Overview

Brief Summary

Biology

Blue duikers are most active at dawn and dusk (5) (10) (11) and feed mainly on fruit, as well as leaves, flowers, fungi, seeds and sometimes insects or even small animals (4) (5) (8). Like other duikers, they may follow feeding monkeys and birds through the forest, picking up the fruits that are dropped (2) (6). The blue duiker is monogamous, with pairs appearing to mate for life and living in a small territory, which is defended against other blue duikers and regularly scent-marked (2) (5) (6). Breeding occurs year-round (4) (10), with a single young being born after a gestation of between 196 and 216 days (5) (12). Young are able to run within half an hour of being born, though usually remain hidden in the undergrowth for the first few weeks of life (5) (6). Blue duikers become mature at around a year old, after which they are driven from the parental territory (6) (10), and are reported to live for up to ten years (2) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The blue duiker is the smallest and one of the most abundant and widespread of all duiker species (4) (5). Like other duikers, this diminutive antelope has a distinctive stocky body, large hindquarters, arched back and short, slender legs, a body shape adapted for easy movement through dense undergrowth (4) (6) (7). The name “duiker” comes from an Afrikaans word meaning “diver”, these species being named for their habit of diving into cover when disturbed (6) (8); in the blue duiker this behaviour is often accompanied by a loud, sneezing whistle given by the male (2) (5). Coat colour is quite variable, depending on location (2) (4) (5), and ranges from slate grey to dark brown, with a bluish sheen on the back, which gives the blue duiker its common name (4) (9). The underparts are whitish (4), as is the underside of the tail, where slightly crinkled white hairs reflect light so well that on the dark forest floor the constantly flickering tail can resemble a light flashing on and off (2) (5). Blue duikers have large eyes, fairly small ears and a wide, flexible mouth adapted to feeding on fruit (2) (4). Sexes are similar in appearance (6) and both possess short, spiky horns, though these are sometimes absent in the female or hidden by a short crest of hair (4) (9) (10). Females may also be slightly larger than males (4) (10). All duikers have a good sense of smell (5) and possess large, obvious, slit-like scent glands in front of the eyes, used in scent-marking (4) (6) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Widely distributed in central, eastern and southern Africa, from the Cross River in Nigeria to south-east Sudan and southwards to central Angola, and remnant forests and thickets in Zambia, Malawi, eastern Zimbabwe, and parts of central Mozambique. In South Africa, this species is mainly confined to the evergreen forest and thicket along the coast from northern KwaZulu-Natal to the eastern Western Cape province; there are no confirmed records from Swaziland and none from southern Mozambique, suggesting a break in distribution between their South African range and eastern Zimbabwe and central Mozambique. Also present on the islands of Pemba, Zanzibar and Mafia (East 1999; Wilson 2001; Hart and Kingdon in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Philantomba monticola, commonly known as the blue duiker, is found throughout Central and Southern Africa. Its range includes Nigeria to Gabon and Kenya to South Africa.

Biogeographic Regions: ethiopian (Native )

  • Ronald, K., K. Kranz. 2006. Duikers. Pp. 542-545 in D Macdonald, ed. Encyclopedia of Mammals. London: The Brown Reference Group.
  • Waltert, M., S. Heber, S. Riedelbauch, J. Lien. 2006. Estimates of Blue Duiker (Cephalophus monticola) Densities from Diurnal and Nocturnal Line Transects in the Korup Region, Southwestern Cameroon. African Journal of Ecology, 44: 290-292.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Blue duikers are widely but patchily distributed throughout central, eastern and southern Africa, from Nigeria east to Kenya and south to Angola, Zambia, Malawi, Zimbabwe and parts of central Mozambique, as well as on the islands of Zanzibar, Pemba and Mafia. They are also found in parts of South Africa, though there appears to be a break in the species' distribution between its South African range and populations in Zimbabwe and Mozambique (1) (2) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Blue duikers are the smallest of the duiker species, weighing no more than 4 to 6 kg. They are typically 55 to 72 cm long, with a 7 to 12.5 cm tail that is black with a white underside. Coat color varies, depending on where the animal lives but the coat is typically brown, often with a blue tint. All males have a pair of grooved horns that are about 5 cm in height. Females may have horns as well, however, horns are frequently not present in females. Blue duikers are very similar in appearance to Maxwell's duikers (Philantomba maxwellii). However, the two can be distinguished by several key features, most notably blue duikers have a smaller skull, with a narrower nasal passage.

Range mass: 4 to 6 kg.

Range length: 55 to 72 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: ornamentation

  • Ralls, K. 1973. Mammalian Species: Cephalophus maxwellii. American Society of Mammalogists, 31: 1-4.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Blue Duiker thrives in a wide range of forested and wooded habitats, including primary and secondary forests, gallery forests, dry forest patches, coastal scrub farmland and regenerating forest from sea level up to 3,000 m asl (Hart and Kingdon in press). They can persist in small patches of modified or degraded forest and thicket, even on the edge of urban centres.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Blue duikers can be found in a variety of forested areas, including rain forests, riverine forests, dense thickets, and montane forests. They are often found near human dwellings, and may use plantations as corridors in their habitat. Piles of dead trees or lumber are sometimes used as resting sites. However, the majority of their time is spent resting in the open or at the base of a tree; this allows them to keep their line of vision clear.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The blue duiker inhabits a wide range of forest and wooded habitats, including lowland rainforest, gallery forest, coastal scrub farmland, dense thicket and montane forest up to elevations of 3,000 metres. It is found in both primary and secondary forest and can also survive in small patches of modified or degraded forest and thicket, including close to human settlements (1) (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Blue duikers are frugivores and primarily feed on fallen ripe and unripe fruit, seeds, flowers, and fungi. They are ruminants, but have a relatively small rumen, which results in a rapid rate of food turnover. In association with rapid turnover, they prefer foods that are low in cellulose and starch with moderate fiber and protein content. They are, however, capable of digesting foods that are relatively high in tannins. Blue duikers spend up to 67 to 76% of their waking hours foraging for food within their territory.

Animal Foods: insects

Plant Foods: leaves; seeds, grains, and nuts; fruit; flowers

Other Foods: fungus

Primary Diet: herbivore (Frugivore , Granivore )

  • Dierenfeld, E., P. Mueller, M. Hall. 2002. Duikers: Native Food Composition, Micronutrient Assessment, and Implications for Improving Captive Diets. Zoo Biology, 21: 185-196.
  • Molloy, L., J. Hart. 2002. Duiker Food Selection Palatability Trials Using Natural Foods in the Ituri Forest, Democratic Republic of Congo. Zoo Biology, 21: 149-159.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Blue duikers live in forested areas and feed primarily on fallen fruit. The fruit that they find on the forest floor is often dislodged by monkeys that inhabit the same areas. In addition to fruit, blue duikers feed on seeds, however, they apparently do not aid in seed dispersal, because they fully masticate their food. Blue duikers may play host to several parasites. Externally, they are often afflicted with ticks. Internal parasites include several species of Nematoda, Coccidia, Strongyles, Trichuridae, and Moniezia.

Mutualist Species:

Commensal/Parasitic Species:

  • Dierenfeld, E., W. Braselton, H. Puche, R. Cook. 1995. Health Evaluation of Five Sympatric Duiker Species (Cephalophus Species). Journal of Zoo and Wildlife Medicine, 26/4: 485-502.
  • Feer, F. 1995. Seed Dispersal in African Forest Ruminants. Journal of Tropical Ecology, 11/4: 683-689.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

The diminutive size of blue duikers leaves them vulnerable to many species, including but not limited to hyenas, wild dogs, African golden cats, leopards, crocodiles, baboons, python, civets, crowned eagles, monitors, and humans. They primarily use their visual and auditory senses in detecting predators. Once a predator is spotted, blue duikers will typically communicate alarm, which may include snorting, stamping, whistling, or flicking the tail, depending on the degree of danger. Once this message of danger has been received, a duiker's response is typically flight. Their long hind limbs make them excellent jumpers, able to quickly dive into dense vegetation and disappear. It is this ability that gave duikers their name, for the Afrikaans word meaning 'divers'.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Blue duikers use auditory, visual, olfactory, and tactile senses for communication. They have several methods of displaying alarm to a mate or offspring, including vocalizing and flicking the tail. Auditory signals include snorting, whistling, hitting an object with the horns, and stamping the feet. Each of these displays conveys different messages and may communicate alarm or sexual excitement. Their primary visual display is tail flicking; flicking the black tail reveals a white underside, which is believed to communicate imminent danger. Blue duikers have several scent glands, the most notable of which are the preorbital glands. Preorbital glands are thought to be important in communicating social acceptance and territory ownership. Pair members may scent mark each other, their offspring, or trees in their home range. Individuals often lick one another, a behavior that is thought to indicate social acceptance. Licking is especially evident when a male is courting a female.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In captivity, blue duikers typically live for 10 to 15 years, but the oldest recorded captive individual survived until it was nearly 16 years of age. In the wild, lifespan is shorter, with the oldest known individual surviving to age 12. Captive duikers are commonly afflicted with several illness, most notable of those is 'sloshing syndrome' or rumen hypomotility syndrome. This illness is characterized by a build-up within the rumen caused by limited activity.

Range lifespan

Status: wild:
12 (high) years.

Range lifespan

Status: captivity:
16 (high) years.

Typical lifespan

Status: captivity:
10 to 15 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.9 years (captivity) Observations: In the wild these animals live up to 12 years (Bernhard Grzimek 1990). One captive specimen was still alive after 15.9 years. A hybrid between a zebra duiker and a blue duiker lived 20.3 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Blue duikers become sexually mature at 9 to 12 months for females and 12 to 18 months for males. Once sexually mature, they find a mate and remain paired for life. Although blue duikers are considered monogamous, males occasionally breed with other females.

Mating System: monogamous

Blue duikers are social animals and display a variety of social behaviors, but they do not form large groups, instead associating as mated pairs. An important aspect of behavior is their use of preorbital scent glands, which both genders use to mark their mate. Licking behavior is also displayed and is believed to indicate social acceptance.

Blue duiker pair members remain together throughout the year, spending much of their time in close proximity. Seasonality does not appear to influence their reproduction, as they continue to produce offspring without regard to time of year. After the female calves, the male leaves the territory for approximately one month, during which time other males may enter the territory. The return of the female's mate drives other males away.

Blue duikers have a gestation period lasting anywhere from 196 to 216 days and typically produce only one calf per reproductive event. Newborn calves weigh about 10% of the mother's body weight. After calving, the female conceals her offspring, and for the first several weeks after birth, the majority of contact between the calf and female takes place during nursing. Eventually, when the calf is more mature, it spends more time with its mother. The calf is weaned between 2.5 and 3 months of age, and eventually leaves the territory on its own accord. Female calves typically leave when they are sexually mature, which is between 1 and 1.5 years of age, and males when they are fully grown, at about 2 years of age. Usually, only one offspring associates with the parents at any one time, but occasionally a monogamous pair will share its territory with two offspring of different ages.

Breeding interval: Breeding interval is not reported, although mated pairs typically associated only with 1 or 2 offspring at a time until they mature at 1 to 2 years old, so breeding interval is likely to be once yearly.

Breeding season: Blue duikers breed throughout the year.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 196 to 216 days.

Range birth mass: 710 to 954 g.

Average birth mass: 867 g.

Range weaning age: 10 to 12 weeks.

Range time to independence: 1 to 2 years.

Range age at sexual or reproductive maturity (female): 9 to 12 months.

Range age at sexual or reproductive maturity (male): 12 to 18 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Blue duiker calves are extremely precocial and are able to run within 20 minutes of birth. The mother typically allows the calf to nurse approximately 3 times a day for the first month, after which the mother reduces nursing events until the calf is weaned at 2.5 to 3 months. Initially, the male is absent, taking leave shortly after the calf is born, and returning approximately one month later. However, he does not travel far, and does occasionally come back and spend time with his mate. It is believed that the male leaves his territory to aid in the protection of his offspring.

Parental Investment: precocial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female)

  • Estes, R. 1991. The Behavior Guide to African Mammals. Berkeley and Los Angeles, California: University of California Press.
  • Brent Hoffman. 1999. "Philantomba monticola" (On-line). Ultimate Ungulate. Accessed March 11, 2010 at http://www.ultimateungulate.com/Artiodactyla/Philantomba_monticola.html.
  • Boehner, J., K. Volger, H. Hendrichs. 1984. Breeding Dates of Blue Duikers (Cephalophus monticola). Zeitschrift fuer Saeugetierkunde, 49/5: 306-314.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Philantomba monticola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGTTGATTATTCTCAACCAATCACAAAGACATCGGTACCCTATACCTTTTATTTGGCGCTTGAGCTGGTATAGTTGGAACCGCTCTAAGCTTATTAATCCGCGCTGAACTGGGTCAACCTGGAACCTTGCTCGGAGACGACCAAATCTACAACGTAGTTGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCTATCATAATTGGAGGATTCGGCAACTGACTAGTTCCTCTAATAATTGGTGCCCCAGACATGGCATTTCCTCGAATAAATAATATAAGTTTCTGACTTCTCCCTCCCTCTTTTCTATTACTCCTAGCATCCTCAATAGTTGAAGCCGGAGCAGGAACTGGCTGAACCGTATACCCCCCTCTAGCAGGCAACCTAGCCCACGCAGGAGCCTCAGTAGACCTAACCATTTTCTCCCTACATCTGGCAGGTGTTTCCTCAATCTTAGGAGCCATTAATTTCATCACTACAATTATCAATATGAAACCCCCTGCAATATCCCAATATCAAACTCCCCTATTTGTATGATCAGTATTAATTACTGCCGTATTACTACTCCTCTCTCTTCCCGTATTAGCAGCTGGTATCACAATATTATTAACAGACCGAAACTTAAACACAACCTTCTTTGACCCGGCAGGAGGAGGGGACCCTATCCTATATCAACACCTATTTTGATTCTTTGGACACCCCGAAGTTTATATTCTTATTTTACCCGGATTTGGAATGATCTCCCACATTGTAACCTATTATTCAGGAAAAAAGGAACCATTTGGGTATATAGGAATAGTATGGGCCATAATATCAATTGGATTTCTAGGATTTATCGTATGAGCCCACCATATATTTACAGTAGGAATAGACGTCGACACACGGGCCTACTTCACATCAGCTACCATAATCATTGCTATCCCTACTGGAGTAAAAGTCTTCAGTTGACTAGCTACACTTCACGGAGGCAATATCAAATGATCCCCTGCTATAATATGAGCTCTGGGCTTTATTTTCCTTTTCACAGTTGGAGGCTTGACAGGAATTGTTCTAGCCAACTCTTCTCTTGACATTGTCCTTCATGACACATACTACGTAGTTGCACACTTCCACTACGTATTATCAATAGGAGCTGTATTTGCTATCATAGGAGGGTTTGTACACTGATTCCCGCTATTCTCAGGCTATACCCTAAACGAAACATGGGCCAAAATCCATTTTGCAATTATATTTGTAGGCGTAAATATAACTTTTTTCCCACAACATTTCTTAGGGCTGTCCGGCATACCACGACGATACTCTGACTACCCAGACGCATATACAATATGAAATACTATTTCATCTATAGGCTCATTCATCTCACTAACAGCAGTTATACTAATAATTTTCATTATTTGAGAAGCATTCGCATCTAAACGAGAAGTTTTAACTGTAGATCTAACAACAACAAACCTAGAGTGACTAAACGGATGCCCTCCACCATACCACACATTTGAAGAACCTACATACGTTAACCTGAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Philantomba monticola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cephalophus monticola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACCCTATACCTTTTATTTGGCGCTTGAGCTGGTATAGTTGGAACCGCTCTAAGCTTATTAATCCGCGCTGAACTGGGTCAACCTGGAACCTTGCTCGGAGACGACCAAATCTACAACGTAGTTGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCTATCATAATTGGAGGATTCGGCAACTGACTGGTTCCTCTAATAATTGGTGCCCCAGACATGGCATTTCCTCGAATAAATAATATAAGTTTCTGACTTCTCCCTCCCTCTTTTCTATTACTCCTAGCATCCTCAATAGTTGAAGCCGGAGCAGGAACTGGCTGAACCGTATACCCCCCTCTAGCAGGCAACCTAGCCCACGCAGGAGCCTCAGTAGACCTAACCATTTTCTCCCTACATCTGGCAGGTGTTTCCTCAATCTTAGGAGCTATTAATTTCATCACTACAATTATCAATATGAAACCCCCTGCAATATCCCAATATCAAACTCCCCTATTTGTATGATCAGTATTAATTACTGCCGTATTACTACTCCTCTCTCTTCCCGTATTAGCAGCTGGTATCACAATATTATTAACAGACCGAAACTTAAACACAACCTTCTTTGACCCNGCAGGAGGAGGGGACCCTATCCTATATC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalophus monticola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as this is a widespread and abundant species with total population numbers estimated at more than seven million. Its ability to withstand hunting pressure and habitat degradation enable it to adapt to increasing human colonization of its forest habitats, although even this abundant, highly resilient species is suffering some decline in its distribution and numbers as human populations continue to grow and expand. However, this is unlikely to threaten the Blue Duiker’s overall survival in the foreseeable future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Currently, blue duikers are listed as 'Least Concern' on the IUCN Red List of Threatened Species.

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1) and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
East (1999) produced a total population estimate of more than 7,000,000 animals, likely a conservative figure. Protected areas comprise only a small part of its total range, but its core populations are generally stable apart from areas where subsistence and commercial meat-hunting pressures are exceptionally high (East 1999).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species is subject to extensive hunting for bushmeat throughout its range states, and is arguably the most important wild ungulate economically and ecologically in Africa (Wilson 2001). However, it withstands hunting pressure better than most of the larger duikers. Furthermore, unlike many of the other forest duikers, Blue Duikers tolerate and even thrive in a range of human-modified habitats, even in the vicinity of settlement, and often persist well in small habitat patches (Hart and Kingdon in press). Nonetheless, some local populations may be subject to declines or extirpation in the face of one or both of these threats (e.g., see Lawes et al. 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The blue duiker is heavily hunted throughout its range and is one of the most important components of the bushmeat trade in many areas (1) (13) (14). Duiker species are particularly popular with hunters, as they are easy to catch, easy to transport and have enough meat to be highly profitable (15). However, the blue duiker appears able to withstand hunting pressure better than most of the larger duiker species and currently remains widespread and abundant (1) (2) (14). Other potential threats include habitat destruction through the felling of forests for fuel, building materials, agriculture and the spread of human settlement (10). The felling of fruit trees and killing of monkey species in particular may further degrade blue duiker habitat and food supply (2). Although the blue duiker is again better able to tolerate this threat than other duiker species, and indeed often survives in a range of human-modified habitats, the combination of hunting and habitat loss may threaten populations in some areas, leading to local declines (1)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Blue Duiker occurs in large, generally stable numbers in many protected areas within the core of its range, e.g., Dja and Lobeke (Cameroon), Dzanga-Sangha and Dzanga-Ndoki (Central African Republic), Monte Aien (Equatorial Guinea), Lope and Gamba (Gabon), Odzala, Nouabale-Ndoki, Lake Tele-Likouala and Conkouati (Congo-Brazzaville) and the Okapi reserve, Maiko, Kahuzi-Biega and Salonga (Congo-Kinshasa), not to mention several protected areas in South Africa.

The Blue Duiker should continue to survive in large numbers and provide an important source of protein to human populations in the Central African forest zone, as long as human population densities remain low to moderate over extensive parts of its range.

Listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

This resilient species still occurs in large and generally stable numbers in most areas and is listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), meaning international trade in blue duikers should be carefully monitored and controlled (1) (3). The blue duiker should continue to survive in large numbers for the foreseeable future, provided human population densities remain low to moderate over large parts of its range. Although protected areas make up only a small part of its total range, its core populations are generally stable other than in areas where hunting pressures are particularly high (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Although this species sometimes occupies plantation fields, it is not known to be harmful to crops or humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Blue duikers are among the most common duikers hunted for bushmeat. Many human groups living near the Congo basin rely heavily on the meat obtained from duikers for food and income.

Positive Impacts: food

  • Newing, H. 2001. Bushmeat Hunting and Management: Implications of Duiker Ecology and Interspecific Competition. Biodiversity and Conservation, 10/1: 99-108.
  • Yasuoka, H. 2006. The Sustainability of Duiker (Cephalophus Spp.) Hunting for the Baka Hunter-Gatherers in Southeastern Cameroon. African Study Monographs, 33: 95-120.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blue duiker

The blue duiker (Philantomba monticola) is a small, forest-dwelling duiker found in the Central Africa and southern South Africa.

Blue duikers stand around 35 cm (14 in) tall at the shoulder and weigh 4 kg (8.8 lb).They are the smallest of the antelope family. The blue duiker has a brown coat with a slight blue tinge – hence the name – and a white underside. A glandular slit occurs beneath both eyes, with a very slight crest between the ears. There is an elongated, oval crown situated on the back of the neck between the shoulder line and the horns, about 2cm x 5cm. It has simple conical horns of 2 to 10 cm (0.79 to 3.9 in). Females do not always have horns, in both sexes horns may be poorly developed, less than 2cm long. The average lifespan is 10–12 years.

Blue duikers live mainly in rainforests, where they eat fruit, flowers, and leaves, which have fallen from the canopy, as well as eggs and insects. They are, in turn, the prey of the crowned eagle. They are nocturnal and solitary or form mating pairs. Observations in the Western Cape (Wilderness) indicate blue duikers to be strictly diurnal and not active after dark. They are very territorial animals, patrolling the borders of their territory and marking them with their dung and excretions from glands above their hooves and under their eyes (preorbital glands). They will chase off any intruders and only tolerate their offspring's presence until they reach 18 months of age.[3]

Blue duikers generally produce one offspring per year. Gestation is estimated at between 4 and 7.5 months.[4] Observations in the Western Cape indicate that, under favorable conditions, a female produced a lamb about every eight months for five years. Lambs remain hidden for 56 days (eight weeks) and then make their appearance, about 20% smaller than adult size. A popular activity is to sprint at high speed through dense undergrowth, possibly to practice escape routes.

Blue duikers are not at all endangered and are in fact quite common; in Gabon, they can reach population densities of almost 80 animals per km2.

References[edit source | edit]

  1. ^ Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 715. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ IUCN SSC Antelope Specialist Group (2008). Cephalophus monticola. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern.
  3. ^ Blue duiker, An ultimate ungulate fact sheet
  4. ^ Alden, Peter (1995). National Audubon Society: Field Guide to African Wildlife. New York: Alfred A. Knopf. pp. 459–460. ISBN 0-679-43234-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!