Articles on this page are available in 1 other language: Spanish (19) (learn more)

Overview

Distribution

Range Description

This species ranges from Oaxaca and Veracruz, Mexico, to central and eastern Brazil, Peru, Bolivia, Guianas, Surinam and Trinidad (Simmons 2005). It is widely distributed at low elevations, generally below 500 m (Eisenberg 1989) but up to 1,500 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Found from southeastern Mexico through Central America to northern half of South America.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

They are 56.5-59.2mm in length, with a forearm length of 35-41mm. These little bats have soft, dense brownish-grey fur with two white stripes on the back and rump. The ventral surface is lighter. The wing is furred dorsally. They have an elongate muzzle, and the calcar is longer than the tibea. A pregnant female was found to weigh 6.0g, almost twice the normal body weight.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is almost always associated with moist areas near multistratal evergreen forests. These bats tend to roost in small, single-species colonies of about ten to twenty-four, on tree trunks, in tree cavities, or in rock caves (Eisenberg 1989). When roosting they are often aligned in vertical rows with individuals about 10 mm apart. Several males occur in a roosting group, and there appears to be no harem formation or defense. These bats are aerial insectivores (Husson 1978; Goodwin and Greenhall 1961); and they tend to feed over water, flying only a short distance above the surface (Eisenberg 1989). In Mexico they have been also reported for secondary forests, crop-lands and grasslands (de Grammont pers. comm.)

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These bats live in tropical woodlands that are stable, nonseasonal habitats. Frequently found in forests, pastures and swamps, all near water.

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

This bat feeds exclusively on insects. It often hunts over water, beginning its foraging bouts at dusk. Males defend a feeding range with pregnant females on the inside and young males and non pregnant females on the outskirts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

There is no breeding season, and stable year round harems are formed. One young is born. Both sexes disperse after weaning at around 2-4 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhynchonycteris naso

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 96 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACCTCTTATTCGGTACTTGAGCCGGAATAGTTGGTACAGCTCTAAGCCTCTTAATCCGCGCAGAACTTGGCCAACCAGGAGCCCTACTAGGCGACGACCAGATTTACAACGTAGTAGTTACAGCCCACGCATTTGTAATAATTTTCTTTATAGTAATGCCCATTATGATTGGTGGCTTTGGTAACTGACTCGTACCTCTGATAATTGGTGCCCCAGATATAGCGTTCCCACGTATAAACAACATAAGCTTCTGACTACTCCCCCCGTCATTCCTACTCCTATTGGCTTCTTCTATAGTTGAAGCTGGTGCTGGCACAGGGTGAACTGTATATCCACCACTAGCTGGCAACCTAGCCCACGCCGGTGCCTCAGTTGACCTTGCCATCTTCTCTCTTCACCTGGCGGGTGTATCCTCTATTCTGGGAGCAATTAATTTCATCACTACCATCATCAACATGAAACCCCCTGCCCTATCCCAGTATCAAACACCTCTCTTCGTCTGATCTGTCCTAATCACAGCAGTCTTACTCCTCCTCTCACTACCCGTACTAGCCGCTGGAATCACCATACTACTAACAGATCGAAATCTAAATACTACCTTTTTCGACCCTGCAGGAGGGGGAGACCCAATTCTATACCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rhynchonycteris naso

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 92
Specimens with Barcodes: 103
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Lim, B. & Miller, B.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern because, although it is widely distributed, common in areas with water and suitable habitat and unlikely to be declining at a rate which would qualify the species for inclusion in one of the threat categories in the near future.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
These bats are often common in lowland forest near water (streams, rivers, mangroves, and lakes) (Reid 1997); widespread (Emmons and Feer 1997). Colonies vary from a few individuals to 100 individuals (Dalquest 1957).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species. May be some water issues.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in protected areas. It is widely distributed throughout the Neotropics. In Mexico it is listed as subject to special protection under NOM - 059 - SEMARNAT - 2001 (Arroyo-Cabrales pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Eat insects that could pollinate crops and gathered foods.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Eat insects that could be pests.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Proboscis bat

The proboscis bat (Rhynchonycteris naso) is a bat species from South and Central America.[2] Other common names include sharp-nosed bat,[3] Brazilian long-nosed bat[4] and river bat[5] in English, and murciélago narizón in Spanish. It is monotypic within its genus.

This species is in the family Emballonuridae, the sac-winged or sheath-tailed bats. Like most bats, it is nocturnal. It is found from southern Mexico to Peru, Bolivia and Brazil, as well as in Trinidad.[1][6][7]

Contents

Characteristics

This is a small bat, around 6 centimeters (2 inches) long and 4 grams (0.14 ounces) in weight. Males in northern South America were found to average 56.48 millimeters long, females 59.18.[4] The tail is about 1.6 centimeters long.[4] Pregnant females can weigh up to 6 grams.[4] The species is characterized by its long, fleshy, and pointed nose. Its fur is soft and dense and is brownish-grey in color, with two white stripes down the back. Whether these stripes serve a purpose, such as camouflage or attraction of mates, is unknown. This bat also has gray tufts of fur on the forearms. No matter what time of day these features may make the bat difficult to see.

Habitat

This species is found in the lowlands of the northern half of South America, throughout Central America, and into southeastern Mexico. From Ecuador south, it is limited to east of the Andes; its range extends south to the northern half of Bolivia and much of Brazil. It seldom occurs above 300 meters (1,000 feet) in elevation.[4] It usually lives around wetlands and is frequently found in riparian forests, pastures swamps, and all near water.

Habits

Proboscis bats live in groups. The colonies are usually between five and ten individuals, and very rarely exceed forty. The bats are nocturnal, sleeping during the day in an unusual formation: they lay one after another on a branch or wooden beam, nose to tail, in a straight row.

A colony of proboscis bats usually has a regular feeding area, typically a small patch of water. Here the bats catch insects using echolocation. They have no specific breeding season, forming stable year-round harems. One young is born. Both sexes disperse after weaning at around 2–4 months.

This small species of bat has been found to occasionally fall prey to the large spider Argiope savignyi.[7]

Relations with humans

They have the potential to be both helpful and harmful to humans because they eat insects, sometimes ones that could pollinate crops and sometimes harmful ones.

Footnotes

  1. ^ a b Chiroptera Specialist Group (1996). "Rhynchonycteris naso". IUCN Red List of Threatened Species. Retrieved 2007-09-01. 
  2. ^ Infonatura. Natureserve.org. Retrieved on 2012-12-29.
  3. ^ Sharp-nosed Bat – Rhynchonycteris naso. Arthurgrosset.com. Retrieved on 2012-12-29.
  4. ^ a b c d e Plumpton, David L.; Jones, J. Knox Jr. (1992). "Rhynchonycteris naso". Mammalian Species 413: 1–5. Retrieved 30 March 2011. 
  5. ^ Lim, Burton K.; Engstrom, Mark D. (26 Nov 2001). "Bat community structure at Iwokrama Forest, Guyana". J. Trop. Ecol. 17 (5): 647–665. doi:10.1017/S0266467401001481. 
  6. ^ Rhynchonycteris. Ftp.funet.fi (2002-08-29). Retrieved on 2012-12-29.
  7. ^ a b Timm, Robert M. & Losilla, Mauricio (2007): Orb-weaving Spider, Argiope savignyi (Araneidae), Predation on the Proboscis Bat Rhynchonycteris naso (Emballonuridae). Caribbean Journal of Science 43(2): 282–284. PDF hdl:1808/4463
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!