures including bridges and buildings. In North Africa it prefers rocky habitats and is not found in caves. The species is probably sedentary in Europe (Hutterer et al. 2005), although it may be a partial migrant in North Africa (GMA Africa Workshop 2004).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The European free-tailed bat prefers open habitats like grassland and rocky places, especially limestone. It roosts colonially in narrow gaps between rocks in winter where temperature is ca. 10°C and artificial structures such as bridges and old buildings.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Nocturnal bat. Insectivorous, feeding on moths. Lives in colonies of around 50 individuals. Flying high and fast, more than 30 km. The European free-tailed bat uses echolocation (at a quasi- constant-frequency calls with an end-frequency 9 to14 kHz) by emitting ultrasound from nose-leaf to detect prey. The breeding season of the European free-tailed bat takes place in January and female gives birth to a single young each year in June after a gestation period of six to seven weeks and reaches sexual maturity after one year.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 13 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tadarida teniotis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATACCTTCTATTTGGTGCCTGAGCAGGGATAGTAGGAACCGCCTTAAGTCTTCTCATTCGAGCCGAACTAGGTCAGCCAGGGGCTCTCTTAGGAGATGACCAGATCTATAACGTAATTGTTACAGCCCATGCTTTCGTAATAATTTTCTTCATAGTAATACCAATTATAATTGGAGGTTTCGGAAACTGACTAGTTCCACTAATAATTGGTGCCCCAGACATAGCCTTTCCACGAATAAACAACATAAGCTTTTGACTCCTTCCTCCCTCTTTCCTACTTCTACTAGCATCCTCTATAGTTGAAGCCGGGGCTGGGACCGGATGAACCGTTTATCCTCCTTTAGCCGGAAACTTAGCCCACGCAGGAGCTTCAGTTGACCTGACCATTTTCTCTCTGCACTTAGCAGGTGTTTCCTCAATCCTTGGTGCCATTAATTTTATTACTACTATTATTAATATGAAACCTCCCGCTCTCTCTCAATACCAAACACCCTTGTTTGTGTGATCGGTCTTAATCACAGCTGTATTACTCCTGTTATCACTACCAGTCCTAGCAGCCGGAATCACGATACTATTAACAGACCGAAACCTAAATACTACTTTCTTTGACCCTGCTGGAGGGGGAGACCCTATCTTATATCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tadarida teniotis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aulagnier, S., Paunovic, M., Karataş, A., Palmeirim, J., Hutson, A.M., Spitzenberger, F., Juste, J. & Benda, P.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
The species is widely distributed over a large extent of occurrence. let occurs in urban areas and forages in other modified habitats. Population trends are not known, but are not believed to approach the threshold for the population decline criterion of the IUCN Red List. Consequently it is assessed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is a common species in suitable habitats. Summer and winter colonies typically number 5-100 individuals, although colonies of up to 300-400 animals have been recorded. It is probably sedentary, although seasonal in some areas (e.g., Malta). It is not abundant in the Caucasus, nor is it highly gregarious - large colonies are not known in this region (K. Tsytsulina pers. comm. 2005) There are only six records for Iran, however, there have not been extensive survey efforts there (M. Sharifi pers. comm. 2005).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It is negatively affected by disturbance and loss of roosts in buildings, and by use of pesticides. It is also potentially threatened by wind farms (GMA Europe Workshop 2006), and deforestation affects the species in some parts of its range (Z. Amr pers. comm. 2005). However, none of these are considered to be major threats at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is protected by national legislation in a number of range states, and receives international legal protection through the Bonn Convention (Appendix II and Eurobats Agreement) and Bern Convention in parts of its range where these apply. It occurs in a number of protected areas across its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

European free-tailed bat

The European free-tailed bat. (Tadarida teniotis, sometimes given as Tadarida insignis) is a species of free-tailed bat found in the Old World.[2] Other common names include the bulldog bat and the mastiff bat because of the presence of wrinkling on the snout. This bat is found in the Mediterranean region of Europe and in scattered locations across Asia at altitudes from sea level to 3100 m.[1] It was reported from Korea in 1931, but has not been sighted on the Korean Peninsula since that time. Populations in Japan, Taiwan and Korea are now considered to be a separate species Tadarida insignis.[1]

Description[edit]

The European free-tailed bat has large, broad ears, each with a very small tragus, a backward-pointing projection which helps direct sound into the ear. Its muzzle has wrinkled lips, which gives its face a similarity to a dog's face and is the origin for its common names of bulldog or mastiff bat. Its tail is fleshy and robust, and the rear third is not connected to any membranes. Its fur is short and even, the dorsal (upper) surface is greyish-black, with a brownish shine, while the ventral (under) surface is paler. Its ears, wing and tail membranes are black and it has an unpleasant smell. This bat's head and body length is about 3.5 inches (89 mm), its tail about 2 inches (51 mm) and its weight from 1 to 2 ounces (28 to 57 g).[3]

Behaviour[edit]

The European free-tailed bat roosts by day in crevices in cliffs, in rocky gorges, under overhangs, in holes in tall buildings, under roof tiles or under stone bridges. It emerges at dusk and flies at a great height with a swift direct flight, not exhibiting the sudden twists and turns shown by many other bat species. It feeds on insects caught in flight and seldom needs to drink. When it does drink, it scoops up water from a pond or river while flying low over the surface. Before leaving the roost it makes a rattling sound and it often emits a characteristic "tsick-tsick" in flight, enabling it to be recognised by sound.[3]

European free-tailed bats generally live solitary lives but small groups of females come together to breed. The gestation period is about eighty days and a single youngster is born in some dark, concealed location. The juvenile opens its eyes when about a week old, can fly by four weeks and is independent by seven weeks. It matures at a year old and the lifespan is about ten years.[3]

Status[edit]

The European free-tailed bat is included by the IUCN in its Red List of Threatened Species as being of "Least Concern". The threats it faces include the use of pesticides, deforestation, the loss of roosts in some buildings and possible injury from wind turbines, however it is felt that none of these is a particularly serious threat. The population trend is not known but it is a common species in suitable habitats and bats in general receive protection in a number of European Union member states.[1]

See also[edit]

References[edit]

  1. ^ a b c d Aulagnier, S.; Paunovic, M.; Karataş, A.; Palmeirim, J.; Hutson, A. M.; Spitzenberger, F.; Juste, J.; Benda, P. (2008). "Tadarida teniotis". IUCN Red List of Threatened Species. Version 2013.1. International Union for Conservation of Nature. Retrieved 2013-10-05. 
  2. ^ Simmons, N. B. (2005). "Order Chiroptera". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 451. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ a b c Konig, Claus (1973). Mammals. Collins & Co. pp. 74–75. ISBN 978-0-00-212080-7. 
  • Won, Byeong-o (원병오) (2004). 한국의 포유동물 (Hangugui poyudongmul, Mammals of Korea). Seoul: Dongbang Media. ISBN 89-8457-310-8. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!