Overview

Brief Summary

Introduction

The current groupings are based on a not entirely satisfactory attempt at synthesis of several sources. Different authors recognize different circumscriptions of Plebejus: Tuzov et al. (1997) consider many of the "subgenera" to be distinct genera; Lamas (2004) views Aricia as distinct but subsumes most others, and Butterflies of America (Pelham) makes Aricia a synonym of Plebejus. It is not even completely clear that these different circumscriptions make a congruent division of species between Plebejus s. l. and Polyommatus s. l., particularly for the MANY central Asian taxa that have been described in recent years.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 1482
Specimens with Sequences: 1369
Specimens with Barcodes: 1313
Species: 66
Species With Barcodes: 63
Public Records: 134
Public Species: 25
Public BINs: 12
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Plebejus eumedon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Plebejus sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Plebejus loewii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGAAAATGACTTTTTTCTACAAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGAATCTTAATTCGTATAGAATTAAGAACTCCTGGATCTTTAATTGGTGAT---GATCAAATTTATAATACTATCGTTACAGCTCATGCATTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTAGTTCCTTTAATATTAGGAGCACCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCACCATCATTAATATTGTTAATTTCTAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCACATGGAGGATCATCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATCACAACAATTATTAATATACGAGTAAATAGTTTATCTTTTGATCAAATATCATTATTTATTTGAGCAGTTGGTATTACTGCTTTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCAATTACTATATTATTAACAGATCGAAATCTTAATACTTCATTTTTTGATCCAGCTGGAGGAGGTGATCCAATTTTATAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Plebejus loewii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Plebejus eumedon

The Geranium Argus (Plebejus eumedon) is a butterfly of the Lycaenidae family. It is found in the Palearctic ecozone.

The wingspan is 26–30 mm. The butterfly flies from May to August depending on the location.

The larvae feed on Geranium species.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Plebejus

Plebejus (also spelled Plebeius) is a genus of butterfly in the Lycaenidae family. Many genera formerly considered independent are at least tentatively included here nowadays, and some others—Agriades, Albulina, Icaricia, Aricia, and Lycaeides—may belong herein too.The members (species) of this genus are found in the Palearctic ecozone and the Nearctic ecozone.

Species include:[1]

References[edit]

  1. ^ Plebejus, funet.fi


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!