Articles on this page are available in 1 other language: Spanish (6) (learn more)

Overview

Distribution

Range Description

This species is found in Central and South America. It's widely distributed from central Nicaragua through Panama; west of the Andes to northwestern Ecuador; and east of the Andes from Venezuela and the Guianas to Amazonian Peru, Brazil and Northern Bolivia (Wilson and Reeder 1993; Reid 1997; Eisenberg 1989; Tirira 1999). Found from lowlands to 1,000 m (Emmons and Feer 1997; Reid 1997; Linares 1998). Distribution follows moist lowland forest areas. Note that this species may no longer occur in the southernmost part of the range due to forest loss. It is found from Nicaragua south to Peru and Central Brazil (Simmons 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
These bats are associated with streams and moist areas, preferably in lowland and multistratal tropical evergreen forests (Eisenberg 1989; Reid 1997). They live in the forest and forage in small open spaces, chiefly flying in long, slow, beats of about 20 m long between the forest canopy and subcanopy (Emmons and Feer 1997). Frequently recorded at forest edges. (Sampaio, pers comm.). Active soon after sunset, it feeds on small flying insects near forest edge or over water (Reid 1997). Cormura brevirostris has not been the subject of a detailed field study (Eisenberg 1989). It is an aerial insectivore of background cluttered space.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cormura brevirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 53 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATACCTGCTATTCGGTGCTTGAGCGGGAATGGTAGGAACCGCACTTAGTCTGCTAATTCGCGCTGAACTGGGTCAACCAGGAGCTTTATTAGGTGATGACCAGATCTATAATGTTATCGTTACTGCCCATGCATTTGTAATAATTTTCTTTATAGTTATACCAATTATAATTGGTGGGTTCGGAAACTGATTAGTACCTCTAATAATTGGTGCTCCAGATATAGCATTTCCACGAATAAATAATATAAGTTTCTGATTATTACCTCCCTCATTCTTACTCCTTCTCGCCTCTTCTATGGTAGAAGCTGGGGCTGGTACCGGATGGACAGTATACCCACCTCTAGCTGGTAATCTAGCCCATGCTGGCGCCTCAGTAGATTTGGCTATTTTTTCCCTACACTTAGCGGGTGTCTCCTCTATTTTGGGAGCTATTAATTTTATTACTACTATTATTAATATAAAACCCCCCGCTCTATCTCAATATCAAACCCCCTTATTTGTCTGATCTGTTTTAATTACTGCTGTTCTTCTTCTCCTATCTCTCCCTGTTTTAGCTGCTGGGATTACCATGCTTTTAACAGACCGTAATTTGAATACTACTTTTTTTGACCCTGCTGGAGGGGGCGACCCTATTTTATACCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cormura brevirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 44
Specimens with Barcodes: 55
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Sampaio, E., Lim, B., Peters, S., Miller, B., Cuarón, A.D. & de Grammont, P.C.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern as it is widespread, and unlikely to be declining rapidly.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Locally common in the Amazon but generally understudied (Bernard pers. comm.). This species may be undersampled due to methodological issues.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Deforestation. In general, deforestation is a potential threat to most organisms but is probably not specific to any species of New World emballonurid bats because none of them have a restricted area of endemism other than perhaps Balantioperyx infusca and Saccopteryx antioquensis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Retention of primary forest. Presumably the species occurs in some protected areas. This is true for most New World emballonurid bats because they are usually widely distributed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chestnut sac-winged bat

The chestnut sac-winged bat, or Wagner's sac-winged bat (Cormura brevirostris) is a species of sac-winged bat native to South and Central America. It is the only species within its genus.

Description[edit]

The chestnut sac-winged bat is a relatively small member of its family, with adults measuring 7 centimetres (2.8 in) in length, and weighing 7 to 11 g (0.25 to 0.39 oz). Soft dense fur covers the body, and the inner parts of the wings, reaching as far as the mid-humerus and mid-femur on both the upper and lower surfaces. The fur is brown-black or red-brown in colour, being darker above, and paler on the underside of the animal. The wings are black, with the membranes extending as far as the ankles.[2]

The tail projects from the middle of the membrane between the legs, but does not extend beyond it, and so is not visible in silhouette. The tail measures about 1.5 cm (0.59 in) in length, although only 1 to 3 mm (0.039 to 0.118 in) of the tip is visible above the membrane. Males of the species have sacs in the centre of the membranes on the forward surfaces of the arms, which reach from the edge of the membrane almost to the elbow. This distinguishes it from all other sac-winged bats, in which the sac is usually much closer to the body.[2]

Distribution and habitat[edit]

In the south, chestnut sac-winged bats are found from eastern Ecuador and Peru, through northern Bolivia as far east as central Brazil. Further north, they are found throughout Colombia, Venezuela, and the Guyanas, and through Central America as far as eastern Nicaragua.[2] No subspecies have been identified. Their natural habitat is subtropical or tropical moist lowland forests.[1]

Biology and behaviour[edit]

Chestnut sac-winged bats forage for insects in openings and gaps just below and around the forest canopy. They are active primarily just after dusk and just before dawn, spending the day resting in cavities in trees or fallen logs. They live in small groups of up to five individuals, each with no more than a single female.[3] The bats' echolocation calls consist of three short pulses, each higher in pitch than the last, and rising from 25 to 32 kHz. This frequency optimises the detection of flying insects at long range.[2] Breeding has been reported to take place between April and May in Panama,[4] but may occur at different times of the year elsewhere.[2]

References[edit]

  1. ^ a b Sampaio, E., Lim, B., Peters, S., Miller, B., Cuarón, A.D. & de Grammont, P.C. (2008). Cormura brevirostris. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 12 November 2013.
  2. ^ a b c d e Bernard, E. (2003). "Cormura brevirostris". Mammalian Species (737): 1–3. doi:10.1644/737. 
  3. ^ Simmons, N.B. & Voss, R.S. (1998). "The mammals of Paracou, French Guiana: a Neotropical lowland rainforest fauna. part 1. Bats". Bulletin of the American Museum of Natural History 237 (X): 1–219. 
  4. ^ Fleming, T.H., et al. (1972). "Three central American bat communities: structure, reproductive cycles, and movement patterns". Ecology 53 (4): 555–569. doi:10.2307/1934771. JSTOR 1934771. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!