Overview

Distribution

Range Description

This duiker formerly occurred throughout the band of savanna woodlands that stretches across West and Central Africa from Senegal and The Gambia to the Nile Valley (East 1999; Kingdon and Hoffmann in press). Formerly widespread in north-western Uganda, as far east as the Albert Nile (East 1999); a small relic population was discovered in the Bugungu G.R., immediately south of the Murchison Falls N.P. (Allan 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Cephalophus rufilatus, or red-flanked duikers, are found throughout central, western Africa. While members of the genus Cephalophus are common throughout most African forests, red-flanked duikers are one of only a few duiker species which have distributions outside African equatorial rain forests.

Biogeographic Regions: ethiopian (Native )

  • Kingdon, J. 1984. East African Mammals: An atlas of evolution in Africa. Chicago: University of Chicago Press.
  • Estes, R. 1991. The behavior guide to African mammals: Including hoofed mammals, carnivores and primates. Berkeley: University of California Press.
  • Huffman, B. 2006. "The Ultimate Ungulate Page" (On-line). Cephalophus rufilatus. Accessed March 06, 2006 at http://www.ultimateungulate.com/Artiodactyla/Cephalophus_rufilatus.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Red-flanked duikers have an orange-red coat which is lighter on the ventral side. They have a dark grey-black stripe along their dorsal midline, which extends from the tail to the shoulders and continues across the face onto the muzzle. The lower legs are also dark grey-black in color and give the animal the appearance of wearing stockings.

Full grown males possess short black horns which project straight back from the forehead. Though usually absent, horns may also be present in females. If present, they are shorter on average than in males. In males horn length varies from 6 to 9.5 cm and from 3 to 4 cm in females.

Cephalophus species, in general, are unique in that they possess preorbital glands that differ in their anatomy from other African antelope. These glands are located beyond the eyes on the snout (unlike other antelope) and form visible bulges in the cheeks. Red-flanked duikers have the largest preorbital glands of all duiker species.

Range mass: 6 to 14 kg.

Range length: 60 to 80 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
An inhabitant of the savanna woodlands of west and central Africa. In Sierra Leone, it was formerly the commonest duiker species in the northern savanna and in farm bush on its southern edges; the replacement of primary forest with farm bush and other secondary vegetation has enabled this species to expand its range southwards to some extent (East 1999).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red-flanked duikers thrive along the transition zones of savanna-forests and along drainage lines. These habitats are characterized by tall grass (primarily elephant grass, Pennisetum purpureum) and shrubs, (Capparis, Acanthus arboreus and others) and provide ample grazing opportunities and suitable cover from predators.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Red-flanked duikers are herbivorous and have been described as browsers. They feed primarily within a meter of the ground and do not spend considerable time in any area. Their diet consists mainly of leaves and fruits, but also includes flowers and twigs. One study of the stomach contents of C. rufilatus indicated a preference for feeding on fruits in secondary forest patches of the moist savanna.

Red-flanked duikers feed on the following plant species: Phoenix reclinata, Nauclea latifolia, Ficus capensis, Iliostigma thonningii, Mucuna flagellipes, Spondias mombin, Pterocarpus erinaceous, Bridelia micrantha, Vitex domiana, Annoa senegalensis, Phyllanthus muellerianus, Cola milleni, Fiscus capensis, Blighia sapida, and Gmellina aborea.

Plant Foods: leaves; fruit; flowers

Primary Diet: herbivore (Folivore , Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Red-flanked duikers feed heavily on the fruit bearing species Phoenix reclinata, Nauclea latifolia, and Ficus capensis. It is likely that they are important seed dispersers of these plant species.

Species in the genus Cephalophus are also hosts to several parasite species. The blood parasite Anaplasma marginale is commonly carried by red-flanked duikers. Ticks such as Rhipicephalus geigyi and Amblyomma variegatum, are also carried by members of the genus Cephalophus. Interestingly, one study of tick reproduction found that ticks extracted from red-flanked duikers produce more eggs than those extracted from cattle in the same region.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • Dipeolu, O., O. Akinboade. 1984. Studies on ticks of vererinary importance in Nigeria XI. Observations on the biology of ticks detached from the Red-flanked duiker (Cephalophys Rufilatus) and parasites encountered in their blood. Veterinary Parasitology, 14: 87-93.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Red-flanked duikers are preyed on by leopards (Panthera pardus), eagles (Harpyhaliaetus coronatus), pythons (Python reticulatus) and humans. Among all of their predators, humans take the greatest number. Red-flanked duikers rely heavily on early detection of threats and have highly sensitive hearing. They dive into dense undergrowth when threats are detected.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Red-flanked duikers have acute senses of hearing and smell, which are superior to those of humans and can make observations of red-flanked duikers challenging. They emit a shrill bark to communicate with their young and when threatened. Red-flanked duikers are also sensitive to territorial scent marking by other members of the species.

Communication Channels: visual ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average lifespan of red-flanked duikers in the wild is five years and is most likely limited by predation. Red-flanked duikers have lived to be over 15 years old in captivity.

Range lifespan

Status: wild:
10 (high) years.

Range lifespan

Status: captivity:
15 (high) years.

Average lifespan

Status: wild:
5 years.

Average lifespan

Status: captivity:
10 years.

Average lifespan

Status: captivity:
15.2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.2 years (captivity) Observations: One captive specimen was still alive after 15.2 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating behaviors of red-flanked duikers is not described in detail in the literature. Mating behaviors of species in the genus Cephalophus, however, are relatively homogenous. Courtship is characterized by following, biting, and licking of the female's genitalia by the male from a few days prior to estrus (which lasts a day), and until copulation. During estrus, female duiker squat unusually low while urinating. When urine-testing for pheromones, female urine elicits a response in which males wrinkle their upper lips in a distinctive grimace. Female duikers demonstrate sexual receptivity by swelling and reddening of the vulva.

Among captive male duikers, competition for mates takes the form of charging, aggressive chasing, head butting, and biting. Male competitive aggression in the wild has not been observed perhaps because individual home ranges are typically widely separated.

Mating System: monogamous

Red-flanked duiker births have been observed in the dry season and the early wet season. Red-flanked duikers typically give birth to a single young. Gestation lasts between 223 and 245 days. Birth weights average around 1000 g.

Newborn red-flanked duikers independently seek cover amid vegetation, exposing themselves only when nursing. Female red-flanked duikers mark their young with secretions from their preorbital glands directly after birth and when grooming.

Breeding interval: Females may give birth up to once per year.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 7.43 to 8.17 months.

Average age at sexual or reproductive maturity (female): 9 months.

Average age at sexual or reproductive maturity (male): 9 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 943 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
270 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
270 days.

Post-gestation parental investment in the genus Cephalophus is relatively low. Outside of nursing, red-flanked duikers occasionally groom their young and nurse them. They otherwise leave the young under cover of vegetation. They are weaned and feed independently at a weight of approximately 9 kg.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalophus rufilatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGCTGACTATTCTCAACCAATCACAAAGACATTGGTACCTTATATCTCCTGTTCGGTGCTTGAGCTGGCATAGTAGGAACCGCTCTAAGTTTATTAATCCGCGCTGAATTAGGTCAACCTGGGACCTTACTCGGAGACGACCAAATTTACAACGTAATTGTAACCGCACATGCATTCGTAATAATTTTCTTCATGGTAATACCTATTATAATTGGAGGCTTCGGCAACTGACTAGTCCCTCTGATGATCGGTGCCCCAGATATAGCATTTCCCCGAATAAATAACATAAGTTTCTGACTTCTCCCTCCCTCCTTCTTACTACTCCTGGCATCTTCTATAGTTGAAGCTGGAGCAGGAACTGGCTGAACCGTATATCCCCCTCTAGCAGGTAACCTGGCCCATGCAGGAGCCTCAGTAGACCTGACCATCTTCTCTTTACACCTAGCGGGTGTCTCTTCAATTTTAGGGGCTATTAATTTTATTACTACAATTATTAATATGAAACCCCCTGCAATATCTCAGTACCAGACTCCCTTATTTGTATGATCAGTGCTAATCACTGCCGTGTTATTACTTCTCTCCCTCCCTGTATTAGCAGCTGGTATTACAATACTACTAACTGACCGAAATCTGAACACAACCTTCTTCGACCCAGCAGGAGGTGGGGACCCTATCCTATACCAACACCTATTCTGATTCTTCGGACACCCCGAAGTGTATATTCTTATTCTACCTGGATTTGGGATAATCTCTCACATCGTGACCTACTACTCGGGAAAAAAAGAACCGTTCGGATATATAGGAATAGTATGAGCTATAATATCAATCGGATTTCTAGGGTTTATTGTATGAGCCCACCATATATTTACAGTAGGTATAGACGTCGACACACGAGCCTACTTTACATCAGCCACCATAATTATTGCTATCCCTACTGGAGTAAAAGTCTTCAGCTGACTAGCTACACTTCACGGAGGTAATATCAAATGATCCCCTGCTATAATATGAGCCCTGGGCTTCATCTTCCTTTTCACAGTTGGAGGCCTAACAGGAATTGTTCTAGCTAACTCTTCTCTCGATATTGTTCTTCACGACACATATTATGTAGTCGCACATTTCCACTATGTACTGTCAATAGGAGCTGTGTTCGCTATTATAGGAGGATTCGTACATTGATTCCCACTATTCTCAGGCTACACCCTTAATACTACATGAGCCAAAATCCATTTTGTAATCATATTTGTAGGTGTAAACATAACTTTCTTCCCACAACATTTCTTAGGATTATCTGGCATACCACGACGATACTCCGACTACCCAGATGCATACACAATATGAAATACTATTTCATCTATAGGCTCATTCATCTCACTAACAGCGGTCATACTAATAATTTTTATCATCTGAGAAGCATTCGCATCTAAACGAGAAGTTCTAACCGTAGACCTAACCACAACAAACTTAGAATGACTAAACGGATGCCCCCCACCATACCACACATTTGAAGAACCCACATATGTTAATCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalophus rufilatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the species still occurs quite widely within its historical range and remains reasonably common (with a total population estimated at nearly 200,000). While the overall distribution and abundance of the Red-flanked Duiker will inevitably decline further with the expansion of settlement and increased hunting for bushmeat, its resilience will probably enable it to persist widely where hunting pressures are not severe. Its long-term conservation status should not deteriorate as long as it continues to be well represented in protected areas and hunting concessions throughout most parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Currently (April 2006) C. rufilatus is listed as lower risk by the IUCN. Hunting for bush meat and deforestation pose the greatest threat to wild populations of red-flanked duikers. To date, there have been no conservation projects aimed at protecting populations of this species in the wild.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Published density estimates are summarized by East (1999), Wilson (2001) and Kingdon and Hoffmann (in press). East (1999) produced a total population estimate of 170,000. The population trend is gradually decreasing as human populations and hunting pressures continue to grow.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The Red-flanked Duiker withstands heavy hunting pressure and probably still occurs reasonably widely throughout much of its historical range. It is common in most of the protected areas and most of the forest reserves within its range where suitable habitat remains, including areas where poaching has greatly reduced or eliminated most other antelope species. However, while it is more resilient than most other antelopes in the savanna zone, its numbers are generally in decline because of human disturbance and severe meat hunting pressures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Red-flanked Duiker is well represented in protected areas (about half of the total population occurs in and around protected areas), generally in stable populations, with relatively large numbers in areas such as Niokolo-Koba (Senegal), Comoe, Haut Bandama and Marahoue (Ivory Coast), Mole, Bui and Digya (Ghana), Pendjari and W (Benin), Bouba Ndjida, Benoue and Faro (Cameroon), Manovo-Gounda-St. Floris, Bamingui-Bangoran and Sangba (Central African Republic) and Garamba (Congo-Kinshasa) (East 1999; Kingdon and Hoffmann in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of red-flanked duikers on humans, though they may occasionally browse on farmland.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Red-flanked duikers are hunted for their meat, pelts and for sport. The predictability of their flight behavior (see Behavior section) has led them to be exploited by hunters who snare them in nets placed in shrubs and tall grass.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-flanked duiker

The red-flanked duiker (Cephalophus rufilatus) is a species of small antelope found in western and central Africa in countries as far apart as Senegal and Sudan.[2] Red-flanked duikers grow to almost 15 in (35 cm) in height and weigh up to 31 lb (14 kg). They have russet coats, with greyish-black legs and backs, and white underbellies. They feed on leaves, fallen fruits, seeds and flowers, and sometimes twigs and shoots. The adults are territorial, living in savannah and lightly wooded habitats, and the females usually produce a single offspring each year. They have lifespans of ten to fifteen years in captivity.

Description[edit]

The red-flanked duiker is one of the smallest species of antelope, growing to a height of about 34 to 37 centimetres (13 to 15 in) with a weight of around 12 to 14 kilograms (26 to 31 lb). The head and body are blackish-grey near the spine gradually blending into a reddish-brown colour on the neck and flanks. There are small white markings on the ears and snout and a dark streak runs along the centre of the face. A tuft of black hairs grows between the horns and further coarse dark hairs grow along the top of the neck. The legs are bluish-grey.[3] The sexes are in general similar in appearance but males have short backward-pointing horns up to 9 centimetres (3.5 in) long. Females are often hornless, or may have shorter horns. Both males and females have large preorbital glands on their snout in front of their eyes which form bulges in their cheeks. These are common to all members of the genus Cephalophus but they are larger in the red-flanked duiker than in other species.[4]

Distribution and habitat[edit]

The red-flanked duiker is native to West and Central Africa where its range extends from Senegal and the Gambia in the west to Sudan and the Nile Valley in the east. Its main habitat is open savannah woodlands[1] and the margins of forests but it also occurs in river basins with elephant grass (Pennisetum purpureum) or thick shrubby vegetation such as caperbushes (Capparis spp.) and tree acanthus (Acanthus arboreus).[4]

Behaviour[edit]

Red-flanked duikers are territorial and mainly solitary, with a single antelope or a pair occupying a small territory for a few months and then moving elsewhere. The territory is marked with secretions from their preorbital glands.[4] The duikers are most active in the early morning and shortly before dusk. They move about while browsing and keep a sharp lookout for possible predators; if startled, they lower their heads and dive into the nearest dense area of vegetation. They are hunted by a number of predators including leopards (Panthera pardus), crowned eagles (Stephanoaetus coronatus) and African rock pythons (Python sebae) but are also hunted by man, who probably kills more duikers than the other predators combined.[4]

The red-flanked duiker feeds on leaves and flowers and the fruits that fall from trees, and also browses on twigs growing within one metre (yard) of the ground. Favoured food species include the wild date palm (Phoenix reclinata), the African peach (Nauclea latifolia), the Cape fig (Ficus capensis), the wild bauhinia (Piliostigma thonningii), the adanme (Mucuna flagellipes), the hog plum (Spondias mombin), the barwood (Pterocarpus erinaceus), the mitzeeri (Bridelia micrantha), the wild African black plum (Vitex doniana), the African custard-apple (Annona senegalensis), the leafflower (Phyllanthus muellerianus), the monkey cola (Cola millenii), the ackee (Blighia sapida) and the beechwood (Gmelina arborea). As the red-flanked duiker eats the fruit of the Cape fig, African peach and wild date, it swallows the seeds. These pass through the gut and are present in the droppings and this is likely to be an important means of seed dispersal for these species.[4]

Both male and female red-flanked duikers mature at about nine months of age. The female comes into oestrus once a year and the gestation period is about eight months, with a single offspring being born in the dry season or near the start of the wet season. The newly-born juvenile weighs about 1 kilogram (2.2 lb) and quickly makes its way into concealing vegetation, only coming out when its mother returns to nurse it. Immediately after birth and when grooming its infant, the mother marks it with the secretions from her preorbital glands. It is weaned when it weighs about 9 kilograms (20 lb) and there is no further parental involvement.[4]

Status[edit]

The red-flanked duiker is an adaptable species, and the removal of trees by logging and the conversion of its natural habitat into more open savannah and farmland has allowed it to increase its range. It is fairly common in the areas in which it is found though numbers are decreasing in general due to severe hunting pressure.[1] The red-flanked duiker was one of the four most frequent species of bushmeat on sale in the Republic of Guinea, along with Maxwell's duiker (Cephalophus maxwelli), the greater cane rat (Thryonomys swinderianus) and the bushbuck (Tragelaphus scriptus).[5] However it occurs in a number of reserves and protected areas where it is less liable to be killed for meat and the International Union for Conservation of Nature in its Red List of Threatened Species lists it as being of "Least Concern".[1]

References[edit]

  1. ^ a b c d IUCN SSC Antelope Specialist Group (2008). Cephalophus rufilatus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 2009-01-16.
  2. ^ Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 714. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ "Red-flanked duiker". Woodland Park Zoo. Retrieved 2013-09-23. 
  4. ^ a b c d e f Hanson, Benjamin (2006). "Cephalophus rufilatus: Red-flanked duiker". Animal Diversity Web. University of Michigan. Retrieved 2013-09-23. 
  5. ^ Brugiere, David; Magassouba, Bakary (2009). "Pattern and sustainability of the bushmeat trade in the Haut Niger National Park, Republic of Guinea". African Journal of Ecology 47 (4): 630–639. doi:10.1111/j.1365-2028.2008.01013.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!