Overview

Distribution

Range Description

The White-bellied Duiker ranges in the west from southern Cameroon, south of the Sanaga River, through Gabon, Equatorial Guinea, northern and south-western Republic of Congo, and extreme south-western Central African Republic, and eastwards, north of the Congo River, to north-east DR Congo (East 1999; Wilson 2001; Hart in press). There are no confirmed records from Cabinda (Angola), south-eastern Central African Republic or Uganda (Hart in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Prefers moist lowland equatorial forests and mature closed-canopy forest; also present in older secondary forests, but absent from swamp forest, gallery forest, forest-savanna mosaics and cleared areas. It appears to prefer mono-dominant stands of Gilbertiodendron forest in areas such as Nouabale-Ndoki in Congo-Brazzaville and the lturi Forest in DR Congo (Hart in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalophus leucogaster

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGCTGACTATTCTCAACCAATCACAAAGACATTGGTACCCTATACCTCCTATTCGGTGCTTGAGCTGGCATAGTAGGAACCGCTCTAAGCTTATTAATCCGCGCTGAATTAGGTCAACCCGGAACCTTACTCGGAGACGACCAGATTTACAACGTAATCGTAACCGCACATGCATTTGTAATAATTTTCTTCATAGTAATACCCATCATAATTGGAGGCTTCGGCAACTGACTAGTCCCTCTGATAATTGGGGCCCCAGATATAGCATTCCCCCGAATAAATAATATAAGTTTCTGACTTCTCCCTCCCTCCTTCCTACTACTCCTAGCATCTTCTATAGTTGAAGCTGGAGCGGGGACTGGCTGAACTGTATATCCCCCTCTAGCAGGCAACCTGGCCCACGCAGGAGCCTCAGTAGACCTGACTATCTTCTCTCTACACCTTGCAGGTGTCTCTTCTATTTTAGGGGCTATTAATTTCATTACTACAATCATTAATATGAAGCCCCCTGCAATATCTCAATACCAAACCCCCTTATTTGTATGATCAGTACTAATCACTGCCGTATTATTACTCCTCTCCCTTCCCGTATTAGCAGCTGGTATCACGATACTATTAACTGATCGAAATCTAAACACAACCTTCTTTGACCCAGCAGGAGGTGGAGACCCCATCCTATACCAGCACTTATTCTGATTCTTCGGACACCCCGAAGTGTATATTCTTATTCTACCCGGATTTGGCATGATCTCTCACATCGTAACCTACTACTCAGGAAAAAAAGAACCATTCGGGTATATAGGAATAGTATGAGCTATAATATCAATTGGTTTCCTAGGGTTTATTGTATGAGCCCACCATATGTTTACAGTAGGTATGGACGTCGACACACGAGCCTACTTTACATCAGCCACCATAATTATTGCTATCCCTACTGGAGTAAAAGTCTTTAGCTGACTAGCTACACTTCACGGAGGTAATATCAAATGATCTCCCGCTATAATATGAGCTCTAGGCTTCATTTTTCTTTTCACGGTAGGAGGCTTAACAGGAATTGTTCTAGCCAACTCTTCTCTCGATATTGTTCTTCATGACACATATTATGTAGTCGCACACTTCCACTATGTACTGTCAATAGGAGCTGTATTTGCTATTATAGGAGGATTTGTGCATTGATTCCCACTATTCTCAGGCTACACCCTTAACACTACATGAGCCAAGATCCATTTTGTAATCATATTTGTAGGTGTGAATATAACTTTCTTCCCACAACATTTCTTAGGACTATCTGGTATACCACGACGATACTCCGACTACCCAGATGCATACACAATATGAAATACTATTTCATCTATGGGCTCATTCATCTCACTAACAGCAGTCATACTAATAATTTTTATCATCTGAGAAGCATTTGCATCTAAACGAGAAGTTCTAACCGTGGACCTAACCACAACAAACTTAGAATGACTAAACGGATGCCCTCCACCATATCATACATTTGAGGAACCCACATATGTTAATCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cephalophus leucogaster

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the species remains reasonably widespread with a total population estimated to number more than 250,000 animals. However, although the White-bellied Duiker is represented in protected areas in its range, its long-term survival is likely to become increasingly dependent on the maintenance of viable populations within national parks and reserves which are effectively protected against habitat destruction and illegal hunting. If current trends continue, this species will become increasingly restricted to areas where pressures of forest degradation and hunting are low. Given its susceptibility to hunting and the increasing rate of bushmeat hunting, it may already be on the way to qualifying as Near Threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species generally occurs at lower densities than other medium-sized duikers, and is uncommon or rare in many areas where it occurs (Wilson 2001, Hart in press). East (1999) produced a total population estimate of 287,000 animals. Like most other duikers of the Central African lowland equatorial forests, its numbers are generally stable in areas remote from settlement, but decreasing elsewhere because of forest degradation and bushmeat hunting.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The major threat to this species, especially given its occurrence at low densities, is likely to be hunting (both with snares and nets), and it is one of the first species to drop out of the small ungulate fauna in areas subject to heavy snare pressure (Hart in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Important protected areas for this species include Lopé Reserve (Gabon), Monte Alen N.P. (Equatorial Guinea), Dzangha-Ndoki N.P. (CAR), Odzala N.P. (Congo), and Kahuzi-Biega N.P., Maiko N.P. and Okapi Faunal Reserve (DR Congo). However, while some of these areas receive moderate to high levels of protection and management (e.g., Dzanga-Sangha-Dzanga-Ndoki, Lope, Odzala), others offer little or no protection against the expansion of logging, settlement and meat hunting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-bellied duiker

The white-bellied duiker (Cephalophus leucogaster) is a duiker found in central Africa. Little is known on the ecology of the species, and only some information on habitat and diet is available.

Duikers are a fairly small species of antelope that originate from, and still reside in, sub-Saharan Africa.

The white-bellied duiker ranges in Cameroon, the Central African Republic, the Republic of the Congo, the Democratic Republic of the Congo, Equatorial Guinea, and Gabon,[2] while it is likely to have been extirpated in Uganda.[3]

References

  1. ^ IUCN SSC Antelope Specialist Group (2008). Cephalophus leucogaster. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ (Wilson & Reeder, 1993)
  3. ^ (East, 1996)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!