Articles on this page are available in 1 other language: Spanish (19) (learn more)

Overview

Distribution

Proboscis bats (Rhynchonycteris naso) can be found from Veracruz and Oaxaca in southeastern Mexico, down through Central America and reaching the northern half of South America including southeastern Brazil, Peru and northern Bolivia.

Biogeographic Regions: neotropical (Native )

  • Goodwin, G. 1942. Mammals of Honduras. Bulletin of the American Museum of Natural History, 79: 107-195.
  • Hall, E. 1981. The Mammals of North America. New York: John Wiley & Sons.
  • Koopman, K. 1982. Biogeography of the bats of South America. Pp. 273-300 in M Mares, H Genoways, eds. Mammalian Biology of South America, Vol. 6. University of Pittsburgh: Pymatuning Laboratory of Ecology.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species ranges from Oaxaca and Veracruz, Mexico, to central and eastern Brazil, Peru, Bolivia, Guianas, Surinam and Trinidad (Simmons 2005). It is widely distributed at low elevations, generally below 500 m (Eisenberg 1989) but up to 1,500 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Proboscis bats are very small members of family Emballonuridae with gray-grizzled brown dorsal sides and two faint white stripes forming a distinct hourglass shape on their lower back and rump. Their ventral sides are pale brownish gray and their pelage is soft and dense, with a dark brown patagium. Their dark brown ears are prominent and tapered distally, much like their tragus. Young bats are slightly darker in color than adults. There is no significant sexual dimorphism, males and females are similar in appearance. Their body mass ranges from 3.8 to 3.9 g, their body length ranges from 37 to 43 mm including their tail, which has an individual length of 15.4 to 16.8 mm. When pregnant, females can weigh up to 6 g. Their average wingspan is 23.9 mm, and their wing aspect ratio (6.54) and wing loading (0.045) are considered intermediate when compared with 25 Neotropical species representing several families. The baculum of male proboscis bats is considerably larger than that of 6 other emballonurid species. Their dental formula is i 1/3, c 1/1, p 2/2, m 3/3 = 32 teeth. Their upper incisors are minute and distinctly separated, while the first upper premolar is relatively large, somewhat triangular in occlusal view and closer to the canine than to the last premolar. Skull lengths range from 11.4 to 12 mm in males and 11.6 to 12 mm in females. Some distinct features of this species include a deep basisphenoid pit and nearly parallel maxillary toothrows. The postorbital process and auditory bullae are well-developed. Similar and closely related emballonurids with overlapping ranges include greater sac-winged bats (Saccopteryx bilineata) and lesser sac-winged bats (Saccopteryx leptura). Proboscis bats can be distinguished from these species by their elongated muzzle and evenly-spaced tufts of white to pale gray fur along their forearms. The dorsal side of greater and lesser sac-winged bats is a darker shade of brown and lacks the gray-grizzled pattern found in proboscis bats. Male proboscis bats also lack wing sacs, which are organs on the propatagial membrane of the wings that store secretions used for mating rituals and are very prominent in greater and lesser sac-winged bats.

Range mass: 3.8 to 3.9 g.

Range length: 37 to 43 mm.

Average wingspan: 23.9 mm.

Sexual Dimorphism: sexes alike

Other Physical Features: endothermic ; bilateral symmetry

  • Bradbury, J., S. Vehrencamp. 1976. Social Organization and Foraging in Emballonurid Bats: 1. Field Studies. Behavioral Ecology and Sociobiology, 1: 337-381.
  • Brown, R., H. Genoways, J. Jones Jr. 1971. Bacula of some Neotropical bats. Mammalia, 35: 456-464.
  • Eisenberg, J. 1989. Mammals of the Neotropics. The northern Neotropics. Panama, Colombia, Venezuela, Guyana, Suriname, French Guiana. Chicago: University of Chicago Press.
  • Husson, A. 1978. The mammals of Suriname. Leiden: Brill.
  • Lawlor, T. 1973. Aerodynamic characters of some Neotropical bats. Journal of Mammalogy, 54: 71-78.
  • Voigt, C., O. von Helversen. 1999. Storage and display of odour by male Saccopteryx bilineata (Chiroptera, Emballonuridae). Behavioral Ecology and Sociobiology, 47: 29-40.
  • Yancey, F., J. Goetze, C. Jones. 1998. Saccopteryx bilineata. American Society of Mammologists, 581: 1-5. Accessed November 27, 2012 at http://www.science.smith.edu/msi/pdf/i0076-3519-581-01-0001.pdf.
  • Yancey, F., J. Goetze, C. Jones. 1998. Saccopteryx leptura. American Society of Mammologists, 582: 1-3. Accessed November 27, 2012 at http://www.science.smith.edu/msi/pdf/i0076-3519-582-01-0001.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Proboscis bats prefer tropical lowlands with an elevation of less than 300 m and are almost always found near or over moving water, but rarely near fast-moving water. Unlike most nocturnal bats, light does not seem to disturb the colony, individuals roost in well-lit areas, usually around 1.8 meters (6 feet) above water. These bats are known to cling upside down in a vertical line on the bark and roots of trees overhanging water, but on occasion, some have been found under bridges, in cave mouths overhanging water, under large curled leaves, such as those of banana plants and under large fabric umbrellas of outdoor Brazilian restaurants.

Range elevation: 300 (high) m.

Habitat Regions: tropical

Terrestrial Biomes: rainforest

  • Barnett, A., R. Shapley, L. Shapley. 2004. An Unusual Day Roost of Rhynchonycteris naso (Emballonuridae). Bat Research News, 45: 88-89.
  • Bloedel, P. 1955. Observations on the life histories of Panama bats. Journal of Mammalogy, 36: 232-235.
  • Bradbury, J., L. Emmons. 1974. Social Organization of some Trinidad bats. Zeitschriftfur Tierpsychologie, 36: 137-183.
  • Dalquest, W. 1957. Observations on the sharp-nosed bat, Rhynchiscus naso (Maximilian). The Texas Journal of Science, 9: 219-226.
  • Dickerman, R., K. Koopman, C. Seymour. 1981. Notes on the Bats from the Pacific Lowlands of Guatemala. Journal of Mammalogy, 62: 406-411.
  • Goldman, E. 1920. Mammals of Panama. Smithsonian Miscellaneous Collections, 69: 1-309.
  • Goodwin, G. 1946. Mammals of Costa Rica. Bulletin of the American Museum of Natural History, 87: 271-473.
  • Goodwin, G., A. Greenhall. 1961. A review of the bats of Trinidad and Tobago. Bulletin of the American Museum of Natural History, 122: 187-302.
  • Handley, C. 1976. Mammals of the Smithsonian Venezuelan Project. Brigham Young University Science Bulletin, Biological Series, 20: 1-89.
  • Murie, A. 1935. Mammals from Guatemala and British Honduras. University of Michigan: Museum of Zoology.
  • Nogueira, M., A. Pol. 1998. Observations about Rhynchonycteris naso (Wied-Neuwied, 1820) and Noctilio albiventris Desmarest, 1818 (Mammalia, Chiroptera). Revista Brasileira de Biologia, 58: 473-480.
  • Plumpton, D., J. Knox Jones Jr. 1992. Rhynchonycteris naso. Mammalian Species, 413: 1-5. Accessed September 18, 2012 at http://www.science.smith.edu/msi/pdf/i0076-3519-413-01-0001.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It is almost always associated with moist areas near multistratal evergreen forests. These bats tend to roost in small, single-species colonies of about ten to twenty-four, on tree trunks, in tree cavities, or in rock caves (Eisenberg 1989). When roosting they are often aligned in vertical rows with individuals about 10 mm apart. Several males occur in a roosting group, and there appears to be no harem formation or defense. These bats are aerial insectivores (Husson 1978; Goodwin and Greenhall 1961); and they tend to feed over water, flying only a short distance above the surface (Eisenberg 1989). In Mexico they have been also reported for secondary forests, crop-lands and grasslands (de Grammont pers. comm.)

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of proboscis bats consists exclusively of insects, mainly those from order Diptera, such as midges and mosquitoes, although some beetles (order Coleoptera) and caddis flies (order Trichoptera) have also been found in stomach content analyses. Since Diptera, Coleoptera, and Trichoptera are thought to comprise approximately 87 to 90% of aerial insects found over water, a study has suggested that this species feeds on the most abundant insects in its foraging area.

Animal Foods: insects

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

There has been no specific study on the role this species plays on the ecosystem, but due to its diet and large population numbers, proboscis bats may contribute to the control of insect populations in its habitat. In Panama, where these bats occur, research has shown that insectivorous bats indirectly affect herbivory on plants, by reducing herbivorous arthropod abundance. Proboscis bats are hosts to two known internal parasites: a coccidian parasite, Eimeria rhynchonycteridis, and a trypanosome, Trypanosoma cruzi. Some ectoparasites previously found on these bats include polyctenid hemipterans, Hesperoctenes fumarius, three species of streblid batflies: Strebla hirsutus, Trichobius caecus, and T. longipes; and two species of acarine mites: Eutrombicula variabilis and Periglischrus iheringi. However, the precise effects of these parasites have yet to be documented.

Commensal/Parasitic Species:

  • Eimeria rhynchonycteridis
  • Trypanosoma cruzi
  • Hesperoctenes fumarius
  • Strebla hirsutus
  • Trichobius caecus
  • Trichobius longipes
  • Eutrombicula variabilis
  • Periglischrus iheringi

  • Brennan, J., J. Reed. 1975. A list of Venezuela chiggers, particularly of small mammalian hosts (Acarina: Trombiculidae). Brigham Young University Science Series, 20: 45-75.
  • Herrin, C., V. Tipton. 1975. Spinturnicid mites of Venezuela (Acarina: Spinturnicidae). Brigham Young University Science Series, 20: 1-72.
  • Kalka, M., A. Smith, E. Kalko. 2008. Bats Limit Arthropods and Herbivory in a Tropical Forest. Science, 320: 71.
  • Lainson, R. 1968. Parasitological studies in British Honduras: 3. Some coccidial parasites of mammals. Annals of Tropical Medicine and Parasitology, 62: 252-259.
  • Ueshima, N. 1972. New world Polyctenidae (Hemiptera), with special reference to Venezuelan species. Brigham Young University Science Series, 17: 13-21.
  • WHO Expert Committee, 2002. Control of Chagas Disease: Second report of the WHO Expert Committee. Geneva, Switzerland: World Health Organization.
  • Wenzel, R. 1976. The streblid batflies of Venezuela (Diptera: Streblidae). Brigham Young University Science Series, 20: 1-177.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common predators of proboscis bats include various species of hawks, falcons, and egrets, although there have been documented cases of predation by orb-weaving spiders and northern annulated tree boas. This species can be very hard to detect when motionless, due to its pelage pattern, enabling it to remain cryptic to avoid predators. It also exhibits a cryptic behavioral adaptation where periods of synchronous gentle rocking can be observed throughout the day by most, if not all members of the colony in the absence of any threat. This behavior may also be more likely to occur during gusts of wind and with the combination of synchronous grooming and urination. Since this species tends to roost in open areas and is visually exposed, this behavior may benefit the colony by hiding its movements from potential predators.

Known Predators:

  • hawks Buteo
  • falcons Falco
  • egrets Leucophoyx
  • orb-weaving spiders Argiope savignyi
  • northern annulated tree boas Corallus annulatus

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

As nocturnal aerial insectivores, proboscis bats rely heavily on echolocation for prey detection. Their calls include a combination of high intensity signals, with narrowband (constant frequency) and broadband (frequency-modulated) components, of which, the former postulates details about small insect prey, while the latter provides information regarding the bat’s position relative to its surrounding. Proboscis bats emit high frequency calls of approximately 100 kHz, as well as lower frequencies around 47 kHz. High frequency calls indicate short-range detection of small prey in cluttered habitats, while lower frequencies increase the detection range, although only larger prey are perceived. Most calls are short, to prevent the overlap of outgoing and returning echoes from obstacles and/or prey. Complex social signals have not been observed in this species, although vocalizations by both sexes were observed when interacting with intra- and inter-colony newcomers.

Communication Channels: acoustic

Perception Channels: tactile ; echolocation ; chemical

  • Fenton, M., J. Rydell, M. Vonhof, J. Eklof, W. Lancaster. 1999. Constant-frequency and frequency-modulated components in the echolocation calls of three species of small bats (Emballonuridae, Thyropteridae, and Vespertilionidae). Canadian Journal of Zoology, 77: 1891-1900.
  • O'Farrell, M., B. Miller. 1997. A New Examination of Echolocation Calls of Some Neotropical Bats (Emballonuridae and Mormoopidae). Journal of Mammalogy, 78: 954-963.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The calculated annual survival rate of adult females is at least 79%, but no lifespan record of this species has been found. However, their close relative, greater sac-winged bats (Saccopteryx bilineata) can live up to 6 years in the wild. A study of the factors affecting longevity showed that lifespan tends to increase with body mass, hibernation and cave use, but is negatively impacted by increased reproductive rates. Out of 64 species of bats, Saccopteryx bilineata is the most similar to proboscis bats, neither of these bats hibernate or roost in caves frequently; however, they both have a similar body mass and a similar number of offspring annually.

  • Wilkinson, G., J. South. 2002. Life history, ecology and longevity in bats. Aging Cell, 1: 124-131.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Proboscis bats are polygynous and although the male to female ratio is usually equal, breeding females mainly copulate with dominant males. The rest of the colony likely follows a hierarchy, where reproductive females rank higher than non-reproductive females and non-dominant males. Dominant males forage at the edge of the feeding area and protect their colony from neighboring conspecifics using aerial attacks and audible vocalizations. Dominant males are thought to exhibit female-defense over resource-defense, since the males follow the females as they forage, even when they return to their roosting sites at night. Mating in proboscis bats is not well-studied, but during an observed copulation, two males approached a female from opposite sides, leading to what appeared to be inaudible vocalizations by the female. One male proceeded to edge over the female’s body and appeared to vocalize inaudibly, followed by copulation. The female and the second male then took off and executed a downward spiraling flight, until nearly reaching the water surface. However, the purpose of this act is not yet known.

Mating System: polygynous

Throughout the year, breeding proboscis bats can be found in different parts of their distribution, but may cease breeding during the dry season, which is November to March in Costa Rica and April to September in southeastern Brazil. Females produce only one offspring per pregnancy, but may have up to two pregnancies annually and can therefore be polyestrus. Offspring are quite large at birth and can reach adult size within 2 weeks. Weaning occurs after 2 to 4 months, after which, the young bats disperse to nearby colonies. Females undergo their first parturition around 18 months of age. Overlap between lactation with the first young and gestation of a second offspring has been documented.

Breeding interval: Proboscis bats breed once or twice annually.

Breeding season: The breeding season continues throughout the year, except the dry season in Costa Rica and southeastern Brazil

Range number of offspring: 1 to 2.

Range weaning age: 2 to 4 months.

Range time to independence: 2 to 4 months.

Range age at sexual or reproductive maturity (female): 18 (high) months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual

Within one week of birth, young bats begin to venture away from their mother, but do not stray far. While the mothers are out foraging, young bats practice flying at the roost. Once the young are able to fly, they forage along with the breeding females in the central feeding area, until dispersal at 2 to 4 months old. Usually, females with offspring roost with the main colony, but some have been found in hollow logs, which are thought to minimize the risk of young bats falling into water. Aside from the general protection of the colony offered by the dominant male, there has been no record of paternal care in this species.

Parental Investment: precocial ; female parental care ; pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Male, Female)

  • Bradbury, J., L. Emmons. 1974. Social Organization of some Trinidad bats. Zeitschriftfur Tierpsychologie, 36: 137-183.
  • Bradbury, J., S. Vehrencamp. 1976. Social Organization and Foraging in Emballonurid Bats: 1. Field Studies. Behavioral Ecology and Sociobiology, 1: 337-381.
  • Bradbury, J., S. Vehrencamp. 1977. Social Organization and Foraging in Emballonurid Bats: 3. Mating Systems. Behavioral Ecology and Sociobiology, 2: 1-17.
  • Bradbury, J., S. Vehrencamp. 1977. Social Organization and Foraging in Emballonurid Bats: 4. Parental Investment Patterns. Behavioral Ecology and Sociobiology, 2: 19-29.
  • Burt, W., R. Stirton. 1971. The Mammals of El Salvador. University of Michigan: Museum of Zoology.
  • Dalquest, W. 1957. Observations on the sharp-nosed bat, Rhynchiscus naso (Maximilian). The Texas Journal of Science, 9: 219-226.
  • Dickerman, R., K. Koopman, C. Seymour. 1981. Notes on the Bats from the Pacific Lowlands of Guatemala. Journal of Mammalogy, 62: 406-411.
  • Dowler, R., M. Engstrom. 1989. Distributional records of mammals from the southwestern Yucatan Peninsula of Mexico. Annals of Carnegie Museum, 57: 159-166.
  • Murie, A. 1935. Mammals from Guatemala and British Honduras. University of Michigan: Museum of Zoology.
  • Nogueira, M., A. Pol. 1998. Observations about Rhynchonycteris naso (Wied-Neuwied, 1820) and Noctilio albiventris Desmarest, 1818 (Mammalia, Chiroptera). Revista Brasileira de Biologia, 58: 473-480.
  • Plumpton, D., J. Knox Jones Jr. 1992. Rhynchonycteris naso. Mammalian Species, 413: 1-5. Accessed September 18, 2012 at http://www.science.smith.edu/msi/pdf/i0076-3519-413-01-0001.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhynchonycteris naso

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 96 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACCTCTTATTCGGTACTTGAGCCGGAATAGTTGGTACAGCTCTAAGCCTCTTAATCCGCGCAGAACTTGGCCAACCAGGAGCCCTACTAGGCGACGACCAGATTTACAACGTAGTAGTTACAGCCCACGCATTTGTAATAATTTTCTTTATAGTAATGCCCATTATGATTGGTGGCTTTGGTAACTGACTCGTACCTCTGATAATTGGTGCCCCAGATATAGCGTTCCCACGTATAAACAACATAAGCTTCTGACTACTCCCCCCGTCATTCCTACTCCTATTGGCTTCTTCTATAGTTGAAGCTGGTGCTGGCACAGGGTGAACTGTATATCCACCACTAGCTGGCAACCTAGCCCACGCCGGTGCCTCAGTTGACCTTGCCATCTTCTCTCTTCACCTGGCGGGTGTATCCTCTATTCTGGGAGCAATTAATTTCATCACTACCATCATCAACATGAAACCCCCTGCCCTATCCCAGTATCAAACACCTCTCTTCGTCTGATCTGTCCTAATCACAGCAGTCTTACTCCTCCTCTCACTACCCGTACTAGCCGCTGGAATCACCATACTACTAACAGATCGAAATCTAAATACTACCTTTTTCGACCCTGCAGGAGGGGGAGACCCAATTCTATACCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhynchonycteris naso

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 92
Specimens with Barcodes: 103
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

According to the IUCN Redlist, Rhynchonycteris naso is considered a species of least concern.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Lim, B. & Miller, B.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern because, although it is widely distributed, common in areas with water and suitable habitat and unlikely to be declining at a rate which would qualify the species for inclusion in one of the threat categories in the near future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
These bats are often common in lowland forest near water (streams, rivers, mangroves, and lakes) (Reid 1997); widespread (Emmons and Feer 1997). Colonies vary from a few individuals to 100 individuals (Dalquest 1957).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species. May be some water issues.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in protected areas. It is widely distributed throughout the Neotropics. In Mexico it is listed as subject to special protection under NOM - 059 - SEMARNAT - 2001 (Arroyo-Cabrales pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Proboscis bats can be infected with Trypanosoma cruzi, the parasite that causes Chagas Disease in humans. Although this parasite cannot be directly transmitted from bats to humans without incubation within an intermediate host, the bats can serve as a reservoir host for the development of more parasites.

Negative Impacts: injures humans (carries human disease)

  • Tyler, K., D. Engman. 2001. The life cycle of Trypanosoma cruzi revisited. International Journal of Parasitology, 31: 472-481.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There are no known positive effects of proboscis bats on humans, although in general, insectivores may aid in controlling insect populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Proboscis bat

The proboscis bat (Rhynchonycteris naso) is a bat species from South and Central America.[2] Other common names include sharp-nosed bat,[3] Brazilian long-nosed bat[4] and river bat[5] in English, and murciélago narizón in Spanish. It is monotypic within its genus.

This species is in the family Emballonuridae, the sac-winged or sheath-tailed bats. Like most bats, it is nocturnal. It is found from southern Mexico to Peru, Bolivia and Brazil, as well as in Trinidad.[1][6][7]

Characteristics[edit]

Individual proboscis bat
Close-up of a proboscis bat

This is a small bat, around 6 centimetres (2.4 inches) long and 4 grams (0.0088 pounds) in weight. Males in northern South America were found to average 56.48 millimeters long, females 59.18.[4] The tail is about 1.6 centimeters long.[4] Pregnant females can weigh up to 6 grams.[4] The species is characterized by its long, fleshy, and pointed nose. Its fur is soft and dense and is brownish-grey in color, with two white stripes down the back. Whether these stripes serve a purpose, such as camouflage or attraction of mates, is unknown. This bat also has gray tufts of fur on the forearms. No matter what time of day these features may make the bat difficult to see.

Habitat[edit]

This species is found in the lowlands of the northern half of South America, throughout Central America, and into southeastern Mexico. From Ecuador south, it is limited to east of the Andes; its range extends south to the northern half of Bolivia and much of Brazil. It seldom occurs above 300 meters (980 feet) in elevation.[4] It usually lives around wetlands and is frequently found in riparian forests, pastures swamps, and all near water.

Habits[edit]

Proboscis bats live in groups. The colonies are usually between five and ten individuals, and very rarely exceed forty. The bats are nocturnal, sleeping during the day in an unusual formation: they lay one after another on a branch or wooden beam, nose to tail, in a straight row.

A colony of proboscis bats usually has a regular feeding area, typically a small patch of water. Here the bats catch insects using echolocation. They have no specific breeding season, forming stable year-round harems. One young is born. Both sexes disperse after weaning at around 2–4 months.

This small species of bat has been found to occasionally fall prey to the large spider Argiope savignyi.[7]

References[edit]

  1. ^ a b Chiroptera Specialist Group (1996). "Rhynchonycteris naso". IUCN Red List of Threatened Species. Retrieved 2007-09-01. 
  2. ^ Infonatura. Natureserve.org. Retrieved on 2012-12-29.
  3. ^ Sharp-nosed Bat – Rhynchonycteris naso. Arthurgrosset.com. Retrieved on 2012-12-29.
  4. ^ a b c d e Plumpton, David L.; Jones, J. Knox Jr. (1992). "Rhynchonycteris naso". Mammalian Species 413: 1–5. doi:10.2307/3504230. Retrieved 30 March 2011. 
  5. ^ Lim, Burton K.; Engstrom, Mark D. (26 November 2001). "Bat community structure at Iwokrama Forest, Guyana". J. Trop. Ecol. 17 (5): 647–665. doi:10.1017/S0266467401001481. 
  6. ^ Rhynchonycteris. Ftp.funet.fi (2002-08-29). Retrieved on 2012-12-29.
  7. ^ a b Timm, Robert M. & Losilla, Mauricio (2007): Orb-weaving Spider, Argiope savignyi (Araneidae), Predation on the Proboscis Bat Rhynchonycteris naso (Emballonuridae). Caribbean Journal of Science 43(2): 282–284. PDF hdl:1808/4463
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!