Overview

Brief Summary

The Red Lechwe (Kobus leche) is a heavily built antelope that is notable for its splayed, elongated hooves (which are generally hidden from view in water, mud, or grass). The eyes are widely spaced and the male has long horns that sweep back and are heavily annulated (i.e., with conspicuous ring-like divisions).

Red Lechwe are found in scattered locations in eastern Angola, eastern Namibia, northern Botswana, and western Zambia. They inhabit seasonal floodplains and shallow swamps adjacent to open water. The interface between inundated and dry grasslands is the most heavily used habitat. They tend to avoid woodlands and are rarely found in water deeper than 50 cm. They can move efficiently through flooded terrain using a bounding gait whereby all four feet touch the ground and leave the ground together. On hard ground, they are slow and clumsy. Lechwes are closely tied to swampy floodplains by their physiology and soft hooves. When water levels are low, predation by Lions (Panthera leo) and African Wild Dogs (Lycaon pictus) increases. 

Kobus leche was long treated as a single species including as subspecies K. l. lecheK. l. kafuensis, and K. l. smithemani, but these taxa were treated by Cotterill (2005) and Huffman (2011) as full species, along with the closely related and newly recognized K. anselli.

Throughout much of the range of this species, populations have been decimated by unsustainable hunting, but they tend to do well in protected areas. Around 98,000 individuals are believed to exist in the wild, around 85% of them in the Okavango Delta of Botswana.

(Kingdon 1997; Cotterill 2005; Huffman 2011)

  • Cotterill, F.P.D. 2005. The Upemba lechwe, Kobus anselli: an antelope new to science emphasizes the conservation importance of Katanga, Democratic Republic of Congo. Journal of Zoology 265: 113-132.
  • Huffman, B.A. 2011. Red Lechwe (Kobus leche). P. 671 in: Wilson, D.E. and Mittermeier, R.A., eds. Handbook of the Mammals of the World. Volume 2. Hoofed Mammals. Lynx Edicions, Barcelona.
  • Kingon, J. 1997. The Kingdon Field Guide to African Mammals. Academic Press, San Diego.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The distribution of the Lechwe is discontinuous, with major populations restricted to extensive wetlands in Botswana, Namibia, Angola and Zambia, and remnants of populations in south-east DR Congo. Present distribution is much the same as its historical distribution, except that range has contracted, particularly over the last century (East 1999; Jeffery and Nefdt in press). The ranges of the four subspecies are as follows (from Jeffery and Nefdt in press):

The Kafue Lechwe is confined to the Kafue Flats in central Zambia.

The Black Lechwe is confined to the southern half of the Bangweulu Swamps of northern Zambia. It is unlikely to survive in its former range on the Chambeshi floodplains along the upper Luapula floodplain that forms the common frontier between Zambia and south-eastern DRC.

Red Lechwe are found in the Okavango Delta, and the Kwando/Linyanti/Chobe system of northern Botswana; the Okavango, Kwando/Linyanti/Chobe, Mashi, and Zambezi River systems of north-east Namibia; and the upper Zambezi and middle Kafue of Zambia.

The extinct Robert’s Lechwe was reportedly restricted to within the Luongo and Kalungwishi drainage systems of the lower Luapula locality of north-east Zambia.

The Upemba Lechwe is restricted to the Upemba wetlands, Kamalondo depression, in the Katanga
Province of south-eastern Democratic Republic of Congo (Cotterill 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Lechwe are found in the southern savanna in Africa. The population is centered in Zambia, but small populations of lechwe are found along rivers in Zambia, Angola, and Botswana (Estes, 1991).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Southern Africa

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Lechwe are medium-sized antelopes, with heights ranging from 90 - 112 cm. The color of the lechwe is chestnut with white underparts, throat, and facial markings. Males darken with age. Lechwe have dark leg and body markings, and these markings vary in color, from black to red, and are noticeable between the different subspecies. The horns of the lechwe range in length from 45 - 92 cm and are relatively thin. Their hooves are adapted for swampy terrain. While lechwe do not have scent glands, their coats are greasy and have a distinct odor (Estes, 1991).

Range mass: 61.6 to 128 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Lechwe are associated with wetlands, preferring the shallow water margins of floodplains and swamps (less than a metre deep), although they may occasionally swim across deep-water areas. They typically frequent light woodlands and termitaria grasslands on the periphery of inundated floodplains, floodplain grasslands and water-meadows among seasonally inundated floodplains, shallow water meadows of permanently inundated swamps and lagoons, and occasionally papyrus and reed beds of permanent deep-water swamps (Jeffery and Nefdt in press). Southern Lechwe are grazers, feeding mainly on floodplain and aquatic grasses. Nefdt (1996) discusses an instance in which Lechwe adapted their reproductive behaviour to changes in ecology including those induced by human activities.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lechwe prefer areas of the flood plains that border swamps because they are close to water and food. The largest populations can be found on flat plains where the wet meadow is maintained throughout the flood cycle. When there is extreme flooding, lechwe take refuse in the woodlands (Estes, 1991).

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Lechwe eat nutritious grasses that are found in flooded meadows. In order to get to their food, lechwe will feed in water up to their bellies. During the cool dry weather, they do not have to drink, but in the dry hot weather, they may need to drink up to three times a day (Estes, 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
15.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25.4 years (captivity) Observations: In the wild, it is estimated these animals may live up to 15 years (Bernhard Grzimek 1990). In captivity, they have been known to live up to 25.4 (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Lechwe breed in a two and a half month period during the rains, which is usually between November and February. Females are able to breed as early as one and a half years of age but males are not mature until five years of age. The gestation period is seven to eight months, and two thirds of the calves are born in a two month peak, from mid-July to mid-September on the Kafue Flats. When the mothers give birth, they either do so singly or in small groups. Calves are born in covered and dry areas and remain concealed for two to three weeks. Mothers suckle their young both early and late in the day. Once they are done hiding, young calves form groups of up to 50 young, which are mainly independent of their mothers. Calves are weaned in five to six months (Estes, 1991).

Range number of offspring: 1 to 1.

Range gestation period: 7.17 to 8.27 months.

Range weaning age: 5 to 6 months.

Average birth mass: 5100 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1050 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
898 days.

Parental Investment: extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Kobus leche

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGACTATTCTCAACTAACCACAAAGACATCGGTACCCTATATCTCCTATTTGGTGCTTGAGCCGGTATAGTAGGAACTGCCCTAAGTCTACTAATCCGCGCCGAATTAGGCCAACCTGGAACCCTCCTTGGAGATGATCAAATTTACAACGTTGTTGTAACTGCACACGCATTTGTAATAATTTTCTTTATAGTAATACCTATCATGATTGGAGGGTTCGGTAATTGACTAGTTCCTCTAATAATTGGCGCTCCCGACATAGCATTTCCCCGAATAAATAATATAAGTTTTTGACTCCTCCCTCCTTCCTTCTTATTACTTCTAGCATCTTCCATAGTTGAGGCTGGAGCTGGAACAGGCTGAACCGTATATCCCCCTCTAGCAGGCAACTTAGCTCACGCAGGAGCTTCAGTTGACCTGACTATTTTCTCCCTTCACTTAGCAGGTGTTTCCTCAATCCTAGGGGCAATCAATTTCATTACAACAATCATCAATATAAAACCTCCTGCAATATCACAATACCAAACCCCTCTGTTCGTATGATCCGTACTAATCACCGCTGTACTATTACTCCTCTCACTTCCTGTATTAGCAGCTGGTATTACAATACTACTAACAGACCGAAATCTAAATACAACCTTCTTCGACCCGGCAGGAGGAGGGGACCCAATCCTATATCAACACCTATTTTGATTCTTTGGACATCCGGAGGTATATATTCTTATTCTACCCGGATTTGGAATAATTTCTCATATCGTAACTTACTACTCAGGAAAAAAAGAACCTTTCGGGTATATGGGAATAGTTTGAGCTATAATATCAATTGGATTCTTAGGATTTATTGTATGGGCCCATCACATGTTTACAGTCGGAATGGATGTTGACACACGAGCCTACTTCACATCAGCCACAATAATTATTGCTATTCCAACTGGGGTAAAAGTGTTTAGCTGACTAGCTACACTTCACGGAGGCAATATTAAATGATCTCCTGCCATAATATGAGCCTTAGGCTTTATTTTCCTCTTTACAGTAGGAGGCTTAACCGGGATTGTCTTAGCAAATTCTTCCCTTGACATTGTTCTTCACGACACATATTATGTAGTTGCACACTTCCACTATGTCTTATCAATAGGGGCTGTGTTCGCTATTATGGGAGGATTTGTTCATTGATTTCCTCTATTCTCAGGATATACTCTCAACGATACATGAGCCAAAATTCACTTTGCAATTATATTTGTAGGGGTAAACATAACTTTTTTCCCACAACATTTCCTAGGATTATCTGGCATGCCACGACGGTACTCTGATTACCCAGACGCATACACAATATGAAATACTATTTCATCTATAGGCTCATTTATCTCACTAACAGCAGTAATACTAATAGTTTTTATTATCTGAGAAGCATTTGCATCTAAACGGGAAGTCTCAACTGTAGACCTAACCACAACAAATCTAGAGTGACTAAACGGATGCCCCCCACCATATCACACATTTGAAGAGCCTACATACGTTAACCCTAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Kobus leche

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Remains widespread in South-Central Africa though restricted to swamp and floodplain margins. Although all surviving subspecies have undergone substantial declines, most populations are now stable or increasing and total numbers estimated at ca. 200,000 (East 1999). The species’ conservation status should not deteriorate further as long as its habitats are maintained in several key areas - in particular Bangweulu (Black Lechwe), Kafue Flats (Kafue Lechwe) and Okavango, Linyanti, Busanga and Caprivi (Red Lechwe) - and illegal hunting is adequately controlled.

History
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed: Southern Africa


Population detail:

Population location: Southern Africa
Listing status: T

For most current information and documents related to the conservation status and management of Kobus leche , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lechwe are listed under the following: CITES - Appendix II; US ESA - Threatened; and IUCN - Vulnerable (Wilson, 1993). A century ago, the lechwe poplulation may have numbered half a million, but it has been dropping ever since then. The greatest change was between 1971 - 1987. This was due to the building of hydroelectric dams that changed the natural flooding cycle. Even poaching of these animals did not cause considerable damage to the population (Estes, 1991).

US Federal List: threatened

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Population estimates based on aerial surveys are available for all of the major surviving Lechwe populations. East (1999), correcting for undercounting biases, produced a total population estimate of 98,000 Red Lechwe (85% in the Okavango Delta), 78,000 Kafue Lechwe and 36,000 Black Lechwe. Overall population trends are stable or increasing for the Black and Kafue Lechwes and for the Red Lechwe in protected areas, but are decreasing for the Red Lechwe outside protected areas (East 1999).

The Kafue Lechwe population has been monitored for many years, and has the most reliable time-series of population records. In the early 1970s, estimates consistently put the population at between 90,000 and 110,000. By the early 1980s the population had been reduced to between 40,000 and 45,000, but has increased thereafter slowly to between 50,000 and 70,000 (East 1999; Jeffery and Nefdt in press, and references therein).

Black Lechwe increased from 16,000-17,000 in the late 1960s to about 40,000 in 1980 and subsequently decreased to 30,000, where it seems to have stabilised since the late 1980s (East 1999; Jeffery and Nefdt in press).

The Upemba Lechwe population of DR Congo has declined from about 20,000 to less than 1,000 since the 1980s (Cotterill 2005).

Roberts Lechwe is extinct.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Lechwes have been eliminated from large parts of their former range by poaching for meat. Poaching is implicated in apparent large-scale changes in the dry season distribution of Black Lechwe, with a dramatic decrease in the numbers occupying the western end of the main Bangweulu Swamps where poaching is intense. In contrast, its numbers appear to be stable or increasing in the central section of the main swamp, and there has been a steady increase in the dry season population on the 100 km² Chimbwi Plain in south-eastern Bangweulu (East 1999). Commercial poaching is also the primary reason for the dramatic decline in numbers of the Upemba Lechwe (Cotterill 2005).

Droughts and disruption of the natural flooding regime are significant causes of population decline. For example, water flow on the Kafue floodplain has been regulated almost entirely by human needs since the construction of hydroelectric dams at the eastern and western ends of the Flats in the 1970s. The Kafue Flats are also used for livestock grazing and the peripheral area is densely settled, particularly in the south. As already noted, the population of Kafue Lechwe decreased from 90,000-100,000 in the early 1970s, before the closure of the dams, to 40,000-50,000 in the early to mid-1980s (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Today, Lechwes survive mainly in and around protected areas and game reserves.

Red Lechwe occur in the Moremi G.R. and Chobe N.P. (Botswana), Sioma Ngwezi, Liuwa Plains and Kafue National Parks, and the West Zambezi and Kasonso-Busanga Game Management Areas (Zambia), Kameia N.P. and the Luando, Mavinga and Luiana Game Reserves (Angola), and the Western Caprivi G.R. and the Mahango Game Park (Namibia) (Jeffery and Nefdt in press).

Kafue Lechwe occur only in Lochinvar and Blue Lagoon National Parks, both Ramsar sites, and the Kafue Flats Game Management Area in Zambia (Jeffery and Nefdt in press).

Black Lechwe occur only in the Bangweulu Game Management Area, and the Kalasa-Mukoso Game Management Area, while the Upemba National Park is the only known protected area refuge for the Upemba Lechwe (Jeffery and Nefdt in press).

The long-term survival of the lechwe in the wild is totally dependent on the effective protection and management of its remaining populations and their wetland habitats in a few critical areas, in particular Bangweulu (Black Lechwe), Kafue Flats (Kafue Lechwe), Okavango, Linyanti, Busanga and Caprivi (Red Lechwe), and Upemba N.P. (Upemba Lechwe). A significant proportion of the species’ total numbers occurs outside national parks and game reserves (>80% for the Red Lechwe). It is therefore likely that both revenue generation through sustainable offtake by sport hunters which capitalises on the species’ value as a trophy animal and the development of sustainable harvesting to provide meat for local people, e.g., in Bangweulu and Kafue Flats, will play an increasingly important role in the conservation of lechwe populations (East 1999).

Populations of Lechwe are maintained in captivity.

Listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Lechwe have been hunted and poached by humans for profit (Estes, 1991). Also, lechwe are one of many African mammals that are a tourist attraction (Stuart and Stuart, 1995).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lechwe

A female lechwe "flying" over a patch of clear water early in the morning in the Okavango Delta

The lechwe, or southern lechwe, (Kobus leche) is an antelope found in Botswana, Zambia, southeastern Democratic Republic of the Congo, northeastern Namibia, and eastern Angola, especially in the Okavango Delta, Kafue Flats and Bangweulu Swamps.

Lechwe stand 90 to 100 cm (35 to 39 in) at the shoulder and weigh from 70 to 120 kg (150 to 260 lb). They are golden brown with white bellies. Males are darker in colour, but general hue varies depending on subspecies. The long, spiral-structured horns are vaguely lyre-shaped, they are found only in males. The hindlegs are somewhat longer in proportion than in other antelopes, to ease long-distance running in marshy soil.

Lechwe are found in marshy areas where they eat aquatic plants. They use the knee-deep water as protection from predators. Their legs are covered in a water-repellant substance which allows them to run quite fast in knee-deep water.

Lechwe are diurnal. They gather in herds which can include many thousands of individuals. Herds are usually all of one sex, but during mating season they mix.

Subspecies[edit]

Lechwe antelopes in Berlin zoological park

Traditionally, four subspecies of the lechwe have been recognized.[2][3] Additionally, the Upemba lechwe, which only was described in 2005, is treated as a subspecies of the lechwe by some authorities.[1]

  • Red lechwe or Zambesi lechwe (K. l. leche) - most of range, overall tawny-fawn with black to front of front legs
  • Kafue lechwe or brown lechwe (K. l. kafuensis) - Kafue Flats, as previous, but front legs almost entirely black, vulnerable.[4]
  • Roberts' lechwe or Kawambwa lechwe (K. l. robertsi) - formerly near Kawambwa, extinct.[5]
  • Black lechwe or Bangweulu lechwe (K. l. smithemani) - Bangweulu Swamps, adult males blackish, vulnerable[6]
  • Cape lechwe or Venter's lechwe (K. l. venterae) - now extinct, but formerly inhabited the marshes and fens of the North West, Free State, Northern Cape and Eastern Cape Provinces of South Africa, as far south as Cradock and Tarkastad

References[edit]

  1. ^ a b IUCN SSC Antelope Specialist Group (2008). Kobus leche. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 10 May 2006. Database entry includes a brief justification of why this species is of least concern.
  2. ^ Groves, C. P. (2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. OCLC 62265494. ISBN 0-801-88221-4. 
  3. ^ Haltenorth, T. & H. Diller. 1980. Mammals of Africa including Madagascar. Harpercollins Publishers. ISBN 0-00-219778-2
  4. ^ IUCN SSC Antelope Specialist Group (2008). Kobus leche ssp. kafuensis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 23 July 2008.
  5. ^ IUCN SSC Antelope Specialist Group (2008). Kobus leche ssp. robertsi. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 23 July 2008.
  6. ^ IUCN SSC Antelope Specialist Group (2008). Kobus leche ssp. smithemani. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 23 July 2008.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!