Articles on this page are available in 1 other language: Spanish (5) (learn more)

Overview

Distribution

Range Description

This species is found in Central and South America. This bat is known from Mexico, northwest Honduras, Costa Rica, Panama, Venezuela, Guyana, Surinam, French Guiana, Peru, Ecuador, Bolivia, and Brazil (Simmons 2005). It occurs at elevations 45 m in French Guiana (Simmons and Voss, 1998), 155 m in Venezuela (Eisenberg, 1989; Handley, 1976), and at 320 m in Peru (Graham and Barkley, 1984). In Belize is known from colections (Reid pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Type for Eumops hansae Sanborn, 1932
Catalog Number: USNM 200993
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): H. Ehrhardt
Year Collected: 1901
Locality: Colonia Hansa, near Joinville, Santa Catarina, Brazil, South America
  • Type: Sanborn, C. C. 1932 Nov 02. Journal of Mammalogy. 13: 356.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Eumops hansae
Catalog Number: USNM 123827
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown; Young adult
Preparation: Skin; Skull
Collector(s): Bicego
Year Collected: 1899
Locality: Manaos, Amazonas, Brazil, South America
  • Type: Handley, C. O. 1955 Dec 31. Proceedings of the Biological Society of Washington. 68: 177.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
E. hansae flies in the upper levels of the canopy (Fenton, 1972); occurs in tropical forests off coastal areas (Alvarez-Castañeda and Alvarez, 1991); in the eastern Brazilian highlands, and coast and in the Amazon Basin and Atlantic Forest biomes (Koopman, 1982; da Fonseca et al., 1996). In Venezuela, it has been observed over ponds, large clearings, and evergreen forests; roosting inside a cavity located in a dead standing tree in a large lagoon (Handley, 1976). In Peru, E. hansae flew over a small river bordered by tall, tropical, lowland forest in hilly terrain (Graham and Barkley, 1984). In Bolivia, this bat occurred in a savanna area near the edge of a forest (Ibañez and Ochoa, 1989). The stomach of a specimen from Bolivia contained Orthoptera (Anderson, 1997).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eumops hansae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTATATCTTCTATTTGGTGCCTGAGCAGGAATAGTAGGAACCGCCCTAAGCCTTCTTATTCGAGCCGAACTAGGCCAACCAGGGGCCCTCCTAGGAGATGACCAAATTTACAACGTAATCGTAACAGCCCATGCTTTTGTTATAATTTTCTTCATAGTTATGCCTATTATGATTGGGGGCTTTGGAAACTGATTAGTCCCATTAATAATTGGAGCCCCAGATATAGCTTTTCCACGAATAAATAACATGAGCTTCTGACTTCTTCCCCCTTCTTTCCTACTACTTCTAGCTTCTTCCATAGTAGAAGCTGGGGCCGGAACTGGTTGAACAGTTTATCCTCCCTTAGCAGGAAATCTAGCCCACGCAGGAGCCTCCGTAGACTTAACCATTTTTTCCCTTCATTTAGCAGGTGTCTCATCAATTCTCGGTGCAATTAACTTTATTACAACTATTATTAACATAAAACCACCAGCCCTGTCCCAATATCAAACACCATTATTTGTGTGATCCGTATTAATTACAGCTGTGTTACTACTATTATCTCTACCAGTACTAGCAGCAGGGATTACAATGCTACTAACAGATCGAAATCTTAATACTACTTTCTTTGATCCTGCCGGGGGAGGAGACCCTATCCTATACCAACATTTGTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eumops hansae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Pineda, J. & Rodriguez, B.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The species is rarely encountered because it is difficult to capture due to their high flying and roosting behaviors (Emmons and Feer, 1997). Need acoustic surveys as for all molossids (Miller pers. comm.). Rare in Mexico.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Occurs in protected areas throughout the range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sanborn's bonneted bat

Sanborn's bonneted bat (Eumops hansae), is a bat species from South and Central America. It was first described from a specimen collected at Colonia Hansa, Brazil, and is sometimes also known as the Hansa bonneted bat.[2]

Description[edit]

Sanborn's species is one of the smaller bonneted bats, measuring around 10 cm (3.9 in) in total length, including the tail, and weighing 13 to 17 g (0.46 to 0.60 oz). They have rich blackish-brown fur, which is paler on the belly, and which allows it to be distinguished from the similarly sized, but more lightly coloured, dwarf bonneted bats that live in the same general area. Other distinctive features of the species include narrow wing tips, relatively well-developed teeth at the back of the jaw, and a higher jaw joint than in its close relatives. As with other molossid bats, the tail extends beyond the margin of the wing membranes, and, in this species, is typically about 3 to 4 cm (1.2 to 1.6 in) in length.[3]

Distribution and behaviour[edit]

Sanborn's bonneted bat is patchily distributed across Central America, and is also found in the southernmost tip of Mexico. In South America, it is found across the northern parts of the continent east of the Andes, including Colombia, Venezuela, the Guyanas, western Brazil, eastern Peru and Ecuador, and northern Bolivia.[1] Within this region it inhabits lowland tropical evergreen forests below about 320 m (1,050 ft) elevation. There are no recognised subspecies.[3]

Sanborn's bonneted bats eat Orthopterans and other insects,[3] which they catch while flying in the upper levels of the forest canopy.[4] They have also been observed flying over clearings and large bodies of water, and to roost in cavities in tree cavities.[3]

References[edit]

  1. ^ a b Pineda, J. & Rodriguez, B. (2008). Eumops hansae. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 2 August 2014.
  2. ^ Sanborn, C.C. (1932). "The bats of the genus Eumops". Journal of Mammalogy 13 (4): 347–357. doi:10.2307/1374140. 
  3. ^ a b c d Best, T.L., et al. (2001). "Eumops hansae". Mammalian Species: Number 687: pp. 1–3. doi:10.1644/1545-1410(2001)687<0001:EH>2.0.CO;2. 
  4. ^ Fenton, M.B. (1972). "The structure of aerial-feeding bat faunas as indicated by ears and wing elements". Canadian Journal of Zoology 50 (3): 287–296. doi:10.1139/z72-039. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!