Articles on this page are available in 1 other language: Chinese (Simplified) (3) (learn more)

Overview

Distribution

Range Description

This very widely recorded species ranges through much of South Asia, southern and Central China, and throughout the Southeast Asian mainland. In South Asia it is known from Afghanistan (Qachcar and Darunta [Habibi 2003]), Bangladesh (Dhaka, Chittagong, Sylhet, Khulna and Rajsahi divisions), India (Andhra Pradesh, Arunachal Pradesh, Assam, Bihar, Chhattisgarh, Gujarat, Himachal Pradesh, Jammu and Kashmir, Jharkhand, Karnataka, Kerala, Madhya Pradesh, Maharashtra, Meghalaya, Nagaland, Orissa, Rajasthan, Tamil Nadu, Uttar Pradesh and West Bengal), Nepal (Central Nepal), Pakistan (Baluchistan and Punjab) and Sri Lanka (Central, North Central, Northern, Southern and Western provinces) (Molur et al. 2002). In China, it has been recorded in Fujian, Sichuan, Guangdong, Hainan, Xizang, Yunnan, Guizhou, Guangxi and Hunan (Smith and Xie 2008). In Southeast Asia the species occurs in Myanmar, Thailand, Cambodia, Lao PDR, Viet Nam and Peninsular Malaysia. In South Asia, it has been recorded from sea level to an elevation of 1,000 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Megaderma lyra is found from eastern Pakistan and Sri Lanka to southeastern China and the northern Malay Peninsula.

(Lekagul & McNeely, 1977)

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Total body length ranges from 65-95 mm, with weights from 40-60 g. Fur is grayish brown above and whitish gray below (Lekagul & McNeely, 1977). Ears are large and connected above rostrum and there is no external tail (Nowak, 1994).

Range mass: 40 to 60 g.

Range length: 65 to 95 mm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in variety of habitats ranging from dry arid lands to hot humid forests to coastal areas. It roosts in small to large colonies ranging from a single individual to several hundred individuals in caves, old buildings, thatched huts, old disused wells, temples, forts, tunnels, mines, cow sheds. It flies rather silently and close to the ground and feeds on a variety of insects that vary seasonally, also small vertebrates and also other bat species. It breeds once in a year. Usually a single young is born after a gestation period of about 150 days (Bates and Harrison 1997).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Megaderma lyra uses day roosts in caves, pits, buildings and hollow trees. These bats reside in more arid areas than M. spasma .

They generally forage less than 1 meter from the ground among trees and undergrowth in tropical forested habitats (Lekagul & MCNeely, 1977).

Habitat Regions: tropical

Terrestrial Biomes: forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Megaderma lyra is mostly carnivorous, with a diet consisting of large insects, spiders, and small vertebrates such as bats, birds, rodents, and fish. Prey are detected either by passive listening or with the help of echolocation, then gleaned from the substrate and removed to a night roost where they are consumed (Schmidt et al., 2000; Rajan & Marimuthu, 1999). They will occasionally enter houses to take prey, such as lizards and insects, from the walls (Nowak, 1994).

Animal Foods: birds; mammals; reptiles; fish; insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore , Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

Megaderma species are agile in flight, allowing them to avoid some predation. Although little is known of predation on this species, it is likely that much predation occurs on young in roosts by small predators such as snakes, viverrids, and birds of prey.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Megaderma lyra is prey of:
Strigiformes
Serpentes
Herpestidae
Felis silvestris
Falconiformes
Viverridae

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Megaderma lyra preys on:
non-insect arthropods
Actinopterygii
Arthropoda
Insecta
Reptilia
Aves
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
14 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Females segregate from males prior to parturition, otherwise both sexes occupy the same roost sites. Other aspects of mating behavior in this species are unknown (Nowak, 1994).

Mating takes place from November through January, with one (occasionally two) young born from April to June. Gestation lasts 150-160 days, with post-natal development following a logistic curve. The sex ratio is balanced at birth. Males are sexually mature by 15 months, females at 19 months (Goymann et al., 1999).

Breeding season: November through January

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 150 to 160 days.

Range age at sexual or reproductive maturity (female): 15 to 19 months.

Range age at sexual or reproductive maturity (male): 15 to 19 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 7.5 g.

Average number of offspring: 1.

Females carry young with them during foraging until the pups are between one and twenty-three days old, at which point they “park” them at either a day or a special night roost. Young are nursed for 2 to 3 months (Goymann et al., 1999).

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Megaderma lyra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTGTACTTATTATTTGGTGCTTGAGCCGGTATAGTAGGAACAGCTCTTAGCCTGTTAATCCGAGCCGAACTAGGCCAACCCGGAGCCCTACTAGGTGATGATCAAATCTATAACGTAATTGTTACAGCCCATGCATTTGTTATAATTTTCTTTATAGTAATGCCCATCATGATCGGCGGGTTTGGCAACTGACTAGTTCCCCTAATAATTGGCGCCCCTGACATGGCATTCCCTCGAATAAATAATATAAGCTTCTGACTTCTTCCCCCATCCTTCCTACTTCTATTAGCCTCTTCAATAGTTGAAGCAGGCGCCGGGACAGGATGAACTGTTTACCCACCTCTAGCAGGCAATTTAGCTCACGCAGGAGCCTCTGTGGACCTGACAATTTTTTCTCTCCATTTAGCAGGTGTCTCCTCTATTCTAGGCGCTATCAATTTTATTACTACTATTATTAATATGAAACCCCCTGCTTTATCCCAATACCAAACCCCTTTATTCGTCTGATCTGTCCTAATTACAGCCGTACTACTACTCCTTTCTCTCCCTGTTCTCGCCGCTGGAATTACAATACTATTAACAGACCGTAACTTAAATACTACCTTCTTTGACCCCGCAGGAGGGGGAGATCCAATCTTGTACCAACACCTCTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Megaderma lyra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Csorba, G., Bates, P., Molur, S. & Srinivasulu, C.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Cox, N. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, it occurs in a number of protected areas, has a tolerance of a degree of habitat modification, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Populations of Megaderma lyra are not currently threatened.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Overall this is a common species. Its population status is stable in Sri Lanka (W. Yapa pers. comm.), increasing in Bihar (Y.P. Sinha pers. comm.), decreasing in certain parts of northern India such as Rajasthan (colonies recorded in 1970s missing in the 1990s [as observed by I. Prakash pers. comm. and by Senacha pers. comm.]) (Molur et al 2002).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There appear to be no major threats to this species as a whole. It is locally threatened in parts of its range due to disturbance and loss of roosting sites due to renovation of old temples, buildings and old forts. Populations are also threatened by mining activities and hunting for local consumption (medicine and food) in India and Viet Nam.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In South Asia, although there are no direct conservation measures in place, the species has been recorded from a number of protected areas in India including Tadoba-Andhari Tiger Reserve and Radhanagari Wildlife Sanctuary in Maharashtra, Orang National Park in Assam, Kawal Wildlife Sanctuary and Nagarjunasagar Srisailam Tiger Reserve in Andhra Pradesh, Kanha National Park in Madhya Pradesh and Indravati National Park in Chattisgarh. In Southeast Asia it has been recorded from several protected areas. In South Asia populations of this species should be monitored. Captive breeding techniques are known for this species and captive stocks exists in Germany. Public awareness to mitigate threats to this species is recommended (Molur et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative effects of Asian False Vampire Bats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Megaderma lyra will occasionally enter human dwellings to capture prey.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Greater false vampire bat

The Greater False Vampire Bat (Megaderma lyra) is a carnivorous bat, just as the South American Spectral Bat. However, it lives in Asia, along with other bats of the genus Megaderma, which are also known as "false vampires".

Contents

Description

It has a relatively large body size 65–95 mm and its weight ranges between 40-60 g. Average forearm length 66.4 mm (56.0-71.5mm). Like the Spectral Bat, it has no tail. Fur colour is bluish grey except on the underside which is brownish grey. It is smaller than the Spectral Bat. Its ears are big. The noseleaf is erect and 10mm in length.

Distribution

The species is found in South Asia and Southeast Asia including Pakistan, India, Sri Lanka, Myanmar, South China, Malaysia, and the Philippines. Its typical habitat is humid forest. It is one of the very few carnivorous bats and is known to eat small bats, small birds, lizards and frogs, fish, mice and rats, as well as large insects. It hunts at and after dusk. It roosts in caves, abandoned mines and attics of houses. Other species of bats avoid caves where this species roosts, probably because of fear of being eaten by them.

Wing morphology and flight

Wings are modified pectoral appendages that have been adapted for flight. Bat wings are membranous wings that attach to the side of the body and include the small hind legs and sometimes the tail as well. The last four digits have been elongated to support the wing skin connects each of the digits covering the entire wing structure. The first digit has been modified into a grasping hook that allows the bat limited ability to grasp onto objects. This hook remains free of the wing. All bat wings are shaped differently based upon the different selective pressures for each habitat and lifestyle. There are seven key measurements used to classify bat wings:

  • Wing span: the distance between the wing tips of a bat with wings extended so that the leading edge of the wing is straight. With units of B/m
  • Wing area: the combined area of the two wings, the entire tail membrane and the portion of the body between the wings. With units of S/m2
  • Aspect ratio: the square wingspan divided by the wing area; a higher aspect ratio usually corresponds with greater aerodynamic efficiency and lower energy losses in flight. Aspect ration correlates well with the outline of wing shape, because wings with rounded tips naturally have low aspect ratio. However not all shape variation in bat wings is expressed by the aspect ratio alone.
  • Wing loading: the weight of the bat divided by the wing area, and it is related to the mean pressure on the wings. Therefore, flight speed is proportional to the square root of wing loading.
  • Tip length ratio: the ratio of the length of the hand wing to the length of the arm wing.
  • Tip area ratio: the ratio of the hand wing area to the arm wing area.
  • Tip shape index: this measurement is particularly valuable because it is independent of the overall size and shape of the arm and hand wings, it is determined simply by their relative size. A value of 1 corresponds to triangular wingtips. Higher index values indicate rounded or nearly square wing tips and with values below 1 the wingtip becomes more acute and the wing thins considerably as the tip is approached.

Environmental pressure put on the bat by the habitat causes selective adaptation of the wings. This permits a species to improve its capacity to use certain food sources in certain ways. Mass-carrying ability, for example, is most closely linked with wing loading. As wing loading increases, the bat must fly faster and therefore expend more energy. Because they habitually fly with substantial loads, we expect carnivores to have relatively low wing loading. Large wing area and large wingtips ensure sufficient thrust and weight support when loaded, without risk of stall. Large wing area also permits a slow controlled approach to prey and facilitates easy take-off under load. Flight in cluttered areas requires slow speeds and high maneuverability; this constrains a bat to a short wing, because long wings can be a physical hindrance. The optimal wing size and shape for any bat is a compromise between numerous of different, and sometimes conflicting, selection forces.

The wing measurements for a typical adult are: Total mass 0.0375 M/kg, Wing Span 0.440 B/m, Wing Area 0.0312 S/m2, Aspect Ratio 6.2, Wing Loading 11.8 Mg/S/N*m-2, Tip Length ratio 1.70, Tip area ratio 0.96 and Tip shape index 1.30. These measurements show that M. lyra have a low wing loading and aspect ratio. Meaning that M. lyra are not very fast fliers but they have good maneuverability. They have wings designed to give them power and control which they need for capturing and lifting prey. A low wing loading also provides the capacity for increased life which is essential if prey is equal to 50% your body mass.

Hunting strategies and food

The wings, and only remains, of a small bat devoured by a false vampire bat, which dropped them from the ceiling onto the floor of a veranda in Sri Lanka.

M. lyra bats are carnivorous. They hunt, using a method called gleaning, in a variety of different habitats. Gleaning bats prefer to capture prey from ground and water surfaces. They consume large arthropods and small vertebrates such as frogs, geckoes, lizards, fish, mice, birds, and even smaller bat species. All of the bats in the roost will hunt from dusk to dawn with the exception of the pups. Some bats will commute 4 km to their hunting area. Once they reach this spot they will remain in an area of approximately 0.1 km2. All foraging areas take advantage of at least two different types of habitats offering them a more diverse selection of prey.

M. lyra use a combination of hunting strategies. 85% of prey is captured during searching flights in which the bats fly 0.5 meters above the ground. These flights last for about 6 minutes. It has been observed that some will sustain flight for 45 minute and based on this observation it has been speculated that M. lyra can eat while in flight. M. lyra also utilize a “sit and wait” strategy. They will perch 2 meters above ground and wait.

Foraging behaviors of individuals may vary with energetic restraints associated with different reproductive states. Reduces flight activity (nightly flight times) and longer perching bouts of lactating females coincided with the time spent at the juveniles night roost.

Echolocation

Bats have the same basic auditory system as all mammals only theirs has evolved to be highly sensitive so that sound can be utilized as a method of seeing. Bats utilize ultrasonic sound (greater than 20 kHz), which most mammals cannot hear, during echolocation.

A large ossified larynx allows the bat to build up a lot of tension on the vocal cords. The bat can then emit sound waves, through either its nose or mouth, which can reach up to 150 kHz. These high frequency sound waves are far closer together than low frequency sound waves. This gives the bat more information about its surroundings when the information is processed by the brain. These waves can be emitted 100 times per second as the bat stalks its prey.

Interestingly, in the Microchiroptera family, successful foraging, particularly in clutter, is sometimes hindered by echolocation. Some species use calls which are clutter-resistant, whereas others forsake echolocation while hunting. In some cases, foraging success may be more limited by echolocation than by flight performance. In any case, it has been observed that in captivity, Greater False Vampire Bats can successfully detect and catch mice and frogs in complete darkness without echolocating.

Reproduction

Not much is known about M. lyra reproduction. We do know that mating takes place from November through to January. After which females segregate from males. Gestation usually lasts 150–160 days. April to June is when child birth happens where one or sometimes two pups are born per mother. The birth disruption between males and female is equal. Males reach sexual maturity by 15 months, females by 19 months.

Females will carry young with them during foraging until the pups are between one and twenty-three days old, at which point they "park" them at either a day or a special night roost. Young are nursed for 2 to 3 months.

References

  • Audet, Doris, et al. “Foraging Behavior of the Indian False Vampire Bat, Megaderma lyra (Chiroptera:.” Biotropica 23.1 (1991): 63-67. Print.
  • Emmanuvel, Rajan, and G. Marimuthu. “A preliminary examination of genetic diversity in the Indian false vampire bat Megaderma lyra.” Animal Biodiversity and Conservation 29.2 (2006): 109-115. Print.
  • Liem, et al. Functional Anatomy of the Vertebrates: An Evolutionary Perspective third edition . United States: Brooks/Coles, 2001. Print.
  • Norberg, U. M., and J. M. V. Rayner. “Ecological Morphology and Flight in Bats (Mammalia; Chiroptera): Wing Adaptations, Flight.” Philosophical Transactions of the Royal Society of London. Series B, Biological 316.1179 (1987): 335-427. Print.
  • Obrist, Martin. “Flexible Bat Echolocation: The Influence of Individual, Habitat and Conspecifics on Sonar.” Behavioral Ecology and Sociobiology 36.3 (1995): 207-219. Print.
  • Ratcliffe,, John, et al. “Hunting in Unfamiliar Space: Echolocation in the Indian False Vampire Bat, Megaderma lyra,” Behavioral Ecology and Sociobiology 58.2 (2005): 157-164. Print.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!