Articles on this page are available in 1 other language: Chinese (Simplified) (3) (learn more)

Overview

Comprehensive Description

Summary

"
Habit

Colonial

Habitat

Widely distributed, many biotypes

Niche

Old building, caves, temples, tunnels, attics, stone mines, cow sheds, grain godowns - up to 923m.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Megaderma lyra is found from eastern Pakistan and Sri Lanka to southeastern China and the northern Malay Peninsula.

(Lekagul & McNeely, 1977)

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This very widely recorded species ranges through much of South Asia, southern and Central China, and throughout the Southeast Asian mainland. In South Asia it is known from Afghanistan (Qachcar and Darunta [Habibi 2003]), Bangladesh (Dhaka, Chittagong, Sylhet, Khulna and Rajsahi divisions), India (Andhra Pradesh, Arunachal Pradesh, Assam, Bihar, Chhattisgarh, Gujarat, Himachal Pradesh, Jammu and Kashmir, Jharkhand, Karnataka, Kerala, Madhya Pradesh, Maharashtra, Meghalaya, Nagaland, Orissa, Rajasthan, Tamil Nadu, Uttar Pradesh and West Bengal), Nepal (Central Nepal), Pakistan (Baluchistan and Punjab) and Sri Lanka (Central, North Central, Northern, Southern and Western provinces) (Molur et al. 2002). In China, it has been recorded in Fujian, Sichuan, Guangdong, Hainan, Xizang, Yunnan, Guizhou, Guangxi and Hunan (Smith and Xie 2008). In Southeast Asia the species occurs in Myanmar, Thailand, Cambodia, Lao PDR, Viet Nam and Peninsular Malaysia. In South Asia, it has been recorded from sea level to an elevation of 1,000 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"
Global distribution

Afghanistan, Bangladesh, China, Pakistan, India, Sri Lanka and Malaysia.

Known presence in Protected Areas

India Maharastra: Tadoba-Andhari Tiger Reserve, Radhanagari Wildlife Sanctuary; Assam: Orang National Park; Andhra Pradesh: Kawal Wildlife Sanctuary, Nagarjunsagar-Srisailam Tiger Reserve; Madhya Pradesh: Kanha National Park; Chhattisgarh: Indravati National Park

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Total body length ranges from 65-95 mm, with weights from 40-60 g. Fur is grayish brown above and whitish gray below (Lekagul & McNeely, 1977). Ears are large and connected above rostrum and there is no external tail (Nowak, 1994).

Range mass: 40 to 60 g.

Range length: 65 to 95 mm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Colonial
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Megaderma lyra uses day roosts in caves, pits, buildings and hollow trees. These bats reside in more arid areas than M. spasma .

They generally forage less than 1 meter from the ground among trees and undergrowth in tropical forested habitats (Lekagul & MCNeely, 1977).

Habitat Regions: tropical

Terrestrial Biomes: forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found in variety of habitats ranging from dry arid lands to hot humid forests to coastal areas. It roosts in small to large colonies ranging from a single individual to several hundred individuals in caves, old buildings, thatched huts, old disused wells, temples, forts, tunnels, mines, cow sheds. It flies rather silently and close to the ground and feeds on a variety of insects that vary seasonally, also small vertebrates and also other bat species. It breeds once in a year. Usually a single young is born after a gestation period of about 150 days (Bates and Harrison 1997).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"
Habitat

Widely distributed, many biotypes

Niche

Old building, caves, temples, tunnels, attics, stone mines, cow sheds, grain godowns - up to 923m.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Megaderma lyra is mostly carnivorous, with a diet consisting of large insects, spiders, and small vertebrates such as bats, birds, rodents, and fish. Prey are detected either by passive listening or with the help of echolocation, then gleaned from the substrate and removed to a night roost where they are consumed (Schmidt et al., 2000; Rajan & Marimuthu, 1999). They will occasionally enter houses to take prey, such as lizards and insects, from the walls (Nowak, 1994).

Animal Foods: birds; mammals; reptiles; fish; insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore , Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Megaderma species are agile in flight, allowing them to avoid some predation. Although little is known of predation on this species, it is likely that much predation occurs on young in roosts by small predators such as snakes, viverrids, and birds of prey.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Megaderma lyra is prey of:
Strigiformes
Serpentes
Herpestidae
Felis silvestris
Falconiformes
Viverridae

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Megaderma lyra preys on:
non-insect arthropods
Actinopterygii
Arthropoda
Insecta
Reptilia
Aves
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
14 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Females segregate from males prior to parturition, otherwise both sexes occupy the same roost sites. Other aspects of mating behavior in this species are unknown (Nowak, 1994).

Mating takes place from November through January, with one (occasionally two) young born from April to June. Gestation lasts 150-160 days, with post-natal development following a logistic curve. The sex ratio is balanced at birth. Males are sexually mature by 15 months, females at 19 months (Goymann et al., 1999).

Breeding season: November through January

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 150 to 160 days.

Range age at sexual or reproductive maturity (female): 15 to 19 months.

Range age at sexual or reproductive maturity (male): 15 to 19 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 7.5 g.

Average number of offspring: 1.

Females carry young with them during foraging until the pups are between one and twenty-three days old, at which point they “park” them at either a day or a special night roost. Young are nursed for 2 to 3 months (Goymann et al., 1999).

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Megaderma lyra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTGTACTTATTATTTGGTGCTTGAGCCGGTATAGTAGGAACAGCTCTTAGCCTGTTAATCCGAGCCGAACTAGGCCAACCCGGAGCCCTACTAGGTGATGATCAAATCTATAACGTAATTGTTACAGCCCATGCATTTGTTATAATTTTCTTTATAGTAATGCCCATCATGATCGGCGGGTTTGGCAACTGACTAGTTCCCCTAATAATTGGCGCCCCTGACATGGCATTCCCTCGAATAAATAATATAAGCTTCTGACTTCTTCCCCCATCCTTCCTACTTCTATTAGCCTCTTCAATAGTTGAAGCAGGCGCCGGGACAGGATGAACTGTTTACCCACCTCTAGCAGGCAATTTAGCTCACGCAGGAGCCTCTGTGGACCTGACAATTTTTTCTCTCCATTTAGCAGGTGTCTCCTCTATTCTAGGCGCTATCAATTTTATTACTACTATTATTAATATGAAACCCCCTGCTTTATCCCAATACCAAACCCCTTTATTCGTCTGATCTGTCCTAATTACAGCCGTACTACTACTCCTTTCTCTCCCTGTTCTCGCCGCTGGAATTACAATACTATTAACAGACCGTAACTTAAATACTACCTTCTTTGACCCCGCAGGAGGGGGAGATCCAATCTTGTACCAACACCTCTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Megaderma lyra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Populations of Megaderma lyra are not currently threatened.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Csorba, G., Bates, P., Molur, S. & Srinivasulu, C.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Cox, N. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, it occurs in a number of protected areas, has a tolerance of a degree of habitat modification, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Overall this is a common species. Its population status is stable in Sri Lanka (W. Yapa pers. comm.), increasing in Bihar (Y.P. Sinha pers. comm.), decreasing in certain parts of northern India such as Rajasthan (colonies recorded in 1970s missing in the 1990s [as observed by I. Prakash pers. comm. and by Senacha pers. comm.]) (Molur et al 2002).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population stable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There appear to be no major threats to this species as a whole. It is locally threatened in parts of its range due to disturbance and loss of roosting sites due to renovation of old temples, buildings and old forts. Populations are also threatened by mining activities and hunting for local consumption (medicine and food) in India and Viet Nam.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Exploitation, illegal trade for food, human interference, renovation of old temples, quarrying, human habitation, habitat disturbance. The influence on the population well understood, not reversible and have not ceased to be a threat."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In South Asia, although there are no direct conservation measures in place, the species has been recorded from a number of protected areas in India including Tadoba-Andhari Tiger Reserve and Radhanagari Wildlife Sanctuary in Maharashtra, Orang National Park in Assam, Kawal Wildlife Sanctuary and Nagarjunasagar Srisailam Tiger Reserve in Andhra Pradesh, Kanha National Park in Madhya Pradesh and Indravati National Park in Chattisgarh. In Southeast Asia it has been recorded from several protected areas. In South Asia populations of this species should be monitored. Captive breeding techniques are known for this species and captive stocks exists in Germany. Public awareness to mitigate threats to this species is recommended (Molur et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known negative effects of Asian False Vampire Bats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Megaderma lyra will occasionally enter human dwellings to capture prey.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Uses

Illegal trade for food
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Risk Statement

"
Habitat status

Increase in area due to human habitation, bats live in old, unused houses. Decrease in quality due to quarrying.

Data quality

Literature, field study; observed, inferred; 95% confidence.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Greater false vampire bat

The greater false vampire bat (Megaderma lyra) is a species of bat in the family Megadermatidae, the false vampire bats. It is native to Asia. It is also known as the Indian false vampire bat.[1]

Description[edit]

This species is 65 to 95 millimeters in length and weighs 40 to 60 grams. The average forearm length is about 66 millimeters. It has large ears and no tail. Its fur is blue-gray in color overall and brownish gray on the underside. It has an erect noseleaf about 10 millimeters long.

Distribution[edit]

This bat is widespread throughout South Asia and Southeast Asia. It occurs in Afghanistan, Bangladesh, Burma, Cambodia, China, India, Laos, Malaysia, Nepal, Pakistan, Sri Lanka, Thailand, and Vietnam.[1]

Biology[edit]

This species is carnivorous, its diet including bats, small birds, reptiles, and fish, and large insects.

This is a gleaning bat, one which captures prey from the ground and from water surfaces. It takes advantage of many habitat types. Adults hunt from dusk to dawn, commuting up to 4 kilometers.

M. lyra uses a combination of hunting strategies. About 85% of prey is captured during short searching flights in which it flies about half a meter above the ground. It also utilizes a sit-and-wait strategy, perching about two meters above the ground to wait for prey. It uses echolocation. It has also been observed catching prey in complete darkness without echolocation.

Females segregate themselves from males after mating. Gestation lasts 150 to 160 days, and the female bears one or two pups. Females carry small pups with them during foraging, but leave larger pups in the roost. Young nurse for 2 to 3 months.

Notes[edit]

  1. ^ a b c Csorba, G., et al. 2008. Megaderma lyra. The IUCN Red List of Threatened Species. Version 2014.2. Downloaded on 25 October 2014.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!