Articles on this page are available in 1 other language: Spanish (6) (learn more)

Overview

Distribution

Range Description

This species is found from Oaxaca and Yucatán (Mexico) to Peru, Bolivia, Paraguay, northern Argentina, Brazil, Venezuela, the Guianas, Trinidad, and Jamaica (Simmons 2005). There is no valid records for Belize (Miller pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
E. auripendulus is an insectivore (Barquez et al. 1993). Occurrs in dense forests, in coastal plains, desciduous forests, chacos, but have been found in human-disturbed areas and in a savanna (Best et al. 2002). They fly up to 1,200 m height (Barquez 1999). On the Yucatan Peninsula, Shaw’s mastiff bat has been observed at dusk over a highway (Ingles 1959; Jones et al. 1973). In Panama, individuals tended not to hang head down but instead tended to crawl into cracks and small recesses. When disturbed, they almost never flew but tried to escape by running on all fours (Bloedel 1955). In Trinidad, E. auripendulus was encountered at the same site as M. ater and M. molossus (Genoways et al. 1973). In Mexico it has been found in tropical moist forests under 1,000 m (Arita, 2005)

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eumops auripendulus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTATACCTTCTATTTGGTGCCTGAGCAGGAATAGTAGGGACCGCCCTGAGTCTTTTAATCCGAGCTGAACTAGGACAGCCAGGAGCTCTTCTAGGAGATGACCAAATTTATAATGTAATCGTCACAGCTCATGCCTTCGTAATAATTTTCTTTATAGTAATACCTATCATGATTGGAGGCTTCGGAAACTGATTAGTGCCCTTAATAATTGGCGCCCCTGATATAGCTTTCCCCCGTATAAATAACATAAGCTTTTGACTCCTTCCCCCATCATTCTTACTCTTATTAGCCTCATCAATAGTCGAAGCTGGGGCTGGAACCGGTTGAACAGTCTATCCTCCCTTAGCCGGAAATCTAGCTCATGCAGGAGCCTCTGTAGACTTAACCATTTTCTCCCTTCACTTAGCAGGTGTCTCATCTATCCTAGGAGCCATTAATTTTATCACAACCATTATTAATATAAAACCCCCTGCCCTTTCTCAATACCAAACACCACTTTTCGTGTGATCCGTGCTAATTACAGCTGTGCTACTCCTTCTATCCCTTCCAGTTCTAGCAGCAGGAATTACAATATTACTAACAGATCGAAATCTAAATACCACCTTCTTTGACCCCGCCGGAGGAGGAGACCCTATCCTATATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eumops auripendulus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Barquez, R., Rodriguez, B., Miller, B. & Diaz, M.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
E. auripendulus occurs at elevations of 25–100 m in Venezuela and from lowlands to 1,800 m in Peru (Best et al. 2002). Its seldom captured in mist nets.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
In Mexico it could be threatened by deforestation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Found in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black bonneted bat

The black bonneted bat, also known as Shaw's mastiff bat, (Eumops auripendulus), is a species of bat from the Americas.

Description[edit]

The black-bonneted bat is a medium sized bat, with adults weighing between 26 and 38 g (0.92 and 1.34 oz). The head and back are covered in dark brown fur that varies from reddish to almost black, while the sides and underparts are a paler, grey, colour. The ears are large and rounded, with a small, pointed tragus and dark, hairless skin. The wing membranes are also dark, and have narrow tips; the fur extends across the upper surface of the wing up to a line between the knees and the mid-point of the humerus. The face is almost entirely hairless, and ends in a blunt muzzle.[2]

Adult males possess a sacular organ on the throat, the function of which is unknown, but which is only vestigial in females. The bat most closely resembles the related Wagner's bonneted bat, but the latter usually has a paler colour and has a different shape to the tragus.[2]

Distribution and habitat[edit]

The black bonneted bat is found in southern Mexico, on the island of Jamaica, and through much of Central and South America, as far south as northern Argentina. It is, however, absent from western Peru and Bolivia, and from Chile. It inhabits a range of forested habitats throughout this region, from coastal lowlands to the slopes of the Andes at least 1,800 m (5,900 ft) in elevation.[1] In Brazil, for example, it is said to inhabit every major biome.[2]

Two subspecies are recognised:

Behaviour and biology[edit]

Black bonneted bats are insectivorous and nocturnal. They spend the day sleeping inside narrow cracks and crevices, often having crawled inside, rather than hanging head-down.[3] In larger spaces, such as inside lofts or belfries, they may hang grouped together in clusters of at least fifteen.[2] Females come into oestrus several times a year, and give birth to a single young.[4]

References[edit]

  1. ^ a b Barquez, R., Rodriguez, B., Miller, B. & Diaz, M. (2008). "Eumops auripendulus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 5 April 2014. 
  2. ^ a b c d Best, T.L., et al. (2002). "Eumops auripendulus". Mammalian Species: Number 708: pp. 1–5. doi:10.1644/1545-1410(2002)708<0001:EA>2.0.CO;2. 
  3. ^ Bloedel, P. (1955). "Observations on the life histories of Panama bats". Journal of Mammalogy 36 (2): 232–235. doi:10.2307/1375881. 
  4. ^ Anderson, S. (1997). "Mammals of Bolivia, taxonomy and distribution". Bulletin of the American Museum of Natural History 231: 1–652. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!