Overview

Brief Summary

Biology

Like other duikers, (a word meaning 'diver' in Dutch) (4), the Natal duiker is a shy animal that dives for forest cover at the slightest disturbance (3). Generally the Natal duiker is seen on its own, but occasionally a pair or a female with her offspring may be observed. When Natal duikers do meet, they greet each other by rubbing their facial scent glands together; these scent glands are also used to mark branches, twigs and tree trunks within their range. Only occasionally may a meeting between duikers escalate in to a fight, when the small, sharp horns can be used to inflict considerable wounds (3). Natal duikers consume a diet of flowers, foliage and fruit that has recently fallen from trees (2) (3). Often, this duiker has been seen under trees where a troop of monkeys are feeding, taking advantage of the plentiful, carelessly dropped fruit (3). While in most areas, foraging for this food is undertaken during daylight hours, in highly disturbed areas the Natal duiker may become nocturnal (2). Females give birth to a single lamb after a gestation of about 210 days (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This small, stocky antelope has an attractive chestnut-red coat that can, surprisingly, obscure its appearance in the dappled light of the forest. Both male and female Natal duikers have short, straight, backward-sloping horns, hidden amongst a tuft of long and bushy chestnut-black hair (3). The margins of the ears, chin, throat and underside of the tail are white, while the upperside of the tail, ears and muzzle are black (2). The neck turns blue-grey with age and in front of the eyes sits conspicuous long, thin scent glands (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Natal Red Duiker formerly occurred widely in coastal and riverine forests and thickets, escarpments and montane forests from south-eastern Tanzania to north-eastern KwaZulu-Natal in South Africa (East 1999; Hoffmann and Bowland in press). There are no confirmed records of this species from Zimbabwe or Zambia; East (1999) shows the species occurring in north-east Zambia and northern Malawi, but these records relate to Harvey’s Duiker (see Hoffmann and Bowland in press, and references therein).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in indigenous forest along the eastern coast of Africa; in Malawi, Mozambique, South Africa, Swaziland, Tanzania and Zambia (1) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits evergreen forest, tropical/subtropical forest patches, coastal scrub, and riverine thickets. In north-east KwaZulu-Natal, they occur up to about 200 m elevation (Rowe-Rowe 1994).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Natal duiker inhabits coastal forests, montane forests and dense thickets. It appears that a wide range of trees that flower and fruit throughout the year are essential features of the duiker's habitat (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 15.2 years (captivity) Observations: One specimen was still alive after 15.2 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalophus natalensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGCTGACTATTCTCAACCAATCACAAAGACATTGGTACCCTATATCTCCTGTTCGGTGCTTGAGCTGGCATAGTAGGAACCGCTCTAAGCTTATTAATCCGCGCTGAATTAGGTCAACCTGGGACCTTACTCGGAGATGACCAAATTTACAACGTAATTGTAACCGCACATGCATTTGTAATAATTTTCTTCATGGTAATACCTATTATAATTGGAGGCTTCGGCAACTGACTAGTCCCTCTGATAATCGGTGCCCCAGATATAGCGTTTCCCCGAATAAATAACATAAGTTTCTGACTTCTCCCTCCCTCCTTCTTACTACTCCTGGCATCTTCTATAGTTGAAGCTGGAGCAGGAACTGGCTGAACCGTATATCCCCCTCTAGCAGGTAACCTAGCCCATGCAGGAGCCTCAGTAGACCTGACTATCTTCTCTTTACACCTAGCGGGTATCTCTTCAATTTTAGGGGCTATCAATTTTATTACTACAATTATTAATATGAAGCCCCCTGCAATGTCTCAGTACCAGACTCCCTTATTTGTATGATCAGTACTAATCACTGCCGTGTTATTACTTCTCTCCCTCCCTGTATTAGCAGCTGGTATTACAATGCTACTAACTGACCGAAATCTGAACACAACCTTCTTCGACCCAGCAGGAGGTGGGGACCCTATCCTATATCAACACCTATTCTGATTCTTCGGGCACCCCGAAGTGTATATTCTTATTCTACCCGGATTTGGGATAATCTCTCACATCGTGACCTATTACTCAGGAAAAAAAGAACCATTCGGATACATAGGAATAGTATGAGCTATAATATCAATTGGATTTCTAGGGTTTATTGTATGAGCCCACCATATATTTACAGTAGGTATAGACGTCGACACACGAGCCTACTTTACATCAGCCACCATAATTATTGCTATCCCTACTGGAGTAAAAGTCTTCAGCTGACTAGCTACACTTCACGGAGGTAATATCAAATGATCCCCTGCTATAATATGGGCCCTGGGCTTCATCTTCCTTTTCACAGTTGGAGGCCTAACAGGAATTGTTCTAGCTAACTCTTCTCTCGATATTGTTCTTCATGACACATATTATGTAGTCGCACATTTCCACTATGTACTGTCAATAGGAGCTGTGTTCGCTATTATAGGAGGATTCGTACATTGATTCCCACTATTCTCAGGCTACACCCTTAATACTACATGAGCCAAAATCCATTTTGTAATCATATTTGTAGGTGTAAACATAACTTTCTTCCCACAACATTTCTTAGGACTGTCTGGCATACCACGACGATACTCCGACTACCCAGACGCATACACAATATGAAATACTATTTCATCTATGGGCTCATTCATCTCACTAACAGCGGTCATACTAATAATTTTTATCATCTGAGAAGCATTCGCATCTAAACGAGAAGTTCTAACCGTGGACCTAACCACAACAAACTTAGAATGACTAAACGGATGCCCTCCACCATACCACACATTCGAGGAACCCACATATGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cephalophus natalensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the species remains reasonably widespread and population size and range surpass the thresholds required for a threatened category. If current trends persist, the Natal Red Duiker may eventually disappear from substantial parts of its present area of occupancy, but its survival should not be threatened in the long term if it continues to be represented by healthy populations in protected areas such as Selous, Nyika, South Viphya, Maputo, St. Lucia, Hluhluwe-iMfolozi and others.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Bowland (1990) recorded densities varying from 1/0.5-1.0 ha in favourable habitat (such as at St. Lucia) to 1/2.5-5.0 ha in less favourable areas. East (1999) produced a total population estimate of about 42,000, although actual numbers could be considerably greater. Population trend is gradually downwards over much of the species’ range, although a substantial part of the range occurs in Mozambique, where an overall recovery in wildlife populations is likely to include this duiker (East 1999; Hoffmann and Bowland in press).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Natal Red Duiker have disappeared from large parts of their former range, largely as a result of the loss of suitable habitat in the face of expanding human settlement and agriculture, as well as hunting (East 1999; Hoffmann and Bowland in press). Nonetheless, it remains locally common within its former range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Natal duiker is the subject of intensive hunting and trapping for the bushmeat trade over much of its range (2); in Tanzanian forests it is one of the most frequently hunted species (5). In addition, the exploitation of extensive areas of forest throughout its range for commercial forestry, settlement and agriculture, has reduced the amount of suitable habitat available for the Natal duiker (2) (3). While this little antelope remains widespread, and is common in many areas (2), these threats have caused its disappearance from some areas, such as the coastal areas of South Africa, south of Durban (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Natal Red Duiker is well represented in several well-managed protected areas such as Selous Game Reserve (Tanzania), Maputo Game Reserve (Mozambique), Greater St. Lucia Wetland Park, Hluhluwe-iMfolozi and Ndumo G.R. (South Africa) (East 1999; Hoffmann and Bowland in press).

There is a need for further taxonomic work to investigate the status of this species relative to Harvey's Red Duiker.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The Natal duiker occurs in a number of protected areas, including the Greater St Lucia Wetland Park, South Africa and Kilimanjaro National Park, Tanzania; both Natural World Heritage Sites (6) (7). In some areas in southern Africa, the Natal duiker has been reintroduced to some of its former range (3). Otherwise, there are no specific conservation measures known to be in place for this duiker. The threats it faces, bushmeat hunting and habitat loss, are complex issues that need to be addressed with a diversity of approaches if the numerous species affected are to survive.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red forest duiker

The red forest duiker, Natal duiker, or Natal red duiker (Cephalophus natalensis) is a small antelope found in central to southern Africa. It is found in forests and shrublands in Malawi, Mozambique, and southern Tanzania.

Red duiker at Pigeon Valley, Durban, South Africa
Red duiker at Pigeon Valley, feeding

Red forest duikers are roughly 40 cm (16 in) tall at the shoulder and weigh 15 kg (33 lb) on average. They have chestnut coats, with dark patches on their faces and backs of their necks. They eat fallen fruit, foliage, and insects. They are territorial, with mated pairs defending territory. Usually, a single fawn is produced each year, with gestation estimated between 4 and 7.5 months.[2]

Red forest duikers are on the IUCN red list of threatened species.

References[edit]

  1. ^ IUCN SSC Antelope Specialist Group (2008). Cephalophus natalensis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ Alden, Peter (1995). National Audubon Society: Field Guide to African Wildlife. New York: Alfred A. Knopf. pp. 460–461. ISBN 0-679-43234-5. 


This small, stocky antelope has an attractive chestnut-red coat that can, surprisingly, obscure its appearance in the dappled light of the forest. Both male and female Natal duikers have short, straight, backward-sloping horns, hidden amongst a tuft of long and bushy chestnut-black hair (3) (4). The horns of the male are around twice the length of those of the female (4). The margins of the ears, chin, throat and underside of the tail are white, while the upperside of the tail, ears and muzzle are black (2) (4). The neck turns blue-grey with age (3) and in ...

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!