Overview

Brief Summary

Biology

Adult male waterbuck establish territories (3), which they guard from other males through displays and combat (4), using their prominent horns. Female and young waterbuck form herds of up to 30 individuals, which move freely through a number of male territories (3). Young males may form bachelor herds, until the opportunity arises to usurp an adult male from his territory (3). The strong, musky scent of waterbucks (3), caused by the oily secretion that coats the fur, is particularly pungent in males (5), and enables them to find other waterbuck. Unfortunately, this useful means of detection also makes them more vulnerable to being found by predators such as lions and hyenas (2). As waterbucks roam around their range, they graze on a variety of grasses, which is unusually high in protein. This diet is supplemented with reeds, rushes (5), and even sometimes fruits, particularly when green grass is scarce (2). Waterbucks drink an unusually large amount of water for an antelope, hence the reason why they are never found too far from a water source (5). During the mating season, adult males attempt to hold females as they wander through their territory, for mating (3). The gestation period lasts for over eight months, and the female gives birth to a single young, which remains hidden in vegetation for at least the first two weeks of life (2). After this period, the calf begins to join its mother and the herd (3), the mother's raised tail serving as a signal to follow (2). At the age of six months the young is weaned. Female waterbuck reach maturity at about three years of age (3), while males leave their mother's herd at about eight or nine months to join a bachelor herd (4), but are unable to compete for their own territory until five or six years old (2) (3). Waterbuck are known to live for up to 18 years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This rather shaggy-haired antelope is noted for its association with water and its strong musky scent (3). Its coat of coarse hair ranges in colour from grey-brown to reddish (3), with darker legs (2). The face is marked with white around the nose, mouth, above the eyes and on the throat (3). The short, rounded ears are white on the inside and black on the edges and tips (2) (3). The males bear long, heavily-ridged horns, extending back from the head and then sweeping forward (3), reaching up to 99 centimetres in length (2). Two subspecies of the waterbuck are recognised, which can be easily distinguished by the obvious pattern on their rear; a broad, white ring encircles the rump of the ellipsen waterbuck (Kobus ellipsiprymnus ellipsiprymnus), while the Defassa waterbuck (Kobus ellipsiprymnus defassa) has a solid white patch on its rump (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

There are two main groups of waterbuck. The ellipsiprymnus group is found throughout southeast Africa. The defassa group is found in northeastern, central, and western Africa (Kingdon, 1982).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Waterbuck formerly occurred throughout most of sub-Saharan Africa. It has been eliminated widely within its former range, but survives in many protected areas and in some other areas which are sparsely populated by humans.

The Defassa Waterbuck is found west of the western Rift Valley and south of the Sahel from Eritrea in the east to Guinea Bissau in the west; its most northerly point of distribution is in southern Mali. A population still exists in Niokola-Koba in Senegal. Defassa also range east of the Congo Basin forest, spreading west below the basin’s southern limit through Zambia into Angola. Another arm extends north, west of the Congo Basin to the Zaïre R. in Congo Republic. Defassa are extinct in Gambia (though vagrants may enter from Senegal) (Spinage in press).

East of the eastern Rift Valley, the Defassa is replaced by the Common Waterbuck, which extends southwards to about the Hluhluwe-Umfolozi N.P. in KwaZulu-Natal, and to central Namibia. Common Waterbuck are extinct in Ethiopia (though Defassa remain) (Spinage in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The ellipsen waterbuck occurs in south-east Africa, east of the Great Rift Valley, while the Defassa waterbuck is found west of the Great Rift Valley, ranging from Ethiopia west to Senegal (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Waterbuck have long bodies and necks and short legs. The hair is coarse, and they have a mane on their necks (Estes, 1991). Their head and body length ranges from 177 - 235 cm and shoulder height from 120 - 136 cm. Only male waterbuck have horns, which are curved forward and vary in length from 55 - 99 cm. The length of the horns is determined by the age of the waterbuck (Kingdon, 1982). Body color ranges from gray to red-brown and darkens with age. The lower part of the legs is black with white rings above the hooves (Estes, 1991).

Range mass: 160 to 300 kg.

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 148.949 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Waterbuck prefer grassland habitat that is close to water. The best habitats are by draining lines and in valleys. While they prefer dry ground, they remain close to water for food and as an escape from predators (Estes, 1991).

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Inhabits savanna woodlands and forest-savanna moasics near permanent water (East 1999). Defassa generally are limited to areas receiving at least 750 mm annual rainfall, whereas Common persist in drier regimes (Spinage in press). They have been recorded to at least 2,100 m in Ethiopia (Yalden et al. 1996). Waterbuck are able to exploit a range of habitats to which its congeners are specifically adapted, albeit only to a varying degree, being not as aquatic as the Lechwe, nor as independent of water as the Kob (Spinage in press). Waterbuck are classified as grazers, but also browse.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The waterbuck inhabits savannas and woodland where, as its name suggests, it is always within reach of permanent water (2). It favours areas where cover, in the form of woods or thickets, lies adjacent to open grassland suitable for grazing (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Waterbuck are very water dependent. They eat a variety of grasses, both medium and short in length. Their diet is very rich in protein. When the amount of available grass is low, waterbuck eat other herbs to satisfy their needs (Estes, 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
18.0 years.

Average lifespan

Status: captivity:
18.7 years.

Average lifespan

Sex: female

Status: wild:
18.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30 years (captivity) Observations: One wild born specimen was about 30 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Male waterbuck mature at six years of age, and females reach maturity in three years. Breeding near the equator is perennial. The generations in these populations are spaced about ten months apart. In northern Africa, the waterbuck calve annually. The gestation period is about eight to eight and a half months. A few days before calving, mothers isolate themselves in thickets. After birth, it takes newborns about half an hour to gain their feet. The young calves remain hidden for two to four weeks (Estes, 1991).

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 9.07 to 9.57 months.

Range weaning age: 6 to 7 months.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual

Average birth mass: 9000 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
771 days.

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Kobus ellipsiprymnus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTCTCAACCAACCACAAAGACATCGGTACCCTATATCTCCTATTTGGTGCTTGAGCCGGCATAGTAGGAACCGCCCTAAGCCTACTAATCCGTGCCGAATTAGGCCAACCTGGAACCCTCCTTGGGGATGATCAAATCTATAATGTCATTGTAACTGCACACGCATTTGTAATAATTTTCTTTATAGTAATACCTATCATAATCGGAGGATTTGGTAATTGACTAGTTCCTCTAATAATTGGCGCTCCCGACATAGCGTTTCCCCGAATAAATAATATAAGTTTTTGACTCCTCCCTCCTTCCTTCTTATTACTTCTAGCATCTTCTATAGTTGAAGCTGGGGCTGGAACAGGCTGAACTGTATATCCCCCTCTAGCAGGCAACTTAGCTCACGCAGGAGCTTCAGTCGACCTAACTATTTTTTCCCTTCACTTAGCAGGTGTTTCCTCAATTCTAGGAGCAATCAATTTTATTACAACAATTATTAATATAAAACCTCCCGCAATATCACAATACCAAACTCCCCTATTCGTATGATCTGTATTAATTACCGCTGTACTTTTACTCCTCTCACTCCCTGTACTAGCGGCCGGTATCACAATACTACTAACAGACCGAAATCTAAACACAACCTTTTTCGACCCAGCAGGAGGAGGGGACCCAATCCTATACCAACACTTATTTTGATTTTTTGGACATCCAGAGGTATATATTCTTATTTTACCCGGATTCGGAATAATCTCTCATATCGTAACTTACTACTCAGGTAAAAAAGAACCCTTCGGGTATATGGGAATGGTCTGGGCTATGATATCAATTGGATTCTTAGGATTTATTGTATGGGCTCATCATATGTTTACAGTTGGAATAGATGTTGACACACGAGCCTATTTCACATCAGCCACAATAATTATTGCTATTCCAACTGGGGTAAAAGTATTTAGCTGATTAGCCACACTTCACGGAGGCAATATCAAATGATCTCCTGCCATAATATGAGCCTTAGGCTTTATTTTCCTCTTTACAGTAGGAGGCTTAACTGGAATTGTTTTAGCAAACTCTTCCCTTGACATTGTTCTTCACGACACATATTATGTAGTTGCACACTTCCACTATGTCTTGTCAATAGGGGCTGTATTCGCTATTATAGGAGGATTCGTTCATTGATTCCCACTATTCTCAGGATATACCCTCAATGATACATGAGCCAAAATTCACTTTGCAATCATATTTGTAGGAGTAAACATAACTTTCTTCCCACAACATTTCCTAGGACTATCTGGCATACCACGACGGTACTCTGATTATCCAGACGCATACACAATATGAAACACTGTTTCATCTATAGGCTCATTTATTTCACTAACAGCAGTAATACTAATAATTTTTATTATCTGAGAAGCGTTTGCATCTAAACGAGAAGTCTCAACTGTAGACCTAACCACAACAAACCTAGAGTGACTAAACGGATGCCCGCCACCATATCACACGTTYGAAGAACCTACATACGTTAACTTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Kobus ellipsiprymnus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

---

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Remains widespread across western, central, eastern and southern Africa, with an estimated total population of about 200,000 over half of which occurred in protected areas. The species is susceptible to poaching and a number of populations have declined. There is no evidence so far that the scale of this decline has reached a level that would qualify the species for Near Threatened or Vulnerable status. However, if declining trends continue then the species may warrant uplisting to Near Threatenedin the near or medium-term future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List 2007. Subspecies: Kobus ellipsiprymnus ellipsiprymnus (ellipsen or common waterbuck) and Kobus ellipsiprymnus defassa (Defassa waterbuck) are both classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Citing various authors East (1999) indicates that population densities can reach high levels within localized areas of favourable habitat, e.g., >10.0/km² in Lake Nakuru National Park. More typical density estimates obtained by aerial surveys of areas where the species is reasonably common are of the order 0.05-0.15/km². Higher densities of 0.2-0.9/km² have been recorded in aerial surveys of a few areas. Ground sun/eys have provided density estimates of the order 0.4-1.5/km² in areas where the species is common.

East (1999) produced a total population estimate of about 200,000. This includes approximately 95,000 Defassa Waterbuck and 105,000 Common. Overall population trend is decreasing for both subspecies.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Waterbuck have been eliminated widely within their former range mainly due to hunting, due to their sedentary nature and fondness for cultivation (Spinage in press). Even though they remain well represented in protected areas, several populations have undergone steep declines (especially those of the Defassa Waterbuck), including those in Queen Elizabeth N. P., Murschison Falls N.P., Akagera N.P., Lake Nakuru N.P., and Comoe N.P. (Spinage in press; and references therein).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The waterbuck has been eliminated from many areas within its large range (2), and is threatened in many other regions by hunting for food, competition with cattle for grazing, and the loss of suitable habitat to human settlements (1) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
More than half the population survives in protected areas, with about 60% of Defassa in protected areas, and more than half of Common in protected areas (plus 13% on private land) (East 1999).

Important populations of the Defassa Waterbuck persist in areas such as Niokolo-Koba (Senegal), Comoe (Côte d'Ivoire), Arly-Singou and Nazinga (Burkina Faso), Mole and Bui (Ghana), Pendjari (Benin), the national parks and hunting zones of North Province (Cameroon), Manovo-Gounda-St. Floris (Central African Republic), Moukalaba (Gabon), Garamba and Virunga (Congo-Kinshasa), the Awash Valley and Omo-Mago-Murule (Ethiopia), Murchison Falls and Queen Elizabeth National Parks (Uganda), Serengeti, Moyowosi-Kigosi, Ugalla River and Katavi-Rukwa (Tanzania) and Kafue (Zambia), but about half of these populations are in decline because of poaching (East 1999).

Important populations of the Common Waterbuck occur in areas such as Tsavo, Laikipia, Kajiado, Lake Nakuru and the coastal rangelands (Kenya), Tarangire and Selous-Mikumi (Tanzania), the Luangwa Valley (Zambia), and Kruger, Hluhluwe-Umfolozi and private land (South Africa) (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

This shaggy-haired antelope thankfully remains widespread in numerous protected areas throughout its range (2) (6), such as Moukalaba Reserve in Gabon and 'W' National Park in Niger (6). However, even within these areas, illegal hunting and habitat degradation can remain a problem, and thus in many countries, the survival of the waterbuck relies on the continuation and improvement of effective protection of these parks and reserves (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Waterbuck are hunted for sport in Africa and are found in zoos throughout the world (Kingdon, 1982).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Waterbuck

The waterbuck (Kobus ellipsiprymnus) is a large antelope found widely in sub-Saharan Africa. It is placed in the genus Kobus of the family Bovidae. It was first described by Irish naturalist William Ogilby in 1833. The thirteen subspecies are grouped under two varieties: the common or ellipsen waterbuck and the defassa waterbuck. The head-and-body length is typically between 177–235 cm (70–93 in) and the average height is between 120 and 136 cm (47 and 54 in). A sexually dimorphic antelope, males are taller as well as heavier than females. Males reach approximately 127 cm (50 in) at the shoulder, while females reach 119 cm (47 in). Males typically weigh 198–262 kg (437–578 lb) and females 161–214 kg (355–472 lb). The coat colour varies from brown to grey. The long, spiral horns, present only on males, curve backward, then forward and are 55–99 cm (22–39 in) long.

Waterbuck are rather sedentary in nature. A gregarious animal, the waterbuck may form herds consisting of six to 30 individuals. These groups are either nursery herds with females and their offspring or bachelor herds. Males start showing territorial behaviour from the age of five years, but are most dominant from the age of six to nine. The waterbuck can not tolerate dehydration in hot weather, and thus inhabits areas close to sources of water. Predominantly a grazer, the waterbuck is mostly found on grassland. In equatorial regions, breeding takes place throughout the year, but births are at their peak in the rainy season. The gestational period lasts for seven to eight months, followed by the birth of a single calf.

Waterbuck inhabit scrub and savanna areas along rivers, lakes and valleys. Due to their requirement for grasslands as well as water, the waterbuck have a sparse ecotone distribution. The IUCN lists the waterbuck as being of Least Concern. More specifically, the common waterbuck is listed as of Least Concern while the defassa waterbuck is Near Threatened. The population trend for both the common and defassa waterbuck is downwards, especially that of the latter, with large populations being eliminated from certain habitats because of hunting and human disturbance.

Taxonomy and etymology[edit]

Rüppell's depiction of the defassa waterbuck (1835)

The scientific name of the waterbuck is Kobus ellipsiprymnus. The waterbuck is one of the six species of the genus Kobus and belongs to the family Bovidae. It was first described by Irish naturalist William Ogilby in 1833. The generic name Kobus is a New Latin word, originating from an African name, koba. The specific name ellipsiprymnus refers to the white elliptical ring on the rump,[2] from the Greek ellipes (ellipse) and prymnos (prumnos, hind part).[3] The animal acquired the vernacular name "waterbuck" due to its heavy dependence on water as compared to other antelopes and its ability to enter into water for defence.[4]

The type specimen of the waterbuck was collected by South African hunter-explorer Andrew Steedman in 1832. This specimen was named Antilope ellispiprymnus by Ogilby in 1833. This species was transferred to the genus Kobusin 1840, becoming K. ellipsiprymnus. It is usually known as the common waterbuck. In 1835, German naturalist Eduard Rüppell collected another specimen, which differed from Steedman's specimen in having a prominent white ring on its rump. Considering it a separate species, Rüppell gave it the Amharic name "defassa" waterbuck and scientific name Antilope defassa.[2] Modern taxonomists, however, consider the common waterbuck and defassa waterbuck a single species, K. ellipsiprymnus, given the large number of instances of hybridisation between the two.[2] Interbreeding between the two takes place in the Nairobi National Park owing to extensive overlapping of habitats.[5]

Evolution[edit]

Not many fossils of the waterbuck have been found. Fossils were scarce in the Cradle of Humankind, occurring only in a few pockets of the Swartkrans.[6] On the basis of Valerius Geist's theories about the relation of social evolution and dispersal in ungulates during the Pleistocene,[7] the ancestral home of the waterbuck is considered to be the eastern coast of Africa - with the Horn of Africa to the north and the East African Rift Valley to the west.[2]

Subspecies[edit]

K. e. ellipsiprymnus
K. e. defassa

37 subspecies of the waterbuck had been initially recognised on the basis of coat colour. They were classified into two groups: the Ellipsen waterbuck group and the Defassa waterbuck group. Owing to the large number of variations in the coat colour in the Defassa waterbuck group, as many as 29 subspecies were included in it; the Ellipsen waterbuck group consisted of eight subspecies. In 1971, however, the number of subspecies was reduced to thirteen (four for the Ellipsen waterbuck group and nine for the Defassa waterbuck group). Though they occur in Zambia as well, their ranges are separated by relief features or by the Muchinga escarpment.[8] The subspecies have been listed below (along with notes about the former subspecies which were recombined into a single subspecies):[2][9]

  • K. e. ellipsiprymnus (Ellipsen waterbuck or common waterbuck) group: Found in southeastern Africa, ranging from southern Somalia to KwaZulu-Natal (South Africa) and inland to the Gregory Rift and Botswana. Includes the following four subspecies:
    • K. e. ellipsiprymnus Ogilby, 1833
    • K. e. kondensis Matschie, 1911 (including K. e. lipuwa, K. e. kulu)
    • K. e. pallidus Matschie, 1911
    • K. e. thikae Matschie, 1910 (including K. e. kuru and K. e. canescens)
  • K. e. defassa (Defassa waterbuck) group: Found west of the Gregory Rift, ranging from Ethiopia west to Senegal and south to Zambia. Includes the following nine subspecies:
    • K. e. adolfi-friderici Matschie, 1906 (including K. e. fulvifrons, K. e. nzoiae and K. e. raineyi)
    • K. e. annectens Schwarz, 1913 (including K. e. schubotzi)
    • K. e. crawshayi P. L. Sclater, 1894 (including K. e. uwendensis, K. e. frommiand K. e. münzneri)
    • K. e. defassa Rüppell, 1835 (including K. e. matschiei and K. e. hawashensis)
    • K. e. harnieri Murie, 1867 (including K. e. avellanifrons, K. e. ugandae, K. e. dianae, K. e. ladoensis, K. e. cottoni, K. e. breviceps, K. e. albertensis and K. e. griseotinctus)
    • K. e. penricei W. Rothschild, 1895
    • K. e. tjäderi Lönnberg, 1907 (including K. e. angusticeps and K. e. powelli)
    • K. e. tschadensis Schwarz, 1913
    • K. e. unctuosus Laurillard, 1842 (including K. e. togoensis)
The white ellipse on the rump of the common waterbuck
The white rump patch on the rump of the defassa waterbuck

Description[edit]

The waterbuck is the largest amongst the six species of Kobus.[2] It is a sexually dimorphic antelope, with the males nearly 7 percent taller than females and around 8 percent longer.[2] The head-and-body length is typically between 177–235 cm (70–93 in) and the average height is between 120 and 136 cm (47 and 54 in).[10] Males reach approximately 127 cm (50 in) at the shoulder, while females reach 119 cm (47 in). The waterbuck is one of the heaviest antelopes. a newborn typically weighs 13.6 kg (30 lb), and growth in weight is faster in males than in females.[2] Males typically weigh 198–262 kg (437–578 lb) and females 161–214 kg (355–472 lb).[11] The tail is 22–45 cm (8.7–17.7 in) long.[3]

The waterbuck is of a robust build. The shaggy coat is reddish brown to grey, and becomes progressively darker with age. Males are darker than females.[12] Though apparently thick, the hair is sparse on the coat. The hair on the neck is, however, long and shaggy. When sexually excited, the skin of the waterbuck secretes a greasy substance with the odour of musk, giving it the name "greasy kob".[2][11] This secretion also assists in water-proofing the body when the animal dives into water.[12] The facial features include a white muzzle and light eyebrows and lighter insides of the ears. There is a cream-coloured patch (called "bib") on the throat. Waterbuck are characterised by a long neck and short, strong and black legs.[3][10] Females have two nipples.[8] Preorbital glands, foot glands and inguinal glands are absent.[13]

The common waterbuck and the defassa waterbuck are remarkably different in their physical appearances. Measurements indicate greater tail length in the latter, whereas the common waterbuck stand taller than the defassa waterbuck.[14] However, the principal differentiation between the two types is the white ring of hair surrounding the tail on the rump, which is a hollow circle in the common waterbuck but covered with white hair in the defassa waterbuck.[11]

The long, spiral horns curve backward, then forward. Found only on males, the horns range from 55 to 99 cm (22 to 39 in) in length.[11] To some extent, the length of the horns is related to the bull's age. A rudimentary horn in the form of a bone lump may be found on the skulls of females.[12]

Ecology and behaviour[edit]

A female herd in the Samburu National Park (Kenya)

Waterbuck are rather sedentary in nature, though some migration may occur with the onset of monsoon. A gregarious animal, the waterbuck may form herds consisting of six to 30 individuals. The various groups are the nursery herds, bachelor herds and territorial males. Herd size increases in summer, whereas groups fragment in the winter months, probably under the influence of food availability.[15] As soon as young males start developing horns (at around seven to nine months of age), they are chased out of the herd by territorial bulls. These males then form bachelor herds and may roam in female home ranges.[3] Females have home ranges stretching over 200–600 hectares (0.77–2.32 sq mi; 490–1,480 acres). A few females may form spinster herds.[16] Though females are seldom aggressive, minor tension may arise in herds.[14]

Males start showing territorial behaviour from the age of five years, but are most dominant from the age of six to nine. Territorial males hold territories 4–146 hectares (0.015–0.564 sq mi; 9.9–360.8 acres) in size. Males are inclined to remain settled in their territories, though over time they may leave inferiot territories for more spacious ones. Marking of territories includes no elaborate rituals - dung and urine are occasionally dropped.[16] After the age of ten years, males lose their territorial nature and replaced by a younger bull, following which they recede to a small and unprotected area.[14] There is another social group, that of the satellite males, which are mature bulls as yet without their own territories, who exploit resources, particularly mating opportunities, even in the presence of the dominant bull. The territorial male may allow a few satellite males into his territory, and they may contribute to its defence. However, gradually they may deprive the actual owner of his territory and seize the area for themselves. In a study in the Lake Nakuru National Park, only 7 percent of the adult males held territories, and only half of the territorial males tolerated one or more satellite males.[17][18]

Territorial males may use several kinds of display. In one type of display, the white patch on the throat and between the eyes is clearly revealed, and other displays can demonstrate the thickness of the neck. These activities frighten trespassers. Lowering of the head and the body depict submission before the territorial male, who stands erect.[8] Fights, which may last up to thirty minutes, involve threat displays typical of bovids accompanied by snorting.[16] Fights may even become so violent that one of the opponents meets its death due to severe abdominal or thoracic wounds.[11] A silent animal, the waterbuck makes use of flehmen response for visual communication and alarm snorts for vocal communication. Waterbuck often enter water to escape from predators which include lions, leopards, cheetahs, African wild dogs and Nile crocodiles (leopards and spotted hyenas prey on juveniles).[14] However, it has been observed that the waterbuck does not particularly like being in water.[19] Waterbuck may run into cover when alarmed, and males often attack predators.[11]

Diseases and parasites[edit]

Waterbuck are susceptible to ulcers, lungworm infection and kidney stones. Other diseases from which these animals suffer are foot-and-mouth disease, sindbis fever, yellow fever, bluetongue, bovine virus diarrhoea, brucellosis and anthrax. The waterbuck is more resistant to rinderpest than are other antelopes. They are unaffected by tsetse flies but ticks may introduce parasitic protozoa such as Theileria parva, Anaplasma marginale and Baberia bigemina. 27 species of ixodid tick have been found on waterbuck - a healthy waterbuck may carry a total of over 4000 ticks in their larval or nymphal stages, the most common among them being Amblyomma cohaerens and Rhipicephalus tricuspis. Internal parasites found in waterbuck include tapeworms, liverflukes, stomachflukes and several helminths.[20][14]

Diet[edit]

The waterbuck is predominantly a grazer.

The waterbuck exhibits great dependence on water. It can not tolerate dehydration in hot weather, and thus inhabits areas close to sources of water. However, it has been observed that unlike the other members of its genus (such as the kob and puku), the waterbuck ranges farther into the woodlands while maintaining its proximity to water.[19] With grasses constituting a substantial 70 to 95 percent of the diet, the waterbuck is predominantly a grazer frequenting grasslands. Reeds and rushes like Typha and Phragmites may also be preferred.[14] A study found regular consumption of three grass species round the year: Panicum anabaptistum, Echinochloa stagnina and Andropogon gayanus. Hyparrhenia involucrata, Acroceras amplectens and Oryza barthii along with annual species were the main preference in the early rainy season, while long life grasses and forage from trees constituted three-fourths of the diet in the dry season.[21]

Though the defassa waterbuck were found to have a much greater requirement for protein than the African buffalo and the Beisa oryx, the waterbuck was found to spend much lesser time on browsing (eating leaves, small shoots and fruits) in comparison to the other grazers. In the dry season about 32 percent of the 24-hour day was spent in browsing, whereas no time was spent on it during the wet season. The choice of grasses varies with location rather than availability; for instance, in western Uganda, while Sporobolus pyramidalis was favoured in some places, Themeda triandra was the main choice elsewhere. The common waterbuck and the defassa waterbuck in the same area may differ in their choices; it has been observed that while the former preferred Heteropogon contortus and Cynodon dactylon, the latter showed less preference for these grasses.[14]

Reproduction[edit]

A female waterbuck with her young

Waterbuck are slower than other antelopes in terms of the rate of maturity.[11] While males become sexually mature at the age of six years, females reach maturity within two to three years.[10] Females may conceive by the age of two-and-a-half years, and remain reproductive for another ten years.[14] In equatorial regions, breeding takes place throughout the year, and births are at their peak in the rainy season. However, breeding is seasonal in the Sudan (south of Sahara), with the mating season lasting four months. The season extends for even longer periods in some areas of southern Africa. Oestrus lasts for a day or less.[11]

Mating begins after the male confirms that the female is in oestrus, which he does by sniffing her vulva and urine. A resistive female would try to bite or even fight off an advancing male. The male exhibits flehmen, and often licks the neck of the female and rubs his face and the base of his horns against her back. There are several attempts at mounting before the actual copulation. The female shifts her tail to one side, while the male clasps her sides with his forelegs and rests on her back during copulation, which may occur as many as ten times.[11][8]

The gestational period lasts for seven to eight months, followed by the birth of a single calf. Twins are rare. Pregnant females isolate themselves and into thickets as parturition approaches. Newborn calves can stand on their feet within half-an-hour of birth.[10] The mother eats the afterbirth. She communicates with the calf by bleating or snorting.[8] Calves are kept hidden for two to three weeks or even two months. At about three to four weeks, the calf begins following its mother, who signals it to do so by raising her tail. Though bereft of horns, mothers will fiercely defend their offspring from predators. Calves are weaned at eight months, following which time they join groups of calves of their own age.[11] Young females remain with their mothers in nursery herds, or may also join bachelor herds.[8] The waterbuck lives to 18 years in the wild and 30 years in captivity.[14]

Distribution and habitat[edit]

Waterbuck inhabit grasslands close to water.

The waterbuck is native to southern and eastern Africa (including countries such as Angola, Botswana, The Democratic Republic of Congo, Ethiopia, Kenya, Namibia, South Africa, Tanzania and Uganda) besides a few countries of western and northern Africa such as Chad, Côte d'Ivoire, Ghana, Mali, Niger, Nigeria and Senegal. Though formerly widespread in sub-Saharan Africa, its numbers have now decreased in most areas.[1]

The common waterbuck is found east of the Eastern African Rift. Its southern range extends to the Hluhluwe-Umfolozi Game Reserve (KwaZulu Natal) and to central Namibia. By contrast, the defassa waterbuck inhabits western and central Africa. The defassa waterbuck occurs west of the Albertine Rift and ranges from Eritrea to Guinea Bissau in the southern Sahel, its most northerly point of distribution being in southern Mali. Its range also stretches east of the Congo basin through Zambia into Angola, while another branch extends to the Zaire River west of the Congo basin. While the common waterbuck is now extinct in Ethiopia, the defassa waterbuck has become extinct in Gambia.[1]

Waterbuck inhabit scrub and savanna areas alongside rivers, lakes and valleys.[12] Due to their requirement for grasslands as well as water, the waterbuck have a sparse distribution across ecotones (areas of interface between two different ecosystems). A study in the Ruwenzori Range showed that the mean density of waterbuck was 5.5 per square mile, and estimates in the Maasai Mara were as low as 1.3 per square mile. It has been observed that territorial size depends on the quality of the habitat, the age and health of the animal and the population density. The greater the age of the animal or the denser the populations, the smaller are the territories. In Queen Elizabeth National Park, females had home ranges 21–61 hectares (0.081–0.236 sq mi; 52–151 acres) in area whereas home ranges for bachelor males averaged between 24–38 hectares (0.093–0.147 sq mi; 59–94 acres). The oldest female (around 18 years old) had the smallest home range.[11]

Threats and conservation[edit]

Horns of a waterbuck displayed at a shop. Hunting for commercial purposes is a major threat to the waterbuck.

The International Union for the Conservation of Nature and Natural Resources (IUCN) lists the waterbuck as of Least Concern. More specifically, the common waterbuck is listed as of Least Concern while the defassa waterbuck is Near Threatened. The population trend for both the common and defassa waterbuck is decreasing, especially that of the latter, with large populations being eliminated from their habitats due to hunting and human settlement. Their own sedentary nature too is responsible for this to some extent. Numbers have fallen in Queen Elizabeth National Park, Murchison Falls National Park, Akagera National Park, Lake Nakuru National Park, and Comoé National Park.[1] Population decrease in the Lake Nakuru National Park has been attributed to heavy metal poisoning in the animals. While cadmium and lead levels were dangerously high in the kidney and the liver, copper, calcium and phosphorus deficiency was noted.[22]

Over 60 percent of the defassa waterbuck populations thrive in protected areas, most notably in Niokolo-Koba, Comoe, Mole, Bui, Pendjari, Manovo-Gounda St. Floris, Moukalaba-Doudou, Garamba, Virunga, Omo, Mago, Murchison Falls, Serengeti, and Katavi, Kafue and Queen Elizabeth National Parks, the national parks and hunting zones of North Province (Cameroon), Ugalla River Forest Reserve, Nazinga Game Ranch, Rukwa Valley, Awash Valley, Murule and Arly-Singou. The common waterbuck occurs in Tsavo, Tarangire, Mikumi, Kruger and Lake Nakuru National Parks, Laikipia, Kajiado, Luangwa Valley, Selous and Hluhluwe-Umfolozi game reserves and private lands in South Africa.[1][14]

References[edit]

  1. ^ a b c d e IUCN SSC Antelope Specialist Group (2008). "Kobus ellipsiprymnus". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. Retrieved 2011-06-15.  Database entry includes justification for why this species is listed as Least concern.
  2. ^ a b c d e f g h i Spinage, C.A. (1982). A Territorial Antelope : The Uganda Waterbuck. London: Academic Press. pp. 4–6, 10, 18–19, 56–63. ISBN 0-12-657720-X. 
  3. ^ a b c d Huffman, B. "Waterbuck". Ultimate Ungulate. Retrieved 21 March 2014. 
  4. ^ Taylor, C.R.; Spinage, C.A.; Lyman, C.P. (1969). "Water relations of the waterbuck, an East African antelope". The American Journal of Physiology 217 (2): 630–4. PMID 5799396. 
  5. ^ Lorenzen, E. D.; Simonsen, B. T.; Kat, P. W.; Arctander, P.; Siegismund, H. R. (14 August 2006). "Hybridization between subspecies of waterbuck (Kobus ellipsiprymnus) in zones of overlap with limited introgression". Molecular Ecology 15 (12): 3787–99. doi:10.1111/j.1365-294X.2006.03059.x. 
  6. ^ Hilton-Barber, B.; Mbeki, L. R. B. (2004). Field Guide to the Cradle of Humankind : Sterkfontein, Swartkrans, Kromdraai & Environs World Heritage Site (2nd revised ed.). Cape Town: Struik. p. 171. ISBN 1-77007-065-6. 
  7. ^ Geist, V. "The relation of social evolution and dispersal in ungulates during the Pleistocene, with emphasis on the old world deer and the genus Bison". Quaternary Research 1 (3): 285–315. doi:10.1016/0033-5894(71)90067-6. 
  8. ^ a b c d e f Skinner, J. D.; Chimimba, Christian T. (2005). The Mammals of the Southern African Subregion (3rd ed.). Cambridge: Cambridge University Press. pp. 681–2. ISBN 0521844185. 
  9. ^ Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 720. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  10. ^ a b c d Newell, T. L. "Kobus ellipsiprymnus (Waterbuck)". University of Michigan Museum of Zoology. Animal Diversity Web. Retrieved 21 March 2014. 
  11. ^ a b c d e f g h i j k Estes, R. D. (2004). The Behavior Guide to African Mammals : Including Hoofed Mammals, Carnivores, Primates (4th ed.). Berkeley: University of California Press. pp. 107–11. ISBN 0-520-08085-8. 
  12. ^ a b c d Kingdon, J. (1989). East African Mammals : An Atlas of Evolution in Africa. Chicago: University of Chicago press. pp. 385–91. ISBN 0-226-43724-8. 
  13. ^ Groves, Colin; Grubb, Peter (2011). Ungulate taxonomy. Baltimore, Md.: Johns Hopkins University Press. p. 195. ISBN 1-4214-0093-6. 
  14. ^ a b c d e f g h i j Kingdon, J.; Hoffman, M. Mammals of Africa (Volume VI): Hippopotamuses, Pigs, Deer, Giraffe and Bovids. Bloomsbury. pp. 461–8. 
  15. ^ Melton, D. A. (1978). Ecology of waterbuck Kobus ellipsiprymnus (Ogilby, 1833) in the Umfolozi Game Reserve. Pretoria: University of Pretoria. 
  16. ^ a b c Spinage, C. A. (2010). "Territoriality and social organization of the Uganda defassa waterbuck Kobus defassa ugandae". Journal of Zoology 159 (3): 329–61. doi:10.1111/j.1469-7998.1969.tb08452.x. 
  17. ^ Wirtz, P. "Territorial defence and territory take-over by satellite males in the waterbuck Kobus ellipsiprymnus (Bovidae)". Behavioral Ecology and Sociobiology 8 (2): 161–2. doi:10.1007/BF00300830. 
  18. ^ Wirtz, P. (2010). "Territory holders, satellite males and bachelor males in a high density population of waterbuck (Kobus ellipsiprymnus) and their associations with conspecifics". Zeitschrift für Tierpsychologie 58 (4): 277–300. doi:10.1111/j.1439-0310.1982.tb00322.x. 
  19. ^ a b Nowak, R. M. (1999). Walker's Mammals of the World (Volume 1) (6th ed.). Baltimore: Johns Hopkins University Press. pp. 1166–70. ISBN 0-8018-5789-9. 
  20. ^ Groocock, C.M.; Staak, C. (1969). "The isolation of Brucella abortus from a waterbuck (Kobus ellipsiprymnus)". The Veterinary Record 85 (11): 318. PMID 4980299. 
  21. ^ Kassa, B.; Libois, R.; Sinsin, B. "Diet and food preference of the waterbuck in the Pendjari National Park, Benin". African Journal of Ecology 46 (3): 303–10. doi:10.1111/j.1365-2028.2007.00827.x. 
  22. ^ Jumba, I. O.; Kisia, S. M.; Kock, R. (2006). "Animal health problems attributed to environmental contamination in Lake Nakuru National Park, Kenya: A case study on heavy metal poisoning in the waterbuck Kobus ellipsiprymnus defassa (Ruppel 1835)". Archives of Environmental Contamination and Toxicology 52 (2): 270–81. doi:10.1007/s00244-005-0241-2. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!