Overview

Brief Summary

Biology

The secretive nature and inaccessible habitat of Jentink's duiker has made it a difficult species to study, and no research on this species has ever been undertaken in Africa (4). It is thought to be active during periods of the day and night (4), and is believed to be territorial (2), spending its days hiding in dense vegetation, hollow trees or under fallen trunks (2). Unusually for duikers, which are relatively solitary animals, Jentink's duikers sometimes rest in pairs during the day (2). Incredibly, Jentink's duiker is so secretive, that it survived unknown for many years on the steep, forested slopes overlooking Freetown, Sierra Leone, an enormous city with over a million inhabitants (8). Like other duikers, Jentink's duiker has a diet primarily of fruit which it can feed on in the safety of its impenetrable habitat. However, when fruit is scarce, it ventures out under the cover of darkness to feed on palm nuts, mangos and cocoa pods in plantations. It has also been observed feeding on the growing stems of tree seedlings, and using its hooves to dig up roots to chew (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

After the enigmatic Jentink's duiker was discovered and described in 1885 (4), there were no sightings for over 50 years (5), probably due to their secretive lives in dense forest (6). Jentink's duiker is easy to distinguish from other duikers due to its striking colouration. The black head and neck are offset with a contrasting white band extending across the shoulders to the top of the front legs, and the hind-quarters are a grizzled grey (2). Underneath each eye is an extremely large scent gland (4), thought to be used to mark their territories (6). Both males and females have smooth, straight, black horns that extend backwards from the head, and are long compared to other duikers, measuring up to 20 centimetres (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Jentink's duiker (Cephalophus jentinki)

The enigmatic Jentink's duiker, gidi-gidi (Krio) or kaikulowulei (Mende) was discovered and described in 1885, but there were no sightings for over 50 years. It is named in honour of Fredericus Anna Jentink

It stands around 80 cm (31 in) tall at the shoulder and weighs about 70 kg (150 lb), making it the largest species of duiker. The black head and neck are offset with a contrasting white band extending across the shoulders to the top of the front legs; the hind-quarters are grizzled grey and the undersides are white. Under each eye is an extremely large scent gland, thought to be used to mark its territory. Both sexes have smooth, straight, thin, black horns that extend backwards from the head and curl back a little at the ends, reaching 14-21 cm (5.5 and 8.3 in).

It occurs in fragmented populations in the western part of the Upper Guinean forest block, from scattered enclaves in Sierra Leone, where it was positively reported for the first time in 1989, through Liberia to south-western Côte d’Ivoire; there are no confirmed records from Guinea. It inhabits very thick primary forest; it also enters secondary growth, farm bush adjacent to high forest, scrub, farms, plantations and occasionally, the seashore. It requires a diversity of fruiting trees and very dense shelter, rather than forest type.

The duiker has a secretive nature and survived unknown for many years on the steep, forested slopes overlooking Freetown, Sierra Leone, an enormous city with over a million inhabitants. It is thought to be active during periods of the day and night and to be territorial, sheltering by day, hiding in dense thickets and other vegetation, buttress roots, hollow trees or under fallen trunks. When frightened, it runs very quickly, but wears itself out easily. Duikers are relatively solitary, but Jentink's duikers may rest in pairs by day.

Jentink's duiker has a diet primarily of fruit, which it can eat in the safety of its impenetrable habitat. When fruit is scarce, it ventures out under the cover of darkness to feed on palm nuts, mangos and cocoa pods in plantations. It also eats flowers and leaves that have fallen from the canopy. It also feeds on the growing stems of tree seedlings and uses its hooves to dig up roots to chew. It was said to be a significant crop pest by rural communities in some areas of south-east Liberia.

A wild born specimen was 21 years old when it died in captivity (3).

The IUCN Red List classifies the duiker as Endangered, which is listed on Appendix I of CITES, meaning that international trade in this species is only allowed in exceptional circumstances. The total population is probably about 2000 individuals and is declining in the face of ongoing habitat loss and bushmeat hunting (2). Over two generations (about 10-12 years), the population could decline by 20%. The duiker seems to be uncommon/rare throughout its range. East (4) estimated the total population as about 3,500, but Wilson (1) doubted if there were more than 2,000 left. The population trend is downwards except for a few remote areas where forest destruction and hunting pressures are lower (e.g. Sapo National Park), and the few areas with effective protection. The major threats are widespread forest destruction (due to, for example, logging and human settlement) and hunting for meat. Much of the natural forest has been lost to human activities or modified by human disturbance; the area of primary forest in Sierra Leone is 6% of the original forest cover. The remaining forest in Côte d'Ivoire and Sierra Leone is highly fragmented and remains under pressure as humans seek to use more forest for farmland, timber, fuelwood and mineral resources. Duikers are highly sought after by hunters as they are easily shot or captured, easily transported by foot and have enough meat to be highly profitable. In many areas, duikers are hunted at unsustainable rates. Without action, Jentink's could be extinct within 10 years. Its long-term survival is closely linked to the future of remaining blocks of primary forest, such as the Tai and Sapo National Parks, the Krahn-Bassa and Grebo National Forests in Liberia, Cavaiiy-Gouin Forest Reserve in Côte d'Ivoire and Western Area Forest Reserve in Sierra Leone. In some areas, hunting of wild animals is prohibited, but this cannot be enforced. The public should be educated about the plight of duikers and the importance of sustainable hunting.

In 1971, the species was successfully bred in the Gladys Porter Zoo (2).

  • 1. Wilson, V. J. 2001. Duikers of Africa: Masters of the African Forest Floor. Directory Publishers, Bulawayo, Zimbabwe.
  • 2. Ellis, Richard (2004). No Turning Back: The Life and Death of Animal Species. New York: Harper Perennial. p. 261. ISBN 0-06-055804-0.
  • 3. Weigl, R. (2005). Longevity of Mammals in Captivity: from the living collections of the world. E Schweizerbart'sche Verlagsbuchhandling, Stuttgart.
  • 4. East, R. (1999). African Antelope Database 1999. IUCN, Gland, Switzerland and Cambridge, UK.
  • Other references
  • IUCN SSC Antelope Specialist Group (2008). Cephalophus jentinki. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification for considering this species endangered.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Olingo

Supplier: Olingo

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Confined to the western part of the Upper Guinean forest block, from Sierra Leone (where only positively reported for the first time in 1989) through Liberia to western Côte d’Ivoire; there are no confirmed records from Guinea (East 1999; Hoppe-Dominik in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Sierra Leone, Liberia, Ivory Coast

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Fragmented populations of Jentink's duiker occur within Sierra Leone, Liberia and Côte d'Ivoire (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Jentink’s Duiker formerly occurred widely in primary forest; it also enters secondary growth and farm bush adjacent to high forest, and in Liberia was stated to be a significant crop pest by rural communities in some areas of the south-east (East 1999).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Jentink's duiker primarily inhabits primary forest, but can also be found in secondary forest, scrub, farms, plantations and occasionally, the seashore (2). A diversity of fruiting trees and very dense shelter appear to be the primary habitat requirements rather than forest type (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 21 years (captivity) Observations: One wild born specimen was 21 years old when it died in captivity (Richard Weigl 2005). Still, not much is known about these endangered animals and maximum longevity could be underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalophus jentinki

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGTTGATTATTCTCAACCAATCACAAAGACATTGGTACCCTGTACCTCCTATTCGGTGCTTGAGCTGGCATAGTAGGAACCGCTCTAAGCCTATTAATCCGCGCTGAATTAGGTCAACCCGGAACCCTACTCGGAGATGACCAGATCTACAACGTAATCGTAACCGCACATGCATTTGTAATAATTTTCTTTATGGTAATGCCTATTATAATTGGAGGCTTTGGCAATTGGCTAGTCCCTCTGATAATTGGTGCCCCAGATATAGCATTTCCCCGAATAAACAACATAAGTTTCTGACTTCTCCCTCCCTCTTTCCTACTACTCCTGGCATCTTCTATAGTTGAAGCCGGAGCAGGAACTGGCTGAACCGTATATCCTCCTCTAGCAGGTAACCTAGCCCACGCAGGAGCTTCAGTGGACCTAACTATCTTCTCTCTACACCTAGCGGGTGTTTCTTCAATTTTAGGAGCTATTAATTTCATTACTACAATCATTAATATAAAACCCCCTGCAATATCTCAATACCAAACCCCCTTATTTGTATGATCAGTACTAATTACTGCCGTATTATTACTCCTCTCCCTTCCTGTACTAGCAGCTGGTATTACAATACTATTAACGGACCGAAATTTAAACACGACCTTCTTCGACCCAGCAGGGGGCGGAGACCCTATCCTGTACCAACACTTATTCTGATTCTTTGGACACCCCGAAGTATATATTCTTATTCTACCCGGATTTGGGATGATCTCTCACATCGTGACCTACTACTCAGGAAAAAAAGAACCATTTGGATATATAGGAATGGTATGAGCCATGATATCAATTGGATTCCTAGGATTTATTGTATGAGCCCACCATATATTCACAGTAGGAATAGACGTTGACACTCGGGCCTACTTCACATCAGCCACYATAATCATTGCTATTCCTACTGGAGTTAAGGTCTTTAGTTGACTAGCCACACTTCACGGAGGCAATATCAAATGATCCCCCGCTATAATATGAGCTCTGGGCTTCATTTTCCTTTTCACAGTCGGAGGCTTAACAGGAATTGTTCTAGCCARCTCTTCYCTTGATATTGTTCTTCAYGATACATACTATGTAGTTGCACACTTCCACTACGTACTATCAATAGGAGCYGTATTCGCTATTATAGGGGGATTCGTACATTGATTCCCACTATTCTCAGGTTATACCCTCAACGCTACATGAGCTAAAATTCAYTTTGTAATCATATTTGTAGGYGTAAACATAACYTTCTTCCCACAACATTTCTTGGGATTATCTGGCATGCCACGACGGTACTCYGACTACCCAGACGCATACACAATATGAAATACTATTTCATCTATAGGCTCATTTATCTCACTAACAGCAGTCATACTAATAATTTTTATTATCTGAGAAGCATTCGCATCTAAACGAGAAGTCCTAACTGTAGACCTAACTACAACAAACCTAGAGTGACTAAACGGATGCCCTCCACCATATCATACATTTGAAGAACCTACATATGTTAATCTAAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalophus jentinki

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C1

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Endangered as the total population is probably on the order of 2000 individuals, and continuing to decline in the face of ongoing habitat loss and bushmeat hunting. Over the course of two generations (estimated at 10-12 years), it is entirely feasible that the population could decline by as much as 20%.

History
  • 1996
    Vulnerable
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 07/27/1979
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Cephalophus jentinki , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This large duiker appears to be uncommon/rare throughout its range. East (1999) produced a total population estimate of about 3,500, but Wilson (2001) doubted whether there were even more than 2,000 animals left throughout the range. The population trend is downwards except for a few remote areas where forest destruction and hunting pressures are lower (e.g., Sapo National Park), and the few areas where there is effective protection.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The major threats to this species are widespread forest destruction (due to, for example, logging and human settlement) and hunting for meat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Much of the natural forest within the range of the Jentink's duiker has been lost to human activities or modified by human disturbance; the area of primary forest in Sierra Leone is now just six percent of the original forest cover (9). The remaining forest in Côte d'Ivoire and Sierra Leone is highly fragmented and remains under pressure as humans seek to use more forest for farmland, timber, fuelwood and mineral resources (9). Compounding the loss of its habitat is the threat of the bushmeat trade. Duikers are highly sought after by hunters as they are easily shot or captured, easily transported by foot and have sufficient meat to be highly profitable (10). In many areas duikers are now the main component of the trade in wildlife species (6), and evidence suggests that they are hunted at unsustainable rates (10).While Jentink's duiker is currently assessed as Vulnerable on the IUCN Red List, other scientists believe that due to hunting, the loss of vast areas of land being converted for agriculture, and the significant lack of protection throughout its range, Jentink's duiker may be Endangered, or even Critically Endangered, and without action, could be extinct within the next ten years (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The long-term survival of Jentink’s duiker is closely linked to the future of the remaining blocks of primary forest, in particular Tai National Park and Sapo National Park, and other key areas such as Krahn-Bassa and Grebo National Forests in Liberia, Cavaiiy-Gouin Forest Reserve in Côte d'Ivoire and Western Area Forest Reserve in Sierra Leone (East 1999).
Listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Jentink's duiker is listed on Appendix I of the Convention on International Trade in Endangered Species (CITES), meaning that international trade in this species is only allowed in exceptional circumstances (3). However, this does little to control the threat of hunting within its range countries, and whilst in some areas of its distribution hunting of wild animals is now prohibited (2), such a ban is impractical and cannot be enforced (9). Unlike Sierra Leone and Côte d'Ivoire, Liberia still holds some large areas of forest, with the largest stands being in protected areas and forest reserves (9). The continued protection of these areas appears to be essential to the continued survival of Jentink's duiker, along with efforts to educate the public about the plight of duikers and the importance of sustainable hunting (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Jentink's duiker

Jentink's duiker (Cephalophus jentinki), also known as gidi-gidi in Krio and kaikulowulei in Mende, is a forest-dwelling duiker found in the southern parts of Liberia, southwestern Côte d'Ivoire, and scattered enclaves in Sierra Leone. It is named in honor of Fredericus Anna Jentink.

Jentink's duikers stand around 80 cm (31 in) tall at the shoulder and weigh about 70 kg (150 lb), making them the largest species of the duikers. They are gray from the shoulders back and dark black from the shoulders forward.[2] A white band goes over the shoulders, between the two colours and joining the white undersides. Jentink's duikers have long, thin horns, which curl back a little at the ends, and reach between 14 and 21 cm (5.5 and 8.3 in).

Jentink's duikers live mainly in very thick rainforest, where they eat fruit, flowers, and leaves which have fallen from the canopy, as well as stems of seedlings, roots, and, to the annoyance of local farmers, palm nuts, mangos, and cocoa pods. They are nocturnal and shelter during the day in dense thickets, or buttress roots, apparently in pairs. Jentink's duikers are reported to be territorial animals, and when frightened, will run very quickly, but wear themselves out easily.

The species was first recognized as a new species in 1884, though it was not described until 1892.[2] The species then vanished until a skull was found in Liberia in 1948. Sightings have occurred in its habitat since the 1960s. In 1971, the species was successfully bred in the Gladys Porter Zoo.[2]

Recent population numbers are not available. In 1999 it was estimated that around 3,500 Jentink's duikers remained in the wild, but the following year others suggested less than 2,000 were likely to remain.[1] They are threatened primarily by habitat destruction and commercial bushmeat hunters.[2]

References[edit]

  1. ^ a b IUCN SSC Antelope Specialist Group (2008). Cephalophus jentinki. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification for considering this species endangered.
  2. ^ a b c d Ellis, Richard (2004). No Turning Back: The Life and Death of Animal Species. New York: Harper Perennial. p. 261. ISBN 0-06-055804-0. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!