Overview

Distribution

Range Description

This bat occurs in the northern Amazon Basin (Koopman, 1982). It is known only from Brazil, Venezuela, Guyana, and Surinam (Eger, 1977; Koopman, 1994; Reid et al., 2000; Sanchez et al. 1992). It is present at an elevation below 500 m (Sanchez et al. 1992; Reid et al. 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is poorly known. In Venezuela, a female was present in a 15-year-old pine (Pinus caribaea) plantation; original vegetation at this locality corresponds to grass (Trachipoqum) savannas, in association with swamps dominated by the palmMauritia flexuosa, gallery forests, and swampy evergreen forests (Sanchez et al., 1992). In Ecuador, this bat was collected in the tropical evergreen forest (Reid et al. 2000). It is insectivorous; may feed on large insects likes other species of Eumops.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eumops maurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTCTTTACCTTCTATTTGGTGCCTGAGCAGGAATAGTAGGGACCGCCTTAAGTCTTTTAATCCGAGCTGAGCTAGGACAGCCAGGAGCTCTTCTAGGAGATGACCAAATTTATAATGTAATCGTCACAGCTCATGCCTTCGTAATAATTTTCTTTATAGTAATGCCTATTATGATTGGAGGCTTCGGAAACTGATTAGTGCCCTTAATAATTGGCGCCCCTGACATAGCTTTCCCCCGTATAAATAACATAAGCTTTTGACTCCTTCCCCCATCATTCCTACTCTTATTAGCTTCATCAATAGTCGAAGCTGGAGCTGGAACCGGTTGAACAGTCTATCCCCCCTTAGCCGGAAATCTAGCCCATGCAGGAGCCTCTGTAGACTTAACCATTTTCTCCCTTCACTTAGCAGGTGTTTCATCTATCCTAGGAGCCATTAATTTTATCACAACCATTATTAATATAAAACCCCCTGCCCTTTCTCAATACCAAACACCACTTTTCGTGTGATCCGTACTAATTACAGCTGTATTACTCCTTCTATCCCTCCCAGTCCTAGCAGCAGGAATTACAATATTACTAACAGATCGAAATCTAAATACCACCTTCTTTGACCCCGCCGGAGGAGGAGATCCTATTCTATATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eumops maurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Sampaio, E., Lim, B. & Peters, S.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Data Deficient in view of the absence of recent information on the extent of occurrence and ecological requirements of this species to make an assessment.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is one of the rarest Neotropical bats; know from a few individuals taken from less than ten localities in humid lowland areas. It is probably declining through habitat loss. The species is rarely encountered because it is difficult to capture due to its high flying and roosting behaviours (Emmons and Feer, 1997).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Habitat loss.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Not cited, maybe research actions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Guianan bonneted bat

The Guianan Bonneted Bat (Eumops maurus) is a species of bat in the family Molossidae. It is found in Guyana and Suriname; a surprising report has been made from Ecuador. It is threatened by habitat loss.

Source


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!