Overview

Brief Summary

Biology

The secretive behaviour of Abbott's duiker, along with its largely nocturnal habits and preference for dense vegetation, has meant that little is known about the ecology and behaviour of this species (1). It has been observed feeding on leaves in the forest understorey, and on vegetation in forest clearings (1), and may feed on fruits and flowers in addition to these green foods (2). An Abbott's duiker has also been seen with an amphibian in its mouth; duikers are known to occasionally capture and feed on live prey (3). The cryptic habits and alertness of Abbott's duiker unfortunately does not protect it entirely from predation. Young Abbott's duikers are probably preyed on by African crowned eagles (Stephanoetus coronatus) and pythons (Python species), while duikers of all ages may fall victim to leopards (Panthera pardus) (1). Lions (Panthera leo) and spotted hyenas (Crocuta crocuta) may also hunt this duiker species in some areas (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This secretive, forest-dwelling antelope was first photographed in the wild as recently as 2003, with the aid of a camera trap (3). It has a stocky body, with short, thick legs and a thick neck, and a glossy coat that varies in colour between dark chestnut-brown and black, with a reddish tinge to the belly and sides (2). The face is more pale grey in colour (2), and a highly distinctive tuft of reddish-brown hair sits between the fairly short, pointed horns (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

A Tanzanian endemic found in a few montane and submontane forests and one lowland forest in the Eastern Arc Mountains, Mount Kilimanjaro and Southern Highlands. Formerly recorded from the forests patches along the top of the Gregory Rift between Babati and Mbulu. In the Eastern Arc, it is currently reported only from West Usambara Mountains and Udzungwa Mountains, while it probably disappeared from the Uluguru and East Usambara Mountains (Wilson 2001; Moyer 2003; Rovero et al. in press). Its status in other Eastern Arc forests is unknown; however, recent surveys failed to detect its presence in North Pare, South Nguru and Uluguru Mountains (F. Rovero, unpubl.). There are old records from the escarpment forests in eastern Njombe District (Swynnerton and Hayman 1951) but the status of these forests is uncertain and under investigation. Wilson (2001) noted that Abbott's Duiker was still present on the Poroto Mountains in 1958 but the status of that population is also uncertain. A small population is still present on Mount Rungwe and the Livingstone Forest within the new Kitulo National Park. The Udzungwa Mountains and Mount Kilimanjaro might hold the only two viable populations (Rovero et al. in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Abbott's duiker occurs only in Tanzania, where it is found in forests in the Eastern Arc Mountains, Mount Kilimanjaro and the Southern Highlands (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Type for Cephalophus spadix True, 1890
Catalog Number: USNM 18965
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): W. Abbott
Locality: Mount Kilimanjaro, Tanzania, Africa
  • Type: True, F. W. 1890 Sep 16. Proc. U.S. Nat. Mus. 13: 227.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found in interior and clearings of mature montane and submontane forest. In Mount Kilimanjaro, this duiker is reported as commonest between 1,300 and 2,700 m asl. (Grimshaw et al. 1995). In the Udzungwa Mountains, Abbott's Duiker has been recorded as low as 300 m in Matundu Forest a large, lowland and semi-deciduous forest (F. Rovero, unpubl.), as well as on the highest peak (Mount Luhombero, 2,600 m; Rodgers and Swai 1988). It is known from disturbed and secondary montane forest and bamboo forest to 2,500 m and occasionally plateau grassland to 2,800 m on Mount Rungwe and in Livingstone-Kitulo in the Southern Highlands (T. Davenport and S. Machaga unpubl.).

Very little is known of Abbott's Duiker ecology and behaviour. This is an extremely secretive species, occurring at low densities and very rarely seen even where it is considered relatively common. Furthermore, it appears to be mainly nocturnal and crepuscular (F. Rovero unpubl.) and, as with most duiker species, probably prefers dense, understory vegetation.

They have been seen browsing forest understory leaves, and marshy vegetation in forest clearing; also one individual photographed with a frog in its mouth.

Abbott's Duikers are known to be predated by leopards (Panthera pardus), and juveniles are probably predated by African Crowned Eagles (Stephanoetus coronatus) and pythons (Python spp). In the Udzungwa Mountains, the Lion (Panthera leo) and the Spotted Hyeana (Crocuta crocuta) are also potential predators (Rovero et al. in press, Moyer unpubl. data).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Primarily an inhabitant of dense forest (5), Abbott's duiker is most common between elevations of 1,300 and 2,700 metres, but may occur up to 4,000 metres above sea level (2). As well as mature forest, Abbott's duiker can be found in disturbed and secondary forest, and occasionally, grasslands (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalophus spadix

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGTTGACTATTCTCAACCAATCACAAAGACATTGGTACCCTGTACCTCCTATTTGGTGCTTGAGCTGGCATAGTAGGGACCGCTCTAAGCCTATTAATCCGTGCTGAATTAGGTCAACCCGGAACCTTACTCGGAGATGACCAAATTTACAACGTAATCGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGTTTCGGCAACTGGCTAGTCCCTCTGATAATTGGTGCCCCAGATATAGCATTTCCCCGAATAAACAACATAAGTTTCTGACTTCTCCCTCCCTCTTTCCTGTTACTCCTAGCATCTTCTATAGTTGAAGCCGGAGCAGGAACTGGCTGAACCGTATATCCCCCTCTAGCAGGTAACCTAGCCCACGCAGGAGCCTCAGTAGACCTAACTATCTTCTCTCTACACCTAGCGGGTGTTTCTTCAATTTTAGGGGCTATTAATTTTATTACTACAATCATTAATATAAAACCCCCTGCAATATCTCAATACCAAACCCCCTTGTTCGTATGATCAGTACTAATTACTGCCGTATTATTACTCCTCTCCCTTCCTGTACTAGCAGCTGGCATTACAATACTATTAACAGACCGAAACTTAAACACGACCTTCTTCGACCCAGCAGGAGGTGGAGACCCTATCCTGTACCAACACTTGTTCTGATTCTTTGGACATCCCGAAGTATATATTCTTATTCTACCCGGATTTGGGATAATCTCTCATATCGTAACCTACTACTCAGGAAAAAAAGAACCATTTGGTTATATGGGAATGGTATGAGCCATGATATCAATTGGATTTCTAGGGTTTATTGTATGAGCCCACCATATATTCACAGTAGGCATAGACGTTGACACACGGGCCTACTTCACATCAGCTACCATAATTATTGCTATTCCTACTGGAGTCAAGGTCTTTAGTTGACTAGCTACGCTTCACGGAGGTAATATTAAATGGTCTCCCGCTATAATATGAGCTCTGGGCTTCATTTTCCTTTTCACAGTCGGAGGCTTAACAGGAATTGTTTTAGCCAACTCCTCTCTCGATATTGTCCTTCACGATACATATTATGTAGTTGCACACTTCCACTACGTACTATCAATAGGAGCCGTGTTCGCTATTATGGGGGGATTCGTACATTGATTCCCACTATTCTCAGGTTATACCCTCAACGCTACATGAGCTAAAATCCACTTTGTAATCATATTTGTAGGCGTAAACATAACCTTCTTCCCACAACACTTCTTAGGATTATCTGGCATACCACGACGATACTCTGACTACCCAGACGCATACACAATATGAAATACTATTTCATCTATGGGCTCATTCATCTCACTAACAGCAGTCATACTAATAATTTTTATTATCTGAGAAGCATTCGCATCTAAACGAGAAGTTCTAACTGTAGACTTAACCACGACAAATCTAGAATGACTAAACGGATGCCCTCCACCATATCATACATTCGAAGAACCTACATATGTTAATCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalophus spadix

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Moyer, D.C., Jones, T. & Rovero, F.

Reviewer/s
Mallon, D.P. & Plowman, A. (Antelope Red List Authority)

Contributor/s

Justification
Population data are scarce, but best estimates indicate fewer than 1,500 individuals in four disparate and fragmented subpopulations. This is based on estimated maximum density at sites were it is locally common and total area of suitable habitat available at all sites were its presence has been recently confirmed. In recent years, Abbott's Duiker is thought to have become locally extinct in several locations from where it had been recorded previously.

History
  • 2007
    Endangered
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Although data are scarce, the total population is probably less than 1,500 individuals. Maximum densities in the Udzungwa Mountains are estimated at 1.3 individuals/km² (Rovero et al. in press), i.e. this species is at low densities even where locally common.

Udzungwa Mountains subpopulations:
Mwanihana Forest (177 km², 300-2,300 m, within Udzungwa Mountains National Park): locally common.
Luhombero Forest (250 km², 1,350-2,500 m, West Kilombero Forest Reserve/Udzungwa Mountains National Park): locally common (Jones, unpubl.).
Uzungwa Scarp Forest Reserve (180 km², 300-2,050 m): rare.
Matundu Forest Reserve (176 km², 300-1,000 m): rare.
Ukami forest (6 km², 1,100-1,600 m): locally common.
Nyumbanitu Forest Reserve (49 km², 1,350-2,500 m): scarce.

Southern Highlands: very rare, with some 40 individuals estimated in Mount Rungwe and adjacent Livingstone forest (T. Davenport and S. Machaga, unpubl.). They may also persist in a few other Southern Highland forests currently being surveyed.

A new population, estimated at a maximum of 50 individuals, was found in 2006 in the southern Rubeho Mountains (?Ilole forest, 30 km²), where the species is locally common (F. Rovero, unpubl.).

Population abundance in Mount Kilimanjaro and West Usambara is unknown.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
A major threat to this species is snaring, which is taking place at low level within Udzungwa Mountains National Park (Mwanihana Forest), where there is a relatively high level of protection. Snaring has also been reported from other sites (Uzungwa Scarp Forest Reserve, Southern Highlands, West Usambara Mountains), but at higher levels. Abbott's Duiker is also affected by loss of habitat due to agricultural encroachment, and selective logging. Virtually nothing is known of the ecology of this species, but selective logging may be predicted to adversely affect a duiker of the body size and low density of Abbott's Duiker (Struhsaker 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Like many other duikers, Abbott's duiker is being impacted by a combination of hunting and habitat destruction (1) (2). Hunted for its meat, Abbott's duiker falls prey to snares laid in the forests it inhabits, even within so-called protected areas (1) (6), while suitable habitat is gradually encroached upon by agriculture and logging (1) (2). These human activities have resulted in the extinction of Abbott's duiker in areas where it once occurred (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Udzungwa Mountains National Park is patrolled by anti-poaching rangers, and zero utilization of animals is permitted. However, the capture of Abbott's Duiker in snares is still occurring in Mwanihana Forest within the Park. With exception of Mount Kilimanjaro, where most of the forests were recently included in the National Park, there is no management in all the other sites.

Current work in the Southern Highlands employing hunters in environmental education initiatives in exchange for stopping hunting, has met with some success. It is too early to say if this will have a significant positive impact on Abbott?s duiker populations, although it may prove a valuable model for conservation at other sites and is being carried out alongside the use of Abbott's Duiker as a flagship species in village education programmes.

Major conservation management measures that would enhance the protection of Abbott's Duiker are the expansion of the Udzungwa Mountains N.P. to include important forests currently unprotected, in particular Uzungwa Scarp, Iyondo and Matundu. Also necessary is the inclusion of Mount Rungwe within the new Kitulo N.P. and greater law enforcement enacted in those areas that are currently not adequately protected (such as Southern Highland forests, Usambara and Uluguru Mountains). Critical forest connections, such as the degraded Bujingijila corridor linking Mount Rungwe to Livingstone forest in Kitulo, must be adequately protected.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Although the Abbott's duiker occurs within several protected areas, such as the Kilimanjaro National Park, Udzungwa Mountains National Park, and New Dabaga/Ulangambi Forest Reserve, this does not, as mentioned previously, completely protect this duiker from the threats of habitat loss and hunting (1) (2). In the Southern Highlands of Tanzania, there are current efforts to employ hunters in environmental education initiatives in exchange for the cessation of hunting. The Abbott's duiker is also being used as a flagship species in village education programmes. This will hopefully be beneficial for many forest-dwelling animals, including the Abbott's duiker (1). The expansion of certain protected areas to incorporate other important forests inhabited by Abbott's duiker (1), in addition to the enforcement of hunting bans within those areas (6), may be essential if this Endangered duiker is to survive.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Abbott's duiker

Abbott's duiker (Cephalophus spadix, also known as minde in Swahili) is a large, forest-dwelling duiker (small antelope) found only in a few scattered enclaves in Tanzania. It may be a subspecies of the yellow-backed duiker. It is very rare and the first photograph was taken as recently as 2003.

Characteristics[edit]

Abbott's duikers stand around 65 cm (26 in) tall at the shoulder and weigh about 55 kg (121 lb). This duiker has a glossy, dark brown coat which is lighter on the underside. The face is paler and gray in color, with a large red tuft on the forehead; the horns are thin and short (8 to 12 cm (3.1 to 4.7 in)).[citation needed] The secretive behavior of Abbott’s duiker, along with its largely nocturnal habits and preference for dense vegetation, means little is known about the ecology and behavior of this species. It has been observed feeding on leaves in the forest understory, and on vegetation in forest clearings, and may feed on fruits, flowers and moss. An Abbott’s duiker has also been seen with a frog in its mouth; duikers are known to occasionally capture and feed on live prey. The cryptic habits and alertness of Abbott’s duiker unfortunately does not protect it entirely from predation. Young Abbott’s duikers are probably preyed on by African crowned eagles (Stephanoetus coronatus) and pythons (Python species), while duikers of all ages may fall victim to leopards (Panthera pardus). Lions (Panthera leo) and spotted hyenas (Crocuta crocuta) may also hunt this duiker species in some areas

Habitat[edit]

Abbott's duiker is endemic to Tanzania, in the Eastern Arc Mountains, Mount Kilimanjaro, and South Highlands in scattered populations. They live mainly in wet forests and swamps between 1,700 and 2,700 m above sea level, but can sometimes wander to much higher altitudes at 4,000 m. They eat mainly fruit and possibly other plant matter. Abbott's duikers are nocturnal, spending the days at rest in thickets. They form regular pathways through the undergrowth, making them relatively easy to find. If threatened, they generally try to run, though they have been known to kill pursuing dogs when left with no escape route.[citation needed]

Status[edit]

Less than 1,500 Abbott's duiker are estimated to be left in the world, with no captive population. They are threatened by habitat destruction and hunting.[1]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!