Overview

Brief Summary

Biology

Duikers are shy animals that move around alone or in pairs (3). Like other duikers, pairs of black-fronted duikers inhabit a territory that is marked with scented secretions from glands on the face (2). Within this area of habitat, the duiker follows regular paths from its sleeping shelter to feeding grounds (2), where it consumes a variety of fruit and succulent vegetation (2). Information on the life history of the black-fronted duiker is lacking, but an individual in captivity lived for nearly 20 years (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The black-fronted duiker is a sturdy and active antelope (3), named for the broad black streak that runs from the nose to its forehead (2), which distinguishes this species from the other duikers of Africa (4). Its glossy coat is a shade of red, chestnut, or dark red-brown (2) (4), with the hair becoming thinner and darker, almost black, on the long legs (2). The short tail is black with a white tip (4). Both male and female black-fronted duikers have short, pointed horns (3), measuring between 4 and 12 centimetres (4), which are used in combat with other duikers and in defence against predators (3). The subspecies Cephalophus nigrifrons rubidus (the Ruwenzori black-fronted duiker), which is recognised by some as a distinct species, differs in appearance by having a white belly and thicker hair (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Black-fronted Duiker occurs widely in swamp forests and alongside watercourses within the equatorial forest zone, from south-eastern Nigeria to the Albertine Rift, and in isolated montane forests in East Africa. The Nigerian population occurs in the Niger Delta and is probably disjunct from the nearest known population in Cameroon (East 1999; Plumptre in press). Isolated populations of this species were recorded on Mounts Cameroon, Kupe and Manengube by Bowden (1986), but Grubb et al. (2003) were not convinced these records relate to Black-fronted Duiker.

C. n. rubidus is confined to the Ruwenzori Mtns at altitudes of 1,300-4,200 m, although it is thus far only recorded from the Ugandan side (Kingdon 1982, Grubb and Groves 2001; Kingdon in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The black-fronted duiker occurs in central Africa, from southern Cameroon to western Kenya and northern Angola (3). The Ruwenzori black-fronted duiker occurs only in the Ruwenzori Mountains, a mountain range located on the border between Uganda and the Democratic Republic of Congo (4)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Tropical forests of central Africa ranging from lowland swamp forest and seasonally flooded forest with poorly drained or permanently saturated soils (where it is frequently encountered along streams and in marshy areas) to montane forests, subalpine vegetation zones, bamboo, and moorland on Mounts Elgon and Kenya and the Aberdares (Kenya).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This small antelope is an inhabitant of montane, lowland, and swamp forests (2) (4), from low altitudes up to 3,500 metres above sea level (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 17.9 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalophus nigrifrons

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGCTGACTATTCTCAACCAATCACAAAGACATTGGTACCTTATATCTCCTGTTCGGTGCTTGAGCTGGCATAGTAGGAACCGCTCTAAGTTTATTAATCCGCGCTGAATTAGGTCAACCTGGAACCTTACTCGGAGACGACCAAATTTACAACGTAATTGTAACCGCACATGCATTCGTAATAATTTTCTTCATGGTAATACCTATTATAATTGGAGGCTTCGGCAACTGACTAGTCCCTCTGATGATCGGTGCCCCAGATATAGCATTTCCCCGAATAAATAACATAAGTTTCTGACTTCTCCCTCCCTCCTTCTTACTACTCCTGGCATCTTCTATAGTTGAAGCTGGAGCAGGAACTGGCTGAACCGTATATCCCCCTCTAGCAGGTAACCTGGCCCATGCAGGAGCCTCAGTAGACCTGACTATCTTCTCTTTACACCTAGCGGGTGTCTCTTCAATTTTAGGGGCTATTAATTTTATTACTACAATTATTAATATGAAACCCCCTGCAATATCTCAGTACCAGACTCCCTTATTTGTATGATCAGTGCTAATCACTGCCGTRTTATTACTTCTCTCCCTCCCTGTATTAGCAGCTGGTATTACAATACTGCTAACTGACCGAAATCTGAACACAACCTTCTTCGACCCAGCAGGAGGTGGGGACCCTATCCTATACCAACACCTATTCTGATTCTTCGGACACCCCGAAGTGTATATTCTTATTCTACCCGGATTTGGGATAATCTCTCACATCGTGACCTACTACTCAGGAAAAAAAGAACCGTTCGGATATATAGGAATAGTGTGAGCTATAATATCAATCGGATTTTTAGGGTTTATTGTATGAGCCCACCATATATTTACAGTAGGTATAGACGTCGACACACGAGCCTACTTTACATCAGCCACCATAATTATTGCTATCCCTACTGGAGTAAAAGTCTTCAGCTGACTAGCTACACTTCACGGAGGTAATATCAAATGATCCCCTGCTATAATATGAGCCCTGGGCTTCATCTTCCTTTTCACAGTTGGAGGCCTAACAGGAATTGTTCTAGCTAACTCTTCTCTCGATATTGTTCTTCACGACACATATTATGTAGTCGCACATTTCCACTATGTACTGTCAATAGGAGCTGTGTTCGCTATTATAGGAGGATTCGTACATTGATTCCCACTATTCTCAGGCTACACCCTTAATACTACATGAGCCAAAATCCATTTTGTAATCATATTTGTAGGTGTGAACATAACTTTCTTCCCACAACATTTCTTAGGATTATCTGGCATACCACGACGATACTCCGACTACCCAGATGCATACACAATATGAAATACTATTTCATCTATAGGCTCATTCATCTCACTAACAGCGGTCATACTAATAATTTTTATCATCTGAGAAGCATTCGCATCTAAACGAGAAGTTCTAACCGTAGACCTAACCACAACAAACTTAGAATGACTAAACGGATGCCCCCCACCATACCACACATTYGAAGAACCCACATATGTTAATCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalophus nigrifrons

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the species remains reasonably widespread with a total population in the order of 300,000. However, this species’ numbers will continue to decrease gradually as human populations and bushmeat hunting increase within the equatorial forest zone. If current trends continue, it will eventually disappear from large parts of its present range until it is confined to isolated fragments of forest which are effectively protected from hunting and the encroachment of settlement. Current rates of decline are not yet considered to have reached the threshold for Near Threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Lower Risk / Near Threatened (LR/nt) on the IUCN Red List 2007 (1). Subspecies: Cephalophus nigrifrons rubidus (Ruwenzori black-fronted duiker) is classified as Endangered (EN) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
East (1999) produced a total population estimate of about 300,000. Population trends are probably downwards over large parts of the species’ range, except for areas where hunting pressures are low because of low human population densities and/or active protection.

East (1999) suggested that the population of the Rwenzori Red Duiker may number at least in the thousands.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Like most other forest duikers, the distribution and numbers of this species have been reduced markedly in areas of dense human settlement and intensive hunting for bushmeat, but it survives in good numbers in areas where the level of human activities is relatively low (East 1999).

Although much of the range of the Rwenzori Red Duiker falls in a national park, the species nonetheless remains susceptible to snaring, and to habitat loss in the lower elevations of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Like other duikers, the black-fronted duiker is being impacted by both hunting for food and habitat destruction (3) (4). As human populations in some parts of central Africa rapidly expand, duikers are increasingly hunted and suitable habitat is lost to human settlements and agriculture (1) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Black-fronted Duiker is present in a number of protected areas such as Lobeke (Cameroon), Dzanga-Sangha and Bangassou (Central African Republic), Lake Tele-Likouala and Nouabale-Ndoki (Congo-Brazzaville), Virunga, Ituri, Maiko, Kahuzi-Biega and Salonga (Congo-Kinshasa), Bwindi (Uganda), Volcanoes National Park (Rwanda) and Mount Kenya. Most of these key populations are stable.

Much of the Ugandan range of the Rwenzori Red Duiker is included within Rwenzori Mountains National Park. There is a need for further taxonomic work to determine whether this subspecies does indeed deserve recognition as a distinct species (as considered by Kingdon in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The black-fronted duiker occurs in numerous protected areas throughout its range, including Lake Lobeke Reserve, Cameroon; Virunga National Park, Democratic Republic of Congo; and Ipassa Reserve, Congo (5), which will hopefully help protect this wary antelope from detrimental human activities.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!