Overview

Distribution

Range Description

Rhinolophus euryale is a western Palaearctic species, occurring in southern Europe, north-west Africa (known range extends across northern Morocco, Algeria, and Tunisia), and the Near East. There is only a single record from Cyprus, but this is regarded by most authors to be R. mehelyi. It is widely distributed over its range, and is found from sea level to 1,000 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Mediterranean horseshoe bats occur mostly in Europe, including the Balkans and Mediterranean region. They are also found on the islands of Sicily, Sardinia, and Corsica. The northern most range includes Slovakia, northern Italy and southern France. They have also been reported in northern Africa.

Biogeographic Regions: palearctic (Native )

  • Russo, D., G. Jones, A. Migliozzi. 2002. Habitat selection by the Mediterranean horseshoe bat, in a rural area of southern Italy and implications for conservation. Biological Conservation, 107 (1): 71-81.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Mediterranean horseshoe bats are medium-sized, weighing betwen 8 and 17.5 g. Total length of these animals is 65 to 88 mm, and wingspan is between 300 and 320 mm. Females are often larger than males.

The horseshoe and lips of the bat are light brown, and the ears and wing membranes are light gray. The fur of this bat is sparse, becoming light gray toward the base. The back is a gray-brown, with a light reddish or pinkish tint. The underside is gray-white to a yellowish-white. The boundary between dorsal and ventral color is indistinct. Darker hairs may be present around the eyes.

The wings of the bat are broad (suggesting life in the forest), with the second phalanx of the fourth finger having more than twice the length of the first. When at rest, the third to fifth fingers are bent 180º at the joint between the first and second phalanges. Because of this, these bats cannot be completely wrapped by their wing membranes.

The species is nasal emitting, with an upper saddle process pointed and slightly curved downward. The lower saddle process is rounded when viewed from below, and is noticably shorter than the upper saddle process.

Range mass: 8 to 17.5 g.

Range length: 65 to 88 mm.

Range wingspan: 300 to 320 mm.

Sexual Dimorphism: female larger

  • Schober, W., E. Grimmberger. 1997. The Bats of Europe and North America. Neptune City, NJ: TFH Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It forages in Mediterranean and sub-Mediterranean shrubland and woodland, feeding on moths and other insects. In Italy, preferred foraging habitats are broadleaved woodland and riparian vegetation; coniferous woodland is avoided, and shrubland is rarely used (Russo et al. 2002). Summer roosts are located in natural and artificial underground sites, as well as attics in some part of the range. In winter it hibernates in underground sites (usually large caves with a constant microclimate). It is a sedentary species (the longest recorded distance travelled by an individual is 134 km) (Heymer 1964 in Hutterer et al. 2005).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mediterranean horseshoe bats inhabit warm, forested regions in foothills and mountains. They favor karst formations with numerous caves located near water sources. They also favor broadleaved woodlands and olive groves. They spend summers roosting in caves and underground shelters. In more northern regions, warm attics are used.

Habitat Regions: temperate

Terrestrial Biomes: forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Mediterranean horseshoe bats emerge in late twilight to feed on moths and other insects. They hunt at low altitudes on warm slopes and in relatively dense stands of trees or shrubs. The flight of the bat is slow and agile, and they have the ability to hover.

All members of the family Rhinolophidae use echolocation to find prey items. They are known to emit FM-CF-FM echolocation calls. These bats produce high frequency, highly directional calls in the range of 101 to 108 kHz, a frequency beyond the ability of tympanate moths to detect. The calls last approximately 20 to 30 ms.

Animal Foods: insects

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Mediterranean horseshoe bats consume large quantities of moths and other insects. They therefore affect insect communities negatively, but probably have an indirect positive effect on plant communities, by eliminating some herbivorous insects.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

No information on predation is available

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Rhinolophus euryale preys on:
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

All members of the family Rhinolophidae emit FM-CF-FM echolocation calls. The bat produces high frequency, highly directional calls in the range of 101 to 108 kHz, this high frequency cannot be heard by tympanate moths, one of their favorite foods. The calls last approximately 20 to 30 ms. However, it should be stressed that this echolocation is used for foraging, not for communicating with conspecifics.

Because these bats are nocturnal and roost in dark caves, it is unlikely that they use a lot of visual signals in their communications with conspecifics. Other members of the genus are reported to use some vocal communication, Because these bats come into frequent contact with one another in roosts, it is likely that there is some tactile communication. Communcation through scent has not been documented, but may occur, as these are mammals.

Communication Channels: tactile ; acoustic

Perception Channels: visual ; acoustic ; ultrasound ; echolocation

  • Russo, D., G. Jones, M. Mucedda. 2001. Influence of age, sex and body size on echolocation calls of Mediterranean and Mehely's horseshoe bats. Mammalia, 65 (4): 429-436.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of Mediterranean horseshoe bats is unknown. It is difficult to speculate on what the lifespan may be, as there is great variability within the genus. Some species on the Malay penninsula are reported to live for only about 6 or 7 years. However, one individual of the species Rhinolophus ferrumequinum in France was reported to have lived in excess of 27 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Not much detailed information is available regarding mating system of this species. Maternity roosts often contain 50 to 400 females with males often present.

Information on reproduction is sparse. Breeding is thought to occur once per year. Females give birth to one offspring which weighs approximately 4 grams at birth, and is ready to fly in early to mid August. In Bulgaria, young are ready to fly in mid July.

Within the genus Rhinolophus, some species are known to undergo delayed fertilization. Mating may occur in winter, and gestation, which is usually about 7 weeks, occurs in early spring. Most births in this genus occur in late spring or early Summer. Given that the young are flying in July or August, it is likely that Rhinolophus eurylate is similar.

In species of Rhinolophus for which data are available, lactation lasts for approximately one month. Sexual maturity is usually reached by two years of age.

Breeding interval: The animals breed once annually.

Breeding season: The breeding season of this species has not been reported, but is likely to occur in winter or in early spring.

Range number of offspring: 1 (high) .

Average number of offspring: 1.

Average gestation period: 7 weeks.

Average weaning age: 1 months.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

No information about parental care is available, but in general females care for young in bats. Young bats are typically atricial, and in this genus, lactation is thought to last for about one month. The role of males in parental care has not been reported.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
  • Schober, W., E. Grimmberger. 1997. The Bats of Europe and North America. Neptune City, NJ: TFH Publications.
  • Russo, D., G. Jones, A. Migliozzi. 2002. Habitat selection by the Mediterranean horseshoe bat, in a rural area of southern Italy and implications for conservation. Biological Conservation, 107 (1): 71-81.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhinolophus euryale

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACTCTATACCTGCTATTTGGTGCCTGAGCTGGAATAGTGGGCACCGCCCTGAGTCTACTAATTCGAGCTGAACTGGGCCAACCAGGCGCCCTCTTAGGAGACGACCAGATCTACAACGTAATCGTCACCGCCCACGCATTCGTGATAATTTTCTTCATAGTAATGCCCATTATGATTGGAGGCTTTGGCAACTGACTAGTCCCTCTAATAATTGGTGCCCCAGATATAGCATTCCCACGTATAAACAACATAAGCTTCTGACTCCTGCCCCCTTCCTTCCTACTCCTATTAGCTTCATCTATAGTTGAAGCTGGTGCCGGAACCGGCTGAACCGTCTACCCCCCTCTAGCAGGAAACCTGGCCCATGCAGGAGCCTCTGTAGACCTAGCTATCTTCTCCCTCCACTTAGCGGGGGTGTCCTCTATCCTAGGAGCAATTAACTTTATCACTACAATCATCAATATAAAACCCCCTGCCCTCTCCCAATACCAAACACCACTCTTCGTGTGGTCTGTCCTAATTACAGCTGTGCTCCTTTTACTATCCCTCCCTGTTCTAGCTGCCGGGATTACTATACTATTAACCGACCGCAACCTGAACACTACCTTCTTCGACCCCGCGGGAGGAGGAGATCCTATCCTGTACCAGCACCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rhinolophus euryale

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hutson, A.M., Spitzenberger, F., Juste, J., Aulagnier, S., Alcaldé, J.T., Palmeirim, J., Paunovic, M. & Karataş, A.

Reviewer/s
Vié, J.-C. & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
Many range states have reported that populations have declined and colonies have disappeared over the last 27 years (=3 generations). It is inferred that overall population decline has approached 30% over that period (although the population is now stable and or even increasing in some areas, e.g. France), so the species is assessed as Near Threatened (approaching A2c).

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rhinolophus euryale is the rarest of all European rhinolophids, and is classified as "Vulnerable" in the IUCN Red List. Data are scarce on population estimates, however, it is known there was a 70% decline in numbers in France between 1940 and 1980. There was also a serious population decrease in Slovakia. Because of the use of pesticides by humans, many species of insectivorous bats have suffered, and the timing of decline in this species corresponds to the increased use of pesticides after World War II.

Rhinolophus euryale seems particularly sensitive to human disturbance, and because it mainly roosts in underground shelters, including caves, protection of such sites is a key conservation strategy.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
An infrequent species. Summer colonies number ca. 50-1,500 individuals (S. Aulagnier pers. comm. 2007). Winter clusters typically number up to 2,000 animals. It occurs in large vulnerable colonies, and is considered threatened in many range states. Large population declines have been reported in a number of European countries, including Spain (Palomo and Gisbert 2002). In France, the population declined by ca. 70% between 1940 and 1980, although subsequently the trend appears to have stabilised (Brosset et al. 1988, S. Aulagnier pers. comm. 2007). Apart from R. blasii, which may have gone extinct in the country, R. euryale is probably the rarest rhinolophid in Italy, and anecdotal evidence suggests that a number of colonies have declined in the past few decades (D. Russo pers. comm. 2006). The species has a very small and declining population in Portugal (Rodrigues et al. 2003, Cabral et al. 2005). It is stable and common in the central and eastern Balkans (M. Paunovic pers. comm. 2007).

There is little information on population trends outside Europe, although it is suspected that continuing declines have also occurred in at least parts of the non-European range. For example, in Iran the species is no longer found in caves which 30 years ago held 20,000 individuals of different species (M. Sharifi pers. comm. 2005).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Threats include loss of foraging habitat, and disturbance and loss of underground habitats. On a landscape scale, fragmentation and loss of linear elements such as hedgerows and riparian vegetation is a problem because such elements are used as landscape references for commuting. The species' strong dependence upon caves for roosting makes it particularly sensitive to cave disturbance, such as that from caving or tourism. Tourist disturbance of caves affects the species in a number of range states. The use of organochlorine pesticides is believed to have contributed to the earlier dramatic decline of the species in France (Brosset et al. 1988). In North Africa, threats include habitat loss due to agriculture (livestock) and human disturbance.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is protected by national legislation in most range states. There are also international legal obligations for protection of this species through the Bonn Convention (Eurobats) and Bern Convention, where these apply. It is included in Annex II (and IV) of EU Habitats and Species Directive, and hence requires special measures for conservation including designation of Special Areas for Conservation. There is some habitat protection through Natura 2000, and some roosts are already protected by national legislation). The species is directly or indirectly benefiting from EU LIFE-funded projects in France, Spain and Italy. No specific measures are in place in North Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of Mediterranean horseshoe bats on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Mediterranean horseshoe bats provide insect control within the ecosystem.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mediterranean horseshoe bat

The Mediterranean Horseshoe Bat (Rhinolophus euryale) is a species of bat in the Rhinolophidae family. It is found in the Mediterranean region and balkan peninsula, as well as parts of Italy.

Contents

Physical characteristics [edit]

The head and body are normally between 43 and 58 mm, with a 22-30 mm tail. The wingspan of R. euryale is between 300 and 320 mm, with a standard weight between 8 and 17.5 grams. The upper connecting process is pointed and slightly bent downwards, and is distinctly longer than the lower connecting process, which is broadly rounded when seen from below.

The fur is fluffy, with a light grey base. The dorsal side is grey-brown, with sometimes a slight reddish tinge, while the ventral side is grey-white or yellow-white. [1]

Habitat [edit]

R. euryale tends to live in warm, wooded areas in foothills and mountains, preferring limestone areas with numerous caves and nearby water. Summar roosts and nurseries are in caves, although sometimes in warm attacks in the north. Roosts are frequently shared with other horseshoe bat species, although without any kind of intermingling.

Reproduction [edit]

There is little known information about the Mediterranean Horseshoe Bat's reproductive cycle. Nurseries normally hold between 50 and 400 females, with males sometimes present.

Hunting [edit]

Mediterranean Horsehoe Bats leave their roosts in late dusk, hunting low over the ground on warm hillsides but also in relatively dense tree cover, preying on moths and other small insects.

References [edit]

  1. ^ Schober, Wilfried; Eckard Grimmberger (1989). Dr. Robert E. Stebbings, ed. A Guide to Bats of Britain and Europe (in English) (1st ed.). UK: Hamlyn Publishing Group. ISBN 0-600-56424-X. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!