Overview

Brief Summary

Biology

Ogilby's duiker feeds on a variety of leaves, shoots, seeds and fruits (2) (4) (10), and, like other duikers, it may follow groups of fruit-eating birds and monkeys through the forest, feeding on dropped fruit (4). Perhaps surprisingly, duikers are also known to occasionally capture small birds and mammals (4). Duikers are thought to play an important ecological role in the forest as seed dispersers and as a significant part of the diet of predators such as leopards (11). Considered mainly diurnal (10), Ogilby's duiker, like other duikers, is likely to be found either alone or in pairs (4) (7). Interestingly, no Ogilby's duikers are known to be kept in captivity (9). This, together with its secretive lifestyle and inaccessible habitat, means little is currently known about the biology of this elusive species (6). However, it is likely that Ogilby's duiker is monogamous, with a male and female occupying a relatively small home range (5). Female duikers typically bear a single calf, which remains well hidden in the vegetation for the first few weeks of life (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

A small, secretive antelope, Ogilby's duiker has a stocky body, an arched back, overdeveloped hindquarters, and short, slender legs, all adaptations for moving easily through dense undergrowth (4) (5) (6). The name “duiker” comes from an Afrikaans word meaning “diver”, these antelopes being named for their habit of diving into cover when disturbed (4) (7). Sexes are similar in appearance and both possess short, spike-like horns, which are curved and strongly corrugated (2) (4) (5). The coat is reddish orange, with a red rump, a paler underside, and a black line that runs along the back from the shoulder to the tail, which is short and tufted (2) (4). C. o. crusalbum possesses distinctive white lower legs that distinguish it from all other duikers (8). Like other duiker species, Ogilby's duiker has large scent glands, known as pre-orbital glands, beneath each eye. These are most likely used to scent-mark the territory or even to mark other individuals (4). Somewhat similar in appearance to the bay duiker, Cephalophus dorsalis, Ogilby's duiker can be distinguished by its longer, more slender legs (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Ogilby’s Duiker is known from four separate populations within the equatorial forest zone (East 1999; Wilson 2001; Kingdon in press):

C. o. brookei (Brooke's Duiker) ranges in Sierra Leone, south-east Guinea, Liberia, southern Côte d’Ivoire and Ghana, west of the Volta River;

The nominate subspecies occurs on Bioko Island, and then on the mainland in south-east Nigeria and south-west Cameroon;

The white-legged form of Ogilby’s Duiker, C. o. crusalbum, occurs in Gabon, mostly south of the Ogooué River, and is reported to occur in north-west Republic of Congo.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Ogilby's duiker is known from four separate locations within the equatorial forest zone of West Africa. C. o. brookei is found from Sierra Leone to Ghana, C. o. ogilbyi is found on Bioko Island (Gulf of Guinea) and, on the mainland, in parts of Nigeria and Cameroon, and C. o. crusalbum is found in Gabon and in northwest Republic of Congo (1) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Its preferred habitat is primary moist lowland forest, yet it is common in forest patches within the forest-savanna mosaic. It has been recorded in areas with a mix of high forest and logged forest, or high forest and secondary forest (but seems to be very rare in highly modified secondary forest).

On Bioko, the species is not only present in lowland forest but also in the island’s montane forest (perhaps to elevations exceeding 2,000 m) and in the higher altitude Schefflera forest zone, habitats which are normally occupied by other duiker species on the mainland (East 1999).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species mainly inhabits moist lowland forest. Although Ogilby's duiker prefers primary rather than secondary forest (1) (9), it has occasionally been reported to 'raid' farmland areas from nearby forest (10). On Bioko Island, Ogilby's duiker has also been recorded from higher altitude montane forest, possibly as a result of the absence of other duiker species that would normally occupy this habitat on the mainland (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalophus ogilbyi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCGTCAACCGCTGACTATTCTCAACCAATCACAAAGACATTGGTACCCTATATCTCTTATTTGGTGCTTGAGCTGGCATAGTAGGAACCGCTCTAAGCTTATTAATCCGTGCTGAATTAGGTCAACCTGGAACCTTGCTCGGAGATGACCAAATTTACAACGTAATCGTAACCGCACATGCATTCGTAATAATCTTCTTCATAGTAATACCCATCATAATTGGAGGCTTCGGCAACTGGTTGGTTCCCCTGATAATTGGTGCCCCAGATATAGCATTTCCCCGAATGAAYAACATAAGTTTCTGACTTCTCCCTCCCTCTTTCCTGCTACTCTTAGCATCTTCTATAGTAGAAGCTGGGGCAGGAACTGGCTGAACCGTATACCCCCCTCTAGCAGGCAATCTAGCCCATGCGGGAGCCTCAGTAGACCTAACCATCTTCTCTCTTCACCTRGCAGGTGTTTCTTCAATTCTAGGAGCCATTAATTTTATCACCACAATTATTAATATGAAGCCCCCTGCAATATCTCAATACCAAACCCCCTTATTTGTATGATCAGTACTAATCACTGCCGTRTTATTACTTCTCTCCCTTCCTGTACTAGCAGCTGGTATTACAATATTACTAACAGACCGAAATTTAAATACGACCTTCTTCGACCCAGCAGGAGGCGGAGACCCTATCCTGTACCAACACTTATTCTGATTCTTCGGACACCCCGAAGTGTATATTCTCATTYTACCCGGATTTGGAATAATCTCTCACATCGTAACCTAYTATTCAGGGAAAAAAGAACCATTYGGATACATAGGAATAGTATGGGCTATAATATCAATYGGATTTYTAGGATTCATTGTATGGGCCCACCACATATTCACAGTGGGTATAGACGTCGACACACGGGCCTACTTCACATCAGCCACCATAATYATTGCTATCCCCACTGGAGTAAAAGTCTTTAGYTGATTAGCTACACTTCACGGGGGTAATATTAAATGATCACCCGCTATAATATGAGCTCTGGGCTTCATTTTCCTTTTCACAGTCGGAGGCYTAACAGGAATTGTTCTAGCCAACTCTTCTCTTGACATCGTTCTTCATGACACATATTATGTAGTTGCACACTTCCACTATGTATTGTCAATAGGAGCTGTGTTTGCTATTATAGGAGGATTTGTACACTGATTCCCATTATTCTCAGGCTACACCCTCAACACTACATGAGCCAAGATCCACTTTGTAATTATATTTGTAGGTGTAAACATAACTTTCTTCCCACAACATTTCCTCGGATTATCTGGTATGCCACGACGATACTCCGACTACCCAGACGCATACACAATATGAAATACTATCTCATCTATAGGCTCTTTCATCTCACTAACAGCAGTCATACTAATAATTTTTATTATCTGAGAGGCATTCGCATCCAAACGAGAAGTCCTAACTGTGGACCTAACTACGACAAACCTAGAATGACTAAACGGGTGCCCTCCACCATATCACACATTTGAAGAGCCTACATATGTCAATCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cephalophus ogilbyi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Based on figures in East (1999), one subspecies, containing about half of the total numbers remains stable while the other two are declining. It is unlikely therefore that the decline for the species as a whole has yet reached the threshold for listing as Near Threatened. However, habitat degradation and destruction and over-hunting are ongoing threats and if current trends continue, the status of Brooke’s Duiker and the nominate subspecies will decline further until both become confined to a few effectively protected areas such as Tai and Korup.

History
  • 1996
    Lower Risk/near threatened
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1) and listed on Appendix II of CITES (3). Three subspecies are recognised: Cephalophus ogilbyi brookei (Brooke's duiker) and Cephalophus ogilbyi ogilbyi (Ogilby's duiker) are both classified as Vulnerable (VU) and Cephalophus ogilbyi crusalbum (white-legged duiker) is classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
East (1999) produced an estimated total population of 35,000, including an estimated 5,000 Brooke’s Duikers, 12,000 C. o. ogilbyi and 18,000 of the white-legged form. Populations are probably decreasing throughout the ranges of Brooke’s Duiker and the nominate subspecies, with a few possible exceptions such as some protected areas. The White-legged Duiker’s numbers are probably stable in considerable parts of its range in Gabon and north-western Congo where human population densities are very low.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Threatened by habitat destruction (due to agriculture, human settlement, and logging) and intense hunting pressure, mainly by snaring for bushmeat. Although hunting takes place throughout the range, this is particularly severe on Bioko (see summary of bushmeat studies in Kingdon in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The main threats to Ogilby's duiker are habitat degradation and destruction as a result of agriculture, human settlement and logging, as well as over-hunting for the bushmeat trade (1) (2). Hunting is a particular threat to the population of C. o. ogilbyi on Bioko Island (1) (9), and, although still common in the island's protected areas, such as Gran Caldera de Luba (9), monitoring of the bushmeat entering the markets here in 2007 found a worrying increase in the number of animals, including C. o. ogilbyi, being taken from this area (12). Duikers are popular with hunters because they are easy to hunt, easy to transport by foot, and have enough meat to be highly profitable (11). However, current levels of hunting are thought to be unsustainable (11) and, combined with increasing habitat loss, to which Ogilby's duiker is particularly susceptible due to its restricted distribution and dependence on mature forest, may lead to the further decline of this species in the future (1) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Brooke''s Duiker is now known to exist in reasonable numbers in only a few areas, such as Sapo National Park and some other forests in eastern Liberia and Tai National Park in south-western Côte d'Ivoire.

The mainland population of the nominate subspecies has only a few remaining strongholds, e.g., Korup National Park (Cameroon) and Cross River N.P. (Nigeria); it has also been recorded from several forest reserves (Forboseh et al. 2007). It remains relatively numerous on Bioko Island (Equatorial Guinea). The effective protection of the Gran Caldera de Luba Scientific Reserve is crucial to the survival of this species on Bioko Island.

The distinctive White-legged Duiker is now known to be relatively widespread and numerous in Gabon, including protected areas such as Lope and the Gamba complex, and Odzala N. P. (Congo).

Listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The white-legged duiker, C. o. crusalbum, has probably the most stable population of the three subspecies of Ogilby's duiker, as it occurs in areas where human population densities are low. It is still relatively widespread and common and occurs in a number of protected areas, including Lopé-Okanda National Park and the Gamba complex in Gabon, as well as Odzala National Park in Congo. However, if human populations in these areas increase, the white-legged duiker may become confined within these protected areas in the future (1). Populations of C. o. ogilbyi and C. o. brookei are decreasing throughout their range. Brooke's duiker, C. o. brookei, has been reduced to around 5,000 individuals and is found in reasonable numbers only in a few areas, such as Sapo National Park in Liberia and Tai National Park in Ivory Coast (1) (9). Mainland populations of C. o. ogilbyi only have a few remaining strongholds, such as Korup National Park in Cameroon. Although this subspecies remains relatively numerous on Bioko Island, the effective protection of Gran Caldera de Luba and the control of the bushmeat trade will be vital to its survival here (1) (9). More public outreach efforts are also needed to educate people about duikers, as well as better monitoring of hunting and enforcement of protected areas (11) (12).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ogilby's duiker

Ogilby's duiker (Cephalophus ogilbyi), is a small antelope found in Sierra Leone, Liberia, Ghana, southeastern Nigeria, Equatorial Guinea's Bioko Island, and, possibly, Gabon. No subspecies are recognized.

The two former subspecies, the white-legged duiker Cephalophus crusalbum and the Brooke's duiker Cephalophus brookei, are considered as distinct species since 2011.[2]

Ogilby's duikers weigh up to 20 kg (44 lb) and have a shoulder height of up to 56 cm (22 in). They vary in color from chestnut to mahogany to deep brown, and have massive hindquarters typical of duikers.

Ogilby's duikers live mainly in high-altitude rainforests, where they feed mainly on fallen fruit.

The total population is estimated at 12,000 individuals.

References

  1. ^ IUCN SSC Antelope Specialist Group (2008). Cephalophus ogilbyi. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ Colin Peter Groves & Peter Grubb: Ungulate Taxonomy, Johns Hopkins University Press, 2011. ISBN 978-142-140-093-8
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!