Overview

Distribution

Range Description

Maxwell’s Duiker formerly occurred throughout the moist lowland forests of West Africa, extending into the adjoining savannas (East 1999). It ranges from western Gambia and south-west Senegal east to the Cross River in Nigeria (East 1999; Wilson 2001; Nett and Newing in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Philantomba maxwellii inhabits an area of western Africa extending from Senegal and Gambia to Nigeria. Members of the species generally prefer lowland rainforests, second growth forests and forests relics found in savannas.

Biogeographic Regions: ethiopian (Native )

  • Happold, D. 1987. The Mammals of Nigeria. Oxford: Clarendon Press.
  • Ralls, K. 1973. Cephalophus maxwellii. Mammalian Species, 31: 1-4.
  • 1982. Cephalophus maxwelli. Pp. 331 in J Honacki, K Kinman, J Koeppl, eds. Mammal Species of the World. Lawrence, Kansas: Allen Press, Inc. and The Association of Systematics Collections.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Maxwell’s duikers are small antelopes, averaging about 66 cm in length and 5 to 7 kg in weight. They have short legs and an arched back and stand 35 to 38 cm tall. Females are reported to be larger in length and mass than males.

The pelage of P. maxwellii is grey or grey-brown and paler on the animal’s underside. Maxwell’s duikers are more uniform in color than closely related blue duikers, Philantomba monticola, which are more sharply bicolored and bear areas of white fur on their buttocks. Maxwell’s duikers have short, bushy tails with a fringe of white fur around the edges. Two white stripes run symmetrically down an animal's head from its horns above its eyes, to its nose. Conspicuous suborbital glands are present below each eye.

Maxwell’s duikers have small, pointed horns that extend backwards from the rear of the skull. Horns are present in both sexes and emerge in the male when it is about two and a half months old. The animals also have a small tuft of dark hair on the tops of their heads.

Philantomba maxwellii has pedal glands in its feet, which consist of a small sac in the interior of the foot that leads to the exterior via a narrow canal. This trait is useful in differentiating P. maxwellii from the related blue duiker, whose pedal glands lack the long canal.

Range mass: 5 to 7 kg.

Average length: 36-40 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger; ornamentation

  • Kingdon, J. 1974. East African Mammals. Chicago: The University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Occurs in moist lowland forests (primary, secondary forests and plantations) and more locally within riverine forests, forest patches and forest-savanna mosaics. Much of its original habitat has been destroyed by the spread of settlement and agriculture, but Maxwell's Duiker are particularly adaptable to dense thickets, farm-bush habitats, and it still occurs locally in areas with thick undergrowth or other suitable cover. Thus, it has probably benefited from the destruction of primary forests by adapting well to disturbed habitats and remains widespread, occurring in primary and secondary vegetation and often surviving in close proximity to settlement.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maxwell’s duikers inhabit rainforest areas, relic forests in savannas, secondary growth forests and clearings in rainforests. Individual P. maxwellii are able to live in a wide variety of habitats because of their wide and adaptable food habits, which allow them to find adequate supplies of food in both primary and secondary forests as well as cleared areas.

Philantomba maxwellii individuals prefer dense foliage where they can remain concealed. Maxwell’s duikers rarely stray more than 30 m from cover. Individuals make trails through the underbrush in their respective territories.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest

  • Coe, M. 1975. Mammalian Ecological Studies on Mount Nimba, Liberia. Mammalia, 39: 523-581.
  • Hofmann, T., H. Roth. 2000. Feeding preferences of duiker (Cephalophus maxwelli, C. rufilatus and C. niger) in Ivory Coast and Ghana. Mammalian Biology, 68: 65-77.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Maxwell’s duikers are herbivores and mainly feed on the leaves of small forest plants such as herbs and shrubs. They rarely graze on grasses and are classified as browsers. They feed heavily on the leaves of Thonningia sanguinea, Canthium vulgare, and Alchornea cordifolia.

Maxwell’s duikers also eat fruit, which varies seasonally in abundance. Over the seasons, a total of 78 different types of fruit were eaten with an average of about 3 different species of fruit being consumed by an individual duiker at any one time. Preference varies seasonally; for example, during January and February, duikers prefer Phoenix reclinata, Griffonia simplicifolia, Nauclea latifolia, Ficus capensis, Alchornea cordifolia and Blighia sapida.

Other foods consumed by P. maxwellii are blossoms, roots, tubers, and fungi, although these foods constitute only a very small portion of the animals’ diets. Although it is speculated that ants are a natural part of the diets of many species of duikers, they have so far been found only in the stomachs of several Maxwell’s duikers. The ant species consumed were Paltothyreus tarsatus and Oecophylla longinoda. Some duikers in captivity have been seen to eat young birds, although this behavior has not been observed in the wild.

Maxwell’s duikers prefer leaves to fruit only during the dry season when tubers and flowers are also present. They show no seasonal variation in the number of species of fruit that they eat.

Animal Foods: birds; insects

Plant Foods: leaves; roots and tubers; fruit; flowers

Other Foods: fungus

Primary Diet: herbivore (Folivore , Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Maxwell’s duikers most likely aid in the distribution of the seeds of the plants whose fruit they eat. More seeds are destroyed during digestion than are effectively disseminated in the their feces. Small seeds, however, may be effectively dispersed, and seeds of plants in the families Solanaceae and Cecropiaceae are distributed in this manner. Plants of the genus Ficus, whose fruits have small seeds and are heavily consumed by duiker are most likely dispersed this way. Some duiker spit out seeds during rumination.

Duikers are known to interact with baboons (Papio) in areas where the two species overlap. Maxwell’s duikers follow monkeys and eat fruit that the monkeys dislodge from the trees.

Several parasites are known to use P. maxwellii as a host. These include the blood parasite Theileria mutans, the nematodes Thrichuris ovis and Setaria labiata-papillosa, the cestode Avitellina centripunctata, and 8 types of tick. Maxwell’s duiker serve as food for the predators listed above.

Ecosystem Impact: disperses seeds

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Maxwell’s duikers are small, nocturnal, and skittish, making them difficult to observe in the wild. Humans avidly hunt this species but duikers have several natural predators as well. These predators include crowned eagles (Harpyhaliaetus coronatus) and leopards (Panthera pardus), as well as local species of pythons and other wild cats.

Maxwell’s duikers issue an “alarm whistle,” but can also make a bleating noise when in danger, such as when confronted and cornered by another duiker or handled by a human. When Maxwell’s duikers are nervous or threatened, they freeze as they are, sometimes in mid-stride.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Of primary importance in communications among Maxwell’s duikers is the use of the suborbital gland in marking both territories and other duikers. Male duikers frequently mark their territories, when most active marking an average of 5.6 objects every ten minutes. Females mark about 2.8 objects every ten minutes. Maxwell’s duikers frequently rub heads, rubbing suborbital secretions on one another. Territorial marking and head rubbing increase when a foreign duiker is introduced into an established group. This indicates that such marking serves not only as a means of advertising territory, but also of reinforcing social relationships. Interestingly, while the behavior of Maxwell’s duikers in using the suborbital gland is well documented, little is reported concerning how Maxwell’s duikers react to these chemical markers.

In addition to suborbital secretions, Maxwell’s duikers smell or taste one another’s urine. When a male samples a female’s urine, he exhibits flehmen behavior, which is characterized by a curled upper lip and open mouth. It is hypothesized that flehmen is somehow useful in helping the animal detect pheromones in the urine. Females also sample male urine, but with less frequency.

Maxwell’s duikers make an “alarm whistle,” though it is not reported in what context these whistles are used or how other duikers react to them.

Communication Channels: tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little information is known of the lifespan of P. maxwellii in the wild, but they are known to live as long as 10 years in captivity.

Range lifespan

Status: captivity:
10 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.3 years (captivity) Observations: In the captivity these animals may live up to 18.3 years (Ralls 1973).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

A male duiker forms bonds and mates exclusively with one female, even when a surplus of females is present.

Male duikers smell or lick the urine of females and demonstrate flehmen, which is a behavior in which the animal retracts its upper lip and opens its mouth. This behavior is considered to somehow aid the animal in sensing pheromones and ascertaining the sexual status of females.

Male Maxwell’s duikers engage in a simple courtship wherein the male chases and bites the female. After a period of chasing, the male and female circle one another, after which the male approaches the female from behind, kicking its foreleg between the hindlegs of the female. Copulation ensues shortly thereafter.

Mating System: monogamous

Female P. maxwellii breed about once a year and give birth to a single young. Duikers time their mating so that young are born in the dry season (January to March) or the “little dry season” (August to September).

The gestation period is about 120 days. Labor for this species lasts 20 to 30 minutes. After the infant duiker is born, the mother cleans it thoroughly with its tongue and eats any membranous material clinging to it. Newborns are capable of standing and walking within hours of birth, and one was reported as being able to run within 25 minutes of birth. Newborn Maxwell's duikers are "hiders" and generally remained concealed. A young duiker gains about 50 g per day by drinking its mother’s milk. Female duikers nursing their young must drink ample quantities of water. After about 2 weeks, young Maxwell’s duikers are able to begin foraging on their own. Weaning follows soon afterwards, although young duiker continue to nurse occasionally until 2 months of age. Full maturity is reached in about three years.

Breeding interval: Maxwell's duikers breed about once a year.

Range number of offspring: 1 to 1.

Range gestation period: 4 (low) months.

Average gestation period: 4 months.

Average weaning age: 0.47 months.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Maxwell’s duikers provide little in terms of parental care. Young duikers usually spend their time in concealed areas and seek out their mothers only for nursing; female duikers were not witnessed to seek out their offspring even to nurse them. Maxwell’s duikers nurse with mother and young antiparallel to one another. Soon after a young Maxwell's duiker begins foraging on its own, at about 2 weeks of age, its mother begins to discourage it from nursing. Female duikers lick their infants as a method of grooming them.

Parental Investment: altricial ; female parental care ; pre-hatching/birth (Provisioning: Female); pre-weaning/fledging (Provisioning: Female)

  • Kingdon, J. 1974. East African Mammals. Chicago: The University of Chicago Press.
  • Happold, D. 1987. The Mammals of Nigeria. Oxford: Clarendon Press.
  • Ralls, K. 1973. Cephalophus maxwellii. Mammalian Species, 31: 1-4.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Philantomba maxwellii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGTTGATTATTCTCAACCAATCACAAAGATATCGGTACTCTATACCTTTTATTTGGTGCTTGAGCCGGTATAGTAGGAACCGCTCTAAGCTTATTAATCCGCGCTGAACTAGGTCAACCCGGAACCTTGCTCGGAGACGACCAAATCTACAACGTAGTTGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTTATACCCATCATAATTGGAGGATTTGGTAACTGACTAGTCCCTCTAATAATTGGTGCCCCAGATATGGCATTTCCCCGAATAAATAACATAAGTTTCTGACTCCTCCCTCCTTCTTTCCTATTACTCCTAGCATCTTCCATAGTCGAAGCCGGAGCAGGAACTGGCTGAACCGTATATCCTCCTCTAGCAGGCAACCTAGCCCACGCAGGAGCCTCAGTGGACCTAACCATTTTCTCTTTACACCTGGCAGGTGTTTCCTCTATTTTAGGGGCTATTAATTTTATCACTACAATTATCAACATAAAACCCCCTGCAATATCCCAATACCAAACCCCTCTATTTGTATGATCAGTATTAATTACTGCCGTATTACTACTCCTCTCCCTTCCTGTATTAGCAGCTGGTATTACAATGTTACTAACAGATCGAAATTTAAACACAACCTTCTTTGATCCAGCAGGAGGAGGAGATCCTATCCTATACCAACACCTATTTTGATTCTTTGGACACCCCGAAGTATATATTCTTATTCTACCTGGATTTGGAATGATCTCCCACATTGTAACCTATTATTCAGGAAAAAAGGAACCATTTGGATATATGGGAATGGTATGAGCTATAATATCAATTGGATTCCTAGGATTTATTGTATGAGCCCATCATATATTTACAGTAGGAATAGACGTCGACACACGGGCCTACTTCACATCAGCTACCATAATTATTGCTATCCCTACTGGAGTAAAAGTCTTCAGTTGACTAGCCACACTTCACGGAGGTAATATCAAATGATCCCCTGCTATGATATGAGCTCTGGGTTTTATCTTCCTTTTCACAGTTGGAGGCTTAACAGGAATTGTTCTAGCCAACTCTTCTCTTGACATTGTCCTCCACGACACATACTATGTAGTTGCACATTTCCATTACGTGTTATCAATAGGGGCTGTATTTGCTATTATAGGAGGATTTGTACACTGATTCCCACTATTCTCAGGCTACACCCTTAATGATACATGAGCCAAAATTCATTTTGCAATTATATTTGTAGGCGTAAATATAACTTTTTTCCCACAACATTTCTTAGGATTATCTGGTATACCACGACGATACTCTGACTACCCAGATGCATACACAATATGAAACACTATCTCATCTATAGGCTCATTCATCTCACTAACAGCAGTTATACTAATAATTTTCATTATCTGAGAAGCATTCGCATCTAAACGAGAAGTATTAACTGTAGACCTAACAACAACAAATCTAGAGTGACTAAATGGATGCCCTCCACCATATCACACATTTGAAGAACCTACATATGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Philantomba maxwellii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cephalophus maxwelli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Justification
Listed as Least Concern as the species remains widespread within its historical range, and abundant, adapting well to modified habitats and showing resiliency in the face of hunting pressure. Maxwell’s Duiker will probably continue to exist in large numbers well into the 2lst century, but even this abundant and resilient species cannot withstand increasing human populations and hunting pressures indefinitely. It has already been severely reduced in numbers or eliminated in those parts of its range with very high human population densities. This foretells its ultimate fate if unrestricted human population growth continues, unless current unrestricted hunting practices are replaced by some form of management which ensures sustainable offtake rates. This would also ensure its continued availability as bushmeat.

History
  • 1996
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Duiker populations have decreased from excessive hunting and habitat destruction. Of prime importance in the decreasing populations is the increased use of firearms by native populations in hunting these animals. While Maxwell’s duikers are not endangered, it is certain that their populations are below previous maximum levels. However, it is thought that the species will remain in abundance as long as ample habitat is available.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Generally abundant throughout the Guinean forest zone. It is the most common duiker species in Côte d’Ivoire, where Newing (2001) recorded a density of 79 / km² in a mixed, hunted farmland near Taï N.P.

East (1999) produced a total population estimate of 2,137,000, likely a conservative estimate. Despite its resilience to hunting pressure and its adaptability to degraded forest habitats, its numbers show a general tendency to decrease in many areas, especially as there are few protected areas within its range which receive effective levels of protection and management.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
While much of its original habitat has been modified or destroyed by the spread of agricultural settlement, it adapts to derived savannas and farm bush. Its major threats are human population growth and extensive hunting for bushmeat throughout its range states. It does show considerable resilience to hunting pressure, but not to intense poaching; for example, in the Comoé N.P. in Côte d’Ivoire, high levels of poaching led to numbers of Maxwell’s Duiker declining by more than 90% within 20 years (Fischer and Linsenmair 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in virtually all protected areas within its range and is well represented in areas such as Sapo (Liberia), Taï (Côte d’Ivoire) and Kakum, Bia and Nini-Suhien (Ghana).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of P. maxwellii on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Maxwell’s duikers are hunted by local peoples for their skins. The Mano and Gio peoples of the Mount Nimba Range in Liberia use large deadfall traps to catch these duikers. These traps can kill the animals, but duikers are also taken alive and are available for sale. In addition to being hunted and trapped for their skins, they are hunted for meat, which is available in large bushmeat markets and can provide hunters with a large and sustainable income. Maxwell’s duikers are rarely hunted for trophies due to their small size. Methods for trapping Maxwell’s duikers outside the Mount Nimba area include firearms and nets and snares placed on frequently used duiker trails.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Maxwell's duiker

Maxwell's duiker (Philantomba maxwellii), is a small antelope found in western Africa.

They grow to 30 in (76 cm) in length with a typical shoulder height of 14.5 to 16 in (37 to 41 cm) and weigh around 11 lb (5.0 kg). Its coat is either grey-brown or grey, with a white underbelly and white markings on its face. However, pale bluish, nearly purple coats have occurred rarely.

Maxwell's duikers live in lowland rainforests, where they eat herbs, fruits, and shrubs.

References

  1. ^ Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 715. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200904.
  2. ^ IUCN SSC Antelope Specialist Group (2008). Cephalophus maxwellii. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!