Overview

Brief Summary

Biology

This small water buffalo is herbivorous and feeds on aquatic plants, ferns, grasses, saplings, fallen fruit, palm, and ginger (5). Like other water buffalo this species wallows and bathes in pools of water and mud, and drinks from salt licks, pools of mineral spring water or from sea water in order to obtain minerals (1).  Lowland anoas are usually solitary, though mother and daughter pairs are common and small groups of up to five individuals have been recorded (6). Research indicates that males are territorial as they have been observed marking trees with their horns and scratching the soil after urinating (6). Breeding occurs throughout the year and, after a gestation period of 275-315 days, females give birth to a single offspring (2)(5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This small water buffalo is found in Indonesia (2). Indeed, 'anoa' is the Sulawesi word for 'buffalo'. This species is characterised by its stocky body and thick, dark skin which is darker in males than females (4). The body is sparsely covered with brown to blackish hair and the forelegs bear white or yellowish white hair. The nape and throat are also a pale yellow-white colour (4). Adults bear horns that point backwards and are flat and wrinkled (2). Males' horns grow to about 30 cm in length, while females' horns are slightly smaller at about 25 cm (in length) (6). Juveniles are brown in colour with a woolly coat which is lost as they mature (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biologi

Anoa lowland (Bubalus depressicornis) adalah hewan herbivora dan memakan tumbuhan air, paku-pakuan, rumput, tunas pohon, buah-buahan jatuh, pohon palem, dan jahe. Seperti halnya kerbau air lainnya, spesies ini juga berkubang dan mandi di kolam air maupun lumpur, dan meminum dari sumber garam, genangan dari sumber mata air atau dari air laut merupakan cara lain untuk mendapatkan mineral. Anoa lowland pada umumnya hidup secara soliter atau terpencil, meskipun induk dan saudaranya berpasangan merupakan keadaan yang biasa dan berkelompok kecil yang terdiri dari lima individu yang dilaporkan. Penelitian menunjukkan bahwa jantan merupakan hewan yang hidup di daerah daratan telah diamati dalam mengejar sasaran dengan tanduknya dan mengarukkan tanah setelah mebuang air kecil. Proses perkawinan terjadi sepanjang tahun dan setelah proses kahamilan selama periode dari 275 sampai 315 hari, betina melahirkan ketururan pertamanya.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Adriani Sunuddin

Supplier: Nurfitri Triramdani

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is endemic to Indonesia, where it is found only on Sulawesi and Buton Island off the southeast coast, with no records of either species of Anoas from other small neighbouring islands adjacent to Sulawesi (Burton et al. 2005), where it is found up to 1,000 m (G. Semiadi pers. comm. 2006). It remains uncertain whether the two putative species, Bubalus depressicornis and Bubalus quarlesi, are sympatric or parapatric in their distribution (Burton et al. 2005). Across the island, local distribution of anoa species remains unclear, as they may occur in forest patches at different altitudes or sympatrically (Burton et al. 2005). Records of skulls and morphological descriptions of this species suggest it is present in the northern peninsular, as far east as the Bogani Nani-Wartabone National Park. It is also found across the central region and ranging to the tip of the eastern and southeastern peninsulars, but no longer present in the south peninsular. The lowland anoa is also present in the central and north of Buton Island (Burton et al. 2005).

Historically, anoa of one species or other were present throughout the majority of the island’s forests (Weber 1890, Sarasin and Sarasin 1901, Mohr 1921, Harper 1945, Groves 1969, Burton et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Bubalus depressicornis is found exclusively in the northern region of the Indonesian island of Celebes, which is also called Sulawesi. (Parker, 1990; Nowak, 1999; Anonymous, 2001; Massicot, 2001)

Biogeographic Regions: oriental (Native )

Other Geographic Terms: island endemic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Indonesia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

This species is endemic to the Indonesian island of Sulawesi, where its range extends for about 5,000 km² (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Juvenile lowland anoas are covered with thick, wooly, yellowish brown hair. Adults are characterized by thick, black skin, and are only sparsely covered with brown to blackish hair. They also have white or yellowish-white hair on their forelegs, and sometimes on their throat and nape. Lowland anoas have a stocky body with the hindquarters slightly higher than the shoulders and a long tail averaging 40 cm in length. Adults stand at an average shoulder height of 86cm. The horns of an adult are triangular in section, flattened and wrinkled. The horns begin at the forehead and point diagonally backwards. Males have horns averaging 30cm in length, and females have horns that average 25cm in length. Anoas are very efficient at crashing through forest undergrowth, with the horns being held close to the back in order to avoid being tangled. (Parker, 1990; Huffman, 1999; Nowak, 1999; Anonymous, 2001; Massicot, 2001)

Range mass: 90 to 225 kg.

Average length: 180 cm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
There is very little is known about the ecology and life history of the Anoas (Burton et al. 2005). Overall population densities were estimated to be 0.9 and 1.1 anoas/km² in Tanjung Peropa and Tanjung Amolengo Wildlife Reserves, southeast Sulawesi, respectively (Mustari 2003). This species is found in both primary and secondary lowland forest, as well as swamp and mangrove forest (A. Priyono and G. Semiadi pers. comm. 2006, Mustari 2003). Riverine and lowland forests were preferred by anoa compared to rocky-cliffs forest in Tanjung Peropa Wildlife Reserve due to the availability of water sources, known food plants and fruit-bearing trees (Mustari 2003). In the past the species was reportedly common along coasts. Lowland Anoa are also found at high elevations in mountainous areas. Like other wild buffalo, Anoas wallow and bathe in pools of water and/or mud. It is probable that mineral springs or licks are also required, although Anoa are reported to drink seawater, which might fulfil their mineral needs in areas without licks or springs.

The species is solitary and is a browser, feeding on vegetation (Whitten et al. 1987, Foead 1992). The typical life span in captivity is reported to be 20 to 30 years, with age at sexual maturity at 2 to 3 years old (in captivity), with typically one offspring per year (NRC, 1983; Jahja, 1987), though in wild conditions this may be less.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The lowland anoa prefers undisturbed lowland forested areas and swamps. Shaded areas are preferred to escape from daytime temperatures. (Parker, 1990; Nowak, 1999; Anonymous, 2001)

Terrestrial Biomes: forest

Wetlands: swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As its name suggests this species inhabits lowland forests. It also occurs in swampy areas and in the past was recorded from coastal areas (1). Lowland anoa are also found in mountainous areas at high elevations (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Lowland anoas are herbivorous. Wild anoas are known to feed on aquatic plants, ferns, grasses, saplings, fallen fruit, palm, and ginger. In addition, they have been recorded to drink sea water which is thought to fulfill their mineral needs in areas that do not have salt licks or mineral spring water. Captive anoas are fed a diet of hay and herbivore pellets. (Parker, 1990; Nowak, 1999; Anonymous, 2001; Massicot, 2001)

Plant Foods: leaves; fruit

Primary Diet: herbivore (Folivore , Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

The lowland anoa controls forest understory growth by feeding on understory grasses and plants. (Parker, 1990; Huffman, 1999; Nowak, 1999; Anonymous, 2001; Massicot, 2001)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Adult lowland anoas do not have any predators (except humans). However, infant anoas are preyed upon by pythons (Python reticulatus or Python molurus) and the endemic civet (Macrogalidia musschembroekii). (Anonymous, 2001)

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Bubalus depressicornis is prey of:
Python molurus
Python reticulatus
Macrogalidia musschenbroekii

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Lowland anoas have been documented to live as long as 31 years in captivity. However, the maximum lifespan in the wild is approximately 20 years. (Jones, 1993; Anonymous 2001)

Range lifespan

Status: wild:
20 (high) years.

Range lifespan

Status: captivity:
31 (high) years.

Average lifespan

Status: wild:
30.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 36.1 years (captivity) Observations: These animals can live up to 36.1 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Lowland anoas are not known to have a breeding season. Both females and males become sexually mature at approximately 2 years of age. The female has a gestation period that lasts from 275 to 315 days. Females will usually go off alone during calving. Although a female can give birth to twins, typically only one offspring is born. Weaning occurs at a time period of 6 to 9 months after birth. Females typically reproduce annually. (Parker, 1990; Huffman, 1999; Nowak, 1999; Anonymous, 2001; Massicot, 2001)

Breeding season: year round

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 9.17 to 10.5 months.

Range weaning age: 6 to 9 months.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal )

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Generally, exclusively the female cares for the young.

Parental Investment: female parental care ; post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bubalus depressicornis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTCTCAACCAACCATAAAGATATCGGCACCCTGTATTTGCTGTTTGGTGCCTGAGCCGGCATAGTAGGGACAGCCCTAAGTCTACTGATTCGCGCTGAATTAGGTCAACCTGGGACCCTACTCGGAGATGACCAAATCTACAACGTAGTTGTAACCGCACACGCATTTGTAATAATTTTCTTCATAGTAATGCCAATCATAATTGGGGGATTTGGCAACTGACTTGTCCCTCTAATAATTGGCGCTCCCGACATAGCATTCCCCCGAATGAACAACATAAGCTTCTGGCTCCTCCCTCCCTCTTTCCTACTACTTCTAGCATCATCCATAGTTGAAGCTGGAGCAGGGACAGGTTGAACCGTATACCCCCCTTTAGCAGGTAACCTAGCCCACGCAGGAGCCTCGGTGGATCTAACCATCTTCTCTCTACACTTGGCAGGTGTCTCCTCAATCTTAGGGGCTATTAATTTTATTACAACAATTATCAACATAAAACCTCCTGCAATATCACAATACCAAACCCCTTTATTCGTGTGATCCGTAATAATCACCGCCGTGCTATTACTCCTTTCACTTCCTGTGCTAGCAGCTGGCATTACAATGCTACTAACAGATCGGAACCTAAACACAACTTTCTTTGATCCAGCGGGGGGAGGAGATCCTATTCTATACCAACACTTATTTTGATTCTTCGGACACCCTGAAGTATATATTCTCATTTTACCCGGGTTCGGTATGATCTCCCATATTGTAACCTACTACTCAGGAAAAAAGGAACCATTCGGATATATAGGAATAGTTTGAGCCATAATATCAATTGGGTTCCTGGGCTTTATCGTATGGGCCCACCACATATTTACAGTTGGAATAGACGTCGATACACGAGCCTACTTCACATCAGCCACTATGATTATTGCTATCCCAACTGGAGTAAAAGTCTTTAGCTGACTAGCAACACTTCACGGAGGTAATATCAAATGATCTCCCGCTATAATGTGAGCCCTAGGCTTCATCTTCCTTTTTACAGTAGGAGGCTTGACCGGAATTGTCCTAGCTAACTCTTCCCTCGACATCGTTCTCCACGACACGTATTATGTTGTAGCACACTTCCACTATGTCCTATCAATAGGTGCTGTGTTCGCCATTATAGGAGGATTTGTACATTGATTCCCACTGTTCTCAGGCTATACCCTAAACGACACTTGAGCCAAAATCCACTTCGCAATCATATTCGTAGGTGTCAATATGACTTTCTTTCCACAACACTTCTTAGGGCTGTCCGGTATACCACGACGTTACTCCGATTACCCAGATGCATACACAATATGAAATACCATTTCATCAATGGGCTCATTTATTTCTCTGACAGCGGTCATACTGATAGTCTTTATTATCTGAGAAGCATTCGCATCCAAACGAGAAGTCTCAACTGTAGATCTAACCACAACAAACCTGGAATGACTAAATGGATGCCCTCCACCATATCATACATTCGAAGAACCTACGTATGTTAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bubalus depressicornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C1+2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Semiadi, G., Mannullang, B., Burton, J., Schreiber, A., Mustari, A.H. & the IUCN SSC Asian Wild Cattle Specialist Group

Reviewer/s
Burton, J. (Asian Wild Cattle Red List Authority) & Stuart, S.N. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is considered Endangered because its population is estimated to be less than 2,500 mature individuals, its rate of decline is believed to be greater than 20% over two generations (14 to 18 years), and no subpopulation is believed to number more than 250 mature individuals.

History
  • 2007
    Endangered
  • 2000
    Endangered
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Bubalus depressicornis , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The lowland anoa was widely distributed throughout northern Sulawesi in 1900. The several reasons for the drastic decline in the lowland anoa population include hunting and the expansion of settlement, which has resulted in logging activities, as well as clearing of forested areas and draining of marshland for agriculture. The current lowland anoa population is estimated to be approximately 5000 animals. The number of wild lowland anoas is still decreasing as illegal hunting continues and humans continue to populate its range. Ongoing research efforts by zoos, including the St. Louis Zoo, San Diego Zoo, Fort Worth Zoo and Woodland Park Zoo in Seattle, Washington, continue to support a captive breeding program for lowland anoas. As of 1995, 110 Bubalus depressicornis were in captivity. (O'Brien and Kinnaird, 1996; Huffman, 1999; Anonymous, 2001; Massicot, 2001; Pangau, 2001)

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Endangered (EN C1+2a) on the IUCN Red List 2003 (1) and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There are to few data exist to accurately quantify the species' current abundance, nevertheless, they still appear to be distributed relatively widely within their known historical range on Sulawesi. There have been declines of this species throughout Sulawesi, especially in the southern and northeastern peninsulas, with the decline attributed to hunting for meat and habitat loss (Burton et al. 2005). The range is extremely fragmented, especially in the southern, northeastern and the south of the southeastern peninsulas of the island (Burton et al. 2005, B. Mannullang pers. comm. 2006). These declines probably began at the turn of the nineteenth century, with an increased decline rate from the 1980 to 2005 period (circa three generations), precipitously in some areas. The population size is unknown because there have been no island-wide surveys to estimate this, even for the largest populations. Estimating the population size is further complicated by the uncertain distribution of the two Anoa species. It is thought that there are less than 2,500 mature individuals. Most populations are becoming rapidly fragmented, suggesting that conservation of viable populations may soon require management of subpopulations (Burton et al. 2005). It is thought no subpopulation exceeds 250 mature individuals. The threats to this species, and thus the declines, are more serious for this species than for the Mountain Anoa.

The Lowland Anoa populations in small reserves (e.g., Tanjung Amolengu Wildlife Reserve) and other forest fragments are threatened with local extinction. Even the populations in large protected areas and other large forest blocks are reported to be in decline as a result of heavy hunting pressure. O'Brien and Kinnaird (1996) report a 50 to 95% decline of this species in Tangkoko Nature Reserve in Northern Sulawesi in a 10-year period, with more recent surveys suggesting it is now locally extinct. The rate of population decline across their range is thought to be 20% over two generations (generation length of 7 to 9 years). The species’ ecology was studied recently in the Tanjung Peropa and Tanjung Amolengo Wildlife Reserves in southeastern Sulawesi.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Land conversion to agriculture and hunting, mainly for food, are the two major threats to this species (Burton et al. 2005), as well as gold mining and other activities related to the collection of non-timber forest product (A. Priyono pers. comm. 2006). Recent reports indicate that hunting is by far the more serious threat. International trade in live animals or body parts is not thought to present a serious threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The population of this buffalo has declined significantly. The major threats are hunting and habitat loss, which is occurring in Sulawesi due to the draining of marshland, agricultural development and logging (1). Anoas are hunted for their desirable meat which is sold in local markets. In addition, the skull and the horns are made into trophies, souvenirs, and used in traditional medicine (4).  The threats of hunting and habitat loss go hand in hand, for as the forests are opened up for development, the wildlife in the forest becomes more accessible to poachers (2). The increase in the availability of weapons has also made the extent of hunting much greater (2). The lowland anoa has retreated into more remote areas of the forest due to these threats (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed on CITES Appendix I and fully protected under Indonesian law (Jahja 1987). Lowland Anoa occur in a number of protected areas (Burton et al. 2005). There are several key protected areas thought to hold significant populations of this species, including Lore Lindu National Park, Bogani Nani-Wartabone National Park, and Tanjung Peropa Nature Reserve on Sulawesi (Burton et al. 2005), as well as Lambu Sango Wildlife Reserve on Buton Island (Burton 2001). There is an ongoing status survey, as well as genetic and morphological research that aims to clarify the confusion that surrounds anoa systematics. A number of Lowland Anoa are in captivity, but the breeding program has been greatly hindered by the difficulties of assigning captive anoa to appropriate taxa. The captive population doubled in size in the 1990s, with around 125 individuals in zoos as of 1998. Of these, a small number are thought to be Mountain Anoa, although the taxonomic status of most individuals remains unconfirmed (Nötzold 1999).

According to Burton et al. (2005) this species requires the following conservation actions: (1) protection from hunting, (2) prevention of habitat loss at key sites, (3) complete genetic studies to better determine the taxonomy of this species, and (4) determination of the status of remaining populations. This species, as it is confined mainly to lowland areas, requires well established protected areas with protection from hunting a major priority. Law enforcement combined with education should be employed to reduce hunting pressure.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Sulawesi's forests have the highest level of mammal endemism in Asia, and there are several conservation programmes underway on the island (7). The lowland anoa is fully protected under Indonesian law, though there is concern that this is not enforced well enough, as hunting continues even inside protected reserves (1). This water buffalo does occur in several protected areas on the island but, unlike many wild cattle of Southeast Asia, this species depends mainly on undisturbed forest (1).  There are a number of lowland anoa held in captivity, though the breeding programme has been greatly hindered by confusion surrounding this species' classification (1). At present, genetic and morphological studies are underway, which will hopefully clarify this issue and allow breeding programmes to develop (1). This species is considered endangered by the IUCN and will face extinction in the wild in the near future unless hunting is controlled and the Sulawesi forests are protected from further development (1) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Wild lowland anoas can be very aggressive toward humans, especially young male anoas and female anoas with offspring. Several accounts of this species of anoa attacking humans with its sharp horns have been recorded. (Anonymous, 2001)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Anoas are hunted because of their desirable meat which is still sold in local markets. In addition, the skull and

the horns are made into trophies or souvenirs. The horns have traditional value for medicinal purposes. Despite the fact that anoas are protected, local people still pursue illegal hunting not only in unprotected forests but also in conservation areas. Local hunters generally use snares, spears or dogs to kill anoas. (Melisch, 1995; Pangau, 2001)

Positive Impacts: food ; body parts are source of valuable material; source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!