Overview

Distribution

Broad-eared bats are found in tropical and subtropical Central and South America. They occur at elevations up to 1700 m, but are most often found at elevations less than 500 m. The species ranges as far north as northern Mexico and south to central South America.

Biogeographic Regions: neotropical (Native )

  • Avila-Flores, R., J. j. Flores-Martinez, J. Ortega. 2002. Nyctinomops laticaudatus. Mammalian Species, no. 697: 1-6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is found from Tamaulipas and Jalisco (Mexico) to Venezuela and the Guianas, northwest Peru, Bolivia, northern Argentina, Paraguay, and Brazil; Trinidad; Cuba (Simmons 2005). Distribution extended to include northern Uruguay (Gonzalez 2001). Expansion of range in southern Argentina according to Barquez et al. (2006). There are no records for Nicaragua and Costa Rica.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Broad-eared bats are smaller than Nyctinomops aurispinosis and N yctinomops macrotis and have a relatively smaller braincase. Their coloration is generally brown on top and paler beneath. The wing membranes have no hair and are semitransparent.

The upper lip of broad-eared bats is wrinkled and turned up. The nostrils are raised on small tubes backed by a hard ridge. These bats have prolonged and delicate mandibles. Individuals of the northern subspecies are larger than those from the southern part of the range.

Individuals measure 88 to 141 mm in total length, of which, between 34 and 57 mm is contributed by the tail.

Range length: 88 to 141 mm.

Range wingspan: forearm length, 41 to forearm length, 64 mm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Broad-eared bats roost and forage in several different habitats. They can be found in tropical evergreen forests, deciduous forest, subtropical moist forests, thorn forests with mangrove and coconut trees, cloud forests, and swampy chacoan vegetaion. These bats are also found roosting in crevices in man-made structures, between rocks and in cracks on rocky cliffs. In northeast Mexico, they have been found roosting in caves.

Range elevation: sea level to 1700 m.

Habitat Regions: tropical

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
N. laticaudatus occupies diverse tropical and subtropical habitats. It has also been captured in disturbed and urban areas (Avila-Flores et al. 2002). It is insectivourous. It is found up to 1,500 m (Reid 1997)

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Broad-eared bats primarily eat coleopterans taken in flight, but also feed on lepidopterans.

Animal Foods: insects

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Broad-eared bats feed on numerous insect species and are food for at least two species of owls. This being the case, these bats are probably very important in structuring local insect populations. Their use as prey by owls, hawks, and snakes means they could have a positive impact on populations of those animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Broad-eared bats are preyed upon by barn owls (Tyto alba), Stygian owls (Asio stygius), snakes and sparrow hawks.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Nyctinomops laticaudatus is prey of:
Serpentes
Falco sparverius
Tyto alba
Asio stygius

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Nyctinomops laticaudatus preys on:
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Broad-eared bats have been heard making audible chirps, but no data was collected regarding the use or meaning of the chirps.

As mammals, it is likely that these bats use visual, chemical and tactile communication, especialy when in the roost.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; tactile ; acoustic ; echolocation ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

No data available

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The mating system of these animals has not been reported.

Broad-eared bats breed during the rainy season, which varies by location. Each female will come into estrous only once a year, and usually has only one young. Parturition is synchronous. The young are able to open their eyes, lift their ears and move over flat surfaces a few hours after birth.

Breeding interval: These bats breed once per year.

Breeding season: These animal apparently breed in the rainy season.

Average number of offspring: 1.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous

Details on the parental care of this species are not available. However, it is likely that the female performs most of the parental care, as she nurses the offspring.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

  • Avila-Flores, R., J. j. Flores-Martinez, J. Ortega. 2002. Nyctinomops laticaudatus. Mammalian Species, no. 697: 1-6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nyctinomops laticaudatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTATATTTACTATTTGGTGCTTGAGCAGGAATAGTGGGAACTGCCCTAAGCCTCCTTATCCGAGCTGAATTAGGTCAGCCAGGAGCTCTTTTAGGAGATGACCAGATTTACAATGTAATTGTTACCGCCCACGCTTTCGTAATAATTTTCTTCATAGTTATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATAATTGGTGCTCCAGATATAGCTTTCCCACGAATAAACAACATAAGTTTTTGACTTCTTCCCCCATCATTCCTCTTACTACTAGCCTCTTCTATGGTAGAAGCTGGTGCAGGAACTGGCTGAACAGTCTATCCTCCCCTAGCAGGAAACTTAGCCCATGCAGGAGCCTCCGTCGATCTAACCATCTTTTCTCTTCACCTAGCAGGAGTCTCATCAATCCTAGGAGCCATTAATTTTATTACTACCATTATTAATATAAAACCACCAGCCCTATCCCAATACCAAACACCATTATTCGTATGATCTGTGTTAATTACAGCTGTACTCTTACTATTATCACTACCAGTTCTAGCAGCAGGAATTACCATACTATTAACAGACCGAAACTTAAACACTACTTTCTTTGACCCCGCTGGAGGAGGTGACCCTATTTTATATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Nyctinomops laticaudatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Broad-eared bats are rare or uncommon throughout their range, except in the Yucatan Peninsula. They are not listed afforded any special protection under CITES or IUCN.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Barquez, R., Rodriguez, B., Miller, B. & Diaz, M.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
N. laticaudatus may form resident colonies throughout the year, in some cases in stable numbers, although population dynamics are complex, and phylopatry is low (Avila-Flores et al. 2002). It is rare or uncommon throughout most of its geographic range. However, it is relatively common in some areas, especially within the Yucatan Peninsula (Bowles et al. 1990; Jones et al. 1973).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is found within several protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Broad-eared bats may carry rabies.

Negative Impacts: injures humans (carries human disease)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There is no information available on the possible economic importance of these animals to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Broad-eared bat

The broad-eared bat, or broad-tailed bat (Nyctinomops laticaudatus), is a species of free-tailed bat from the Americas.

Description[edit]

The broad-eared bat is a relatively small bat, measuring about 10 cm (3.9 in) in total length, and weighing 11 g (0.39 oz) on average. The bats have a dark chocolate brown body with paler underparts, and hairless, translucent wings. The snout is pointed with an upturned tip, and the lower jaw is longer and narrower than is typical in free-tailed bats. As the common name of the bat suggests, the ears are unusually wide and rounded, and they join together in the middle of the forehead.[2]

Distribution and habitat[edit]

Broad-eared bats are found in tropical and subtropical forests from coastal Mexico to southern Brazil. It has been reported from a range of forest types, as well as scrubland and cerrado habitats, and even in urban areas. It is found from coastal plains to cloud forests as high as 1,500 m (4,900 ft), but is more common below 500 m (1,600 ft).[1] Five subspecies are recognised:[2]

  • N. l. laticaudatus - southern Paraguay and neighbouring parts of Brazil and Argentina
  • N. l. europs - South America east of the Andes, from Venezuela to northern Paraguay and Argentina
  • N. l. ferrugineus - coastal regions of central and northeastern Mexico
  • N. l. macarenensis - South America west of the Andes, from westernmost Venezuela to northernmost Peru
  • N. l. yucatanicus - Central America, southern Mexico, and Cuba

Biology and behaviour[edit]

Broad-eared bats are nocturnal, and roost during the day in rocky crevices in tightly packed groups of anything from 150 to 1,000 individuals.[2] However, in Tamaulipas, colonies of several thousand have been reported roosting in caves.[3] Such colonies can be resident throughout the year, but are not always so, and individual bats do not always return to the same home area.[1]

The bats are insectivorous, feeding mainly on beetles and moths. Predators include owls,[4] sparrowhawks, and tree-climbing snakes.[2]

Broad-nosed bats breed in the rainy season, giving birth between June and July in the northern parts of their range, and later in the year further south. They give birth to a single hairless young, weighing about 3 g (0.11 oz), which first opens its eyes within a few hours of birth.[2]

References[edit]

  1. ^ a b c Barquez, R., Rodriguez, B., Miller, B. & Diaz, M. (2008). Nyctinomops laticaudatus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 14 June 2014.
  2. ^ a b c d e Avila-Flores, R., Flores-Martinez, J.J., & Ortega, J. (2002). "Nyctinomops laticaudatus". Mammalian Species: Number 697: pp. 1–6. doi:10.1644/1545-1410(2002)697<0001:NL>2.0.CO;2. 
  3. ^ Villa, R.B. (1960). "Tadarida yucatanica in Tamaulipas". Journal of Mammalogy 41 (3): 314–319. doi:10.2307/1377488. 
  4. ^ Motta, J.C. Jr. & Taddei, V.A. (1992). "Bats as prey of stygian owls in southeastern Brazil". Journal of Raptor Research 26 (4): 259–260. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!