Overview

Brief Summary

Biology

Adult male waterbuck establish territories (3), which they guard from other males through displays and combat (4), using their prominent horns. Female and young waterbuck form herds of up to 30 individuals, which move freely through a number of male territories (3). Young males may form bachelor herds, until the opportunity arises to usurp an adult male from his territory (3). The strong, musky scent of waterbucks (3), caused by the oily secretion that coats the fur, is particularly pungent in males (5), and enables them to find other waterbuck. Unfortunately, this useful means of detection also makes them more vulnerable to being found by predators such as lions and hyenas (2). As waterbucks roam around their range, they graze on a variety of grasses, which is unusually high in protein. This diet is supplemented with reeds, rushes (5), and even sometimes fruits, particularly when green grass is scarce (2). Waterbucks drink an unusually large amount of water for an antelope, hence the reason why they are never found too far from a water source (5). During the mating season, adult males attempt to hold females as they wander through their territory, for mating (3). The gestation period lasts for over eight months, and the female gives birth to a single young, which remains hidden in vegetation for at least the first two weeks of life (2). After this period, the calf begins to join its mother and the herd (3), the mother's raised tail serving as a signal to follow (2). At the age of six months the young is weaned. Female waterbuck reach maturity at about three years of age (3), while males leave their mother's herd at about eight or nine months to join a bachelor herd (4), but are unable to compete for their own territory until five or six years old (2) (3). Waterbuck are known to live for up to 18 years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This rather shaggy-haired antelope is noted for its association with water and its strong musky scent (3). Its coat of coarse hair ranges in colour from grey-brown to reddish (3), with darker legs (2). The face is marked with white around the nose, mouth, above the eyes and on the throat (3). The short, rounded ears are white on the inside and black on the edges and tips (2) (3). The males bear long, heavily-ridged horns, extending back from the head and then sweeping forward (3), reaching up to 99 centimetres in length (2). Two subspecies of the waterbuck are recognised, which can be easily distinguished by the obvious pattern on their rear; a broad, white ring encircles the rump of the ellipsen waterbuck (Kobus ellipsiprymnus ellipsiprymnus), while the Defassa waterbuck (Kobus ellipsiprymnus defassa) has a solid white patch on its rump (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Waterbuck formerly occurred throughout most of sub-Saharan Africa. It has been eliminated widely within its former range, but survives in many protected areas and in some other areas which are sparsely populated by humans.

The Defassa Waterbuck is found west of the western Rift Valley and south of the Sahel from Eritrea in the east to Guinea Bissau in the west; its most northerly point of distribution is in southern Mali. A population still exists in Niokola-Koba in Senegal. Defassa also range east of the Congo Basin forest, spreading west below the basin’s southern limit through Zambia into Angola. Another arm extends north, west of the Congo Basin to the Zaïre R. in Congo Republic. Defassa are extinct in Gambia (though vagrants may enter from Senegal) (Spinage in press).

East of the eastern Rift Valley, the Defassa is replaced by the Common Waterbuck, which extends southwards to about the Hluhluwe-Umfolozi N.P. in KwaZulu-Natal, and to central Namibia. Common Waterbuck are extinct in Ethiopia (though Defassa remain) (Spinage in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

There are two main groups of waterbuck. The ellipsiprymnus group is found throughout southeast Africa. The defassa group is found in northeastern, central, and western Africa (Kingdon, 1982).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The ellipsen waterbuck occurs in south-east Africa, east of the Great Rift Valley, while the Defassa waterbuck is found west of the Great Rift Valley, ranging from Ethiopia west to Senegal (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Waterbuck have long bodies and necks and short legs. The hair is coarse, and they have a mane on their necks (Estes, 1991). Their head and body length ranges from 177 - 235 cm and shoulder height from 120 - 136 cm. Only male waterbuck have horns, which are curved forward and vary in length from 55 - 99 cm. The length of the horns is determined by the age of the waterbuck (Kingdon, 1982). Body color ranges from gray to red-brown and darkens with age. The lower part of the legs is black with white rings above the hooves (Estes, 1991).

Range mass: 160 to 300 kg.

Average basal metabolic rate: 148.949 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits savanna woodlands and forest-savanna moasics near permanent water (East 1999). Defassa generally are limited to areas receiving at least 750 mm annual rainfall, whereas Common persist in drier regimes (Spinage in press). They have been recorded to at least 2,100 m in Ethiopia (Yalden et al. 1996). Waterbuck are able to exploit a range of habitats to which its congeners are specifically adapted, albeit only to a varying degree, being not as aquatic as the Lechwe, nor as independent of water as the Kob (Spinage in press). Waterbuck are classified as grazers, but also browse.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Waterbuck prefer grassland habitat that is close to water. The best habitats are by draining lines and in valleys. While they prefer dry ground, they remain close to water for food and as an escape from predators (Estes, 1991).

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The waterbuck inhabits savannas and woodland where, as its name suggests, it is always within reach of permanent water (2). It favours areas where cover, in the form of woods or thickets, lies adjacent to open grassland suitable for grazing (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Waterbuck are very water dependent. They eat a variety of grasses, both medium and short in length. Their diet is very rich in protein. When the amount of available grass is low, waterbuck eat other herbs to satisfy their needs (Estes, 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
18.0 years.

Average lifespan

Status: captivity:
18.7 years.

Average lifespan

Sex: female

Status: wild:
18.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30 years (captivity) Observations: One wild born specimen was about 30 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Male waterbuck mature at six years of age, and females reach maturity in three years. Breeding near the equator is perennial. The generations in these populations are spaced about ten months apart. In northern Africa, the waterbuck calve annually. The gestation period is about eight to eight and a half months. A few days before calving, mothers isolate themselves in thickets. After birth, it takes newborns about half an hour to gain their feet. The young calves remain hidden for two to four weeks (Estes, 1991).

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 9.07 to 9.57 months.

Range weaning age: 6 to 7 months.

Average birth mass: 9000 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
771 days.

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Kobus ellipsiprymnus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTCTCAACCAACCACAAAGACATCGGTACCCTATATCTCCTATTTGGTGCTTGAGCCGGCATAGTAGGAACCGCCCTAAGCCTACTAATCCGTGCCGAATTAGGCCAACCTGGAACCCTCCTTGGGGATGATCAAATCTATAATGTCATTGTAACTGCACACGCATTTGTAATAATTTTCTTTATAGTAATACCTATCATAATCGGAGGATTTGGTAATTGACTAGTTCCTCTAATAATTGGCGCTCCCGACATAGCGTTTCCCCGAATAAATAATATAAGTTTTTGACTCCTCCCTCCTTCCTTCTTATTACTTCTAGCATCTTCTATAGTTGAAGCTGGGGCTGGAACAGGCTGAACTGTATATCCCCCTCTAGCAGGCAACTTAGCTCACGCAGGAGCTTCAGTCGACCTAACTATTTTTTCCCTTCACTTAGCAGGTGTTTCCTCAATTCTAGGAGCAATCAATTTTATTACAACAATTATTAATATAAAACCTCCCGCAATATCACAATACCAAACTCCCCTATTCGTATGATCTGTATTAATTACCGCTGTACTTTTACTCCTCTCACTCCCTGTACTAGCGGCCGGTATCACAATACTACTAACAGACCGAAATCTAAACACAACCTTTTTCGACCCAGCAGGAGGAGGGGACCCAATCCTATACCAACACTTATTTTGATTTTTTGGACATCCAGAGGTATATATTCTTATTTTACCCGGATTCGGAATAATCTCTCATATCGTAACTTACTACTCAGGTAAAAAAGAACCCTTCGGGTATATGGGAATGGTCTGGGCTATGATATCAATTGGATTCTTAGGATTTATTGTATGGGCTCATCATATGTTTACAGTTGGAATAGATGTTGACACACGAGCCTATTTCACATCAGCCACAATAATTATTGCTATTCCAACTGGGGTAAAAGTATTTAGCTGATTAGCCACACTTCACGGAGGCAATATCAAATGATCTCCTGCCATAATATGAGCCTTAGGCTTTATTTTCCTCTTTACAGTAGGAGGCTTAACTGGAATTGTTTTAGCAAACTCTTCCCTTGACATTGTTCTTCACGACACATATTATGTAGTTGCACACTTCCACTATGTCTTGTCAATAGGGGCTGTATTCGCTATTATAGGAGGATTCGTTCATTGATTCCCACTATTCTCAGGATATACCCTCAATGATACATGAGCCAAAATTCACTTTGCAATCATATTTGTAGGAGTAAACATAACTTTCTTCCCACAACATTTCCTAGGACTATCTGGCATACCACGACGGTACTCTGATTATCCAGACGCATACACAATATGAAACACTGTTTCATCTATAGGCTCATTTATTTCACTAACAGCAGTAATACTAATAATTTTTATTATCTGAGAAGCGTTTGCATCTAAACGAGAAGTCTCAACTGTAGACCTAACCACAACAAACCTAGAGTGACTAAACGGATGCCCGCCACCATATCACACGTTYGAAGAACCTACATACGTTAACTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Kobus ellipsiprymnus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Remains widespread across western, central, eastern and southern Africa, with an estimated total population of about 200,000 over half of which occurred in protected areas. The species is susceptible to poaching and a number of populations have declined. There is no evidence so far that the scale of this decline has reached a level that would qualify the species for Near Threatened or Vulnerable status. However, if declining trends continue then the species may warrant uplisting to Near Threatenedin the near or medium-term future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

---

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List 2007. Subspecies: Kobus ellipsiprymnus ellipsiprymnus (ellipsen or common waterbuck) and Kobus ellipsiprymnus defassa (Defassa waterbuck) are both classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Citing various authors East (1999) indicates that population densities can reach high levels within localized areas of favourable habitat, e.g., >10.0/km² in Lake Nakuru National Park. More typical density estimates obtained by aerial surveys of areas where the species is reasonably common are of the order 0.05-0.15/km². Higher densities of 0.2-0.9/km² have been recorded in aerial surveys of a few areas. Ground sun/eys have provided density estimates of the order 0.4-1.5/km² in areas where the species is common.

East (1999) produced a total population estimate of about 200,000. This includes approximately 95,000 Defassa Waterbuck and 105,000 Common. Overall population trend is decreasing for both subspecies.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Waterbuck have been eliminated widely within their former range mainly due to hunting, due to their sedentary nature and fondness for cultivation (Spinage in press). Even though they remain well represented in protected areas, several populations have undergone steep declines (especially those of the Defassa Waterbuck), including those in Queen Elizabeth N. P., Murschison Falls N.P., Akagera N.P., Lake Nakuru N.P., and Comoe N.P. (Spinage in press; and references therein).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The waterbuck has been eliminated from many areas within its large range (2), and is threatened in many other regions by hunting for food, competition with cattle for grazing, and the loss of suitable habitat to human settlements (1) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
More than half the population survives in protected areas, with about 60% of Defassa in protected areas, and more than half of Common in protected areas (plus 13% on private land) (East 1999).

Important populations of the Defassa Waterbuck persist in areas such as Niokolo-Koba (Senegal), Comoe (Côte d'Ivoire), Arly-Singou and Nazinga (Burkina Faso), Mole and Bui (Ghana), Pendjari (Benin), the national parks and hunting zones of North Province (Cameroon), Manovo-Gounda-St. Floris (Central African Republic), Moukalaba (Gabon), Garamba and Virunga (Congo-Kinshasa), the Awash Valley and Omo-Mago-Murule (Ethiopia), Murchison Falls and Queen Elizabeth National Parks (Uganda), Serengeti, Moyowosi-Kigosi, Ugalla River and Katavi-Rukwa (Tanzania) and Kafue (Zambia), but about half of these populations are in decline because of poaching (East 1999).

Important populations of the Common Waterbuck occur in areas such as Tsavo, Laikipia, Kajiado, Lake Nakuru and the coastal rangelands (Kenya), Tarangire and Selous-Mikumi (Tanzania), the Luangwa Valley (Zambia), and Kruger, Hluhluwe-Umfolozi and private land (South Africa) (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

This shaggy-haired antelope thankfully remains widespread in numerous protected areas throughout its range (2) (6), such as Moukalaba Reserve in Gabon and 'W' National Park in Niger (6). However, even within these areas, illegal hunting and habitat degradation can remain a problem, and thus in many countries, the survival of the waterbuck relies on the continuation and improvement of effective protection of these parks and reserves (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Waterbuck are hunted for sport in Africa and are found in zoos throughout the world (Kingdon, 1982).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Waterbuck

The waterbuck (Kobus ellipsiprymnus) is a large antelope found widely in sub-Saharan Africa.

Taxonomy and etymology[edit]

Rüppell's depiction of the defassa waterbuck (1835)

The scientific name of the waterbuck is Kobus ellipsiprymnus. The waterbuck is one of the six species of the genus Kobus and belongs to the family Bovidae. It was first described by Irish naturalist William Ogilby in 1833. The generic name Kobus is a New Latin word, originating from an African name, koba. The specific name ellipsiprymnus refers to the white elliptical ring on the rump.[2] It is composed of two Greek words : ellipes, which means lacking; and prumnos, which means the hind part.[3]

The type specimen of the waterbuck was collected by South African hunter-explorer Andrew Steedman in 1832. This specimen was named Antilope ellispiprymnus by Ogilby in 1833. This species was transferred to the genus Kobus and named K. ellipsiprymnus in 1840. In 1835, German naturalist Eduard Rüppell collected another specimen, which differed from Steedman's specimen in having a prominent white ring on its rump. Considering it a separate species, Rüppell gave it the Amharic name "defassa" waterbuck and scientific name Antilope defassa.[2] Presently, these two are considered to be the same species, K. ellipsiprymnus.[4]

Subspecies[edit]

37 subspecies of the waterbuck had been initially recognised on the basis of pelage colour. They classified into two groups - the Ellipsen waterbuck group and the Defassa waterbuck group. Owing to the high variability of coat colour in the Defassa waterbuck group, as many as 29 subspecies were included in it; the Ellipsen waterbuck group consisted of eight subspecies. In 1971, however, the number of subspecies was reduced to thirteen (four for the Ellipsen waterbuck group and nine Defassa waterbuck group). These subspecies are often found to interbreed in Tanzania and Kenya, where their ranges overlap extensively. Though they occur in Zambia as well, their ranges are separated by relief features or by the Muchinga escarpment.[4] The list of subspecies is as follows:[2][5]

  • K. e. ellipsiprymnus (Ellipsen waterbuck) group: Found in southeast Africa, ranging from southern Somalia to KwaZulu-Natal (South Africa) and inland to the Gregory Rift and Botswana. Includes the following four subspecies:
    • K. e. ellipsiprymnus Ogilby, 1833
    • K. e. kondensis Matschie, 1911 (including lipuwa, kulu)
    • K. e. pallidus Matschie, 1911
    • K. e. thikae Matschie, 1910 (including kuru and canescens)
  • K. e. defassa (Defassa waterbuck) group: Found west of the Gregory Rift, ranging from Ethiopia west to Senegal and south to Zambia. Includes the following nine subspecies:
    • K. e. adolfi-friderici Matschie, 1906 (including fulvifrons, nzoiae and raineyi)
    • K. e. annectens Schwarz, 1913 (including schubotzi)
    • K. e. crawshayi P. L. Sclater, 1894 (including uwendensis, frommiand münzneri)
    • K. e. defassa Rüppell, 1835 (including matschiei and hawashensis)
    • K. e. harnieri Murie, 1867 (including avellanifrons, ugandae, dianae, ladoensis, cottoni, breviceps, albertensis and griseotinctus)
    • K. e. penricei W. Rothschild, 1895
    • K. e. tjäderi Lönnberg, 1907 (including angusticeps and powelli)
    • K. e. tschadensis Schwarz, 1913
    • K. e. unctuosus Laurillard, 1842 (including togoensis)

Description[edit]

The waterbuck is the largest of the kob antelopes.[2] It is a sexually dimorphic antelope, with the males larger and heavier than the females.[4] The head-and-body length is typically between 177–235 cm (70–93 in) and the average height is between 120 and 136 cm (47 and 54 in).[6] Males reach approximately 127 cm (50 in) at the shoulder, while females reach 119 cm (47 in). Males typically weigh 198–262 kg (437–578 lb) and females 161–214 kg (355–472 lb).[7] The tail is 22–45 cm (8.7–17.7 in) long.[3]

The waterbuck is of a robust build. The shaggy coat is reddish brown to grey, and becomes progressively darker with age.[7] Though apparently thick, the hair is sparse on the coat. The hair on the neck is, however, long and shaggy. When sexually excited, the skin of the waterbuck secretes a greasy substance, giving it the name "greasy kob".[2] The face is marked with a white muzzle and light eyebrows and insides of the ears. There is a cream-coloured patch called "bib" on the throat.[3] The neck is long, while the legs are short.[6]

The long, spiral-structured horns, found only in males, sweep back and up. The first group shows a white rump patch, the second a white, ellipse-shaped ring on the rump that extends above the tail.

Habitat[edit]

Waterbuck are found in scrub and savanna areas near water, where they eat grasses. Despite their name, waterbuck do not spend much time in the water, but will take refuge there to escape predators. They are diurnal. Females gather in herds of between two and 600 individuals. Males keep territories of around 300 acres (1.2 km²) during their prime. They usually lose their territories before the age of 10.

References[edit]

  1. ^ IUCN SSC Antelope Specialist Group (2008). "Kobus ellipsiprymnus". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. Retrieved 2011-06-15.  Database entry includes justification for why this species is listed as Least concern.
  2. ^ a b c d e Spinage, C. (1982). A Territorial Antelope. Oxford: Elsevier Science. pp. 1–10. ISBN 978-0-323-15475-8. 
  3. ^ a b c Huffman, B. "Waterbuck". Ultimate Ungulate. Retrieved 21 March 2014. 
  4. ^ a b c Skinner, J. D.; Chimimba, Christian T. (2005). The Mammals of the Southern African Subregion (3rd ed.). Cambridge: Cambridge University Press. pp. 681–2. ISBN 0521844185. 
  5. ^ Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 720. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  6. ^ a b Newell, T. L. "Kobus ellipsiprymnus (Waterbuck)". University of Michigan Museum of Zoology. Animal Diversity Web. Retrieved 21 March 2014. 
  7. ^ a b Estes, R. D. (2004). The Behavior Guide to African Mammals : Including Hoofed Mammals, Carnivores, Primates (4th ed.). Berkeley: University of California Press. pp. 107–11. ISBN 0-520-08085-8. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!