Overview

Brief Summary

Biology

The African buffalo is a gregarious animal, the savanna subspecies forming large, imposing herds consisting of over one thousand individuals (3). The forest buffalo, due to its more restricted habitat, forms small groups of up to 12 animals, consisting of related females and their offspring and one or more males (2). Males not belonging to a herd are solitary, or form bachelor herds (2). Living in a herd has its advantages; information can be shared regarding the best places to feed, and it offers increased protection against predators (6). Bonds between females in a herd are strong (2), and if one is attacked by a predator such as a lion, the rest of the herd will respond to its bellowing distress calls and rush to its defence. A herd of buffalo are easily capable of driving away a whole pride of lions to protect a herd member (5). Living in large herds is not as important for the forest buffalo as they live in a habitat that does not suit carnivores, such as the lion, and they can easily retreat into cover if required (2). African buffalos spend most of their day lying in the shade to escape the heat. They can often be found drinking water in the early morning and late afternoon, and most feeding takes place during the cooler night (3). The African buffalo grazes extensively on fresh grass, turning only to herbs, shrubs and trees when there is a deficiency of grass (5). Their dietary habits are responsible for opening up areas of long grassland for other species with more selective feeding habits, and thus they play an important ecological role in the savannas of sub-Saharan Africa (5). March to May is the primary period of mating in the African buffalo, resulting in a pregnancy of about 11 months (2), with calves born from January to April (5). The bond between the mother and calf is very strong (2), and within just a few hours, the newborn calf is capable of keeping up with its herd (3). African buffalo are known to live for 26 years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The strong and imposing African buffalo is Africa's only wild cattle species (3), and one of the 'Big Five' mammals that were once popular with trophy hunters (4). With its bulky build and thick horns, it is easy to see why the African buffalo is considered to be a dangerous animal; and their propensity to attack and even kill humans when wounded by an arrow or bullet only acts to reinforce this reputation (3). There are two recognised subspecies of the African buffalo. Syncerus caffer caffer, the cape or savanna buffalo, is the larger of the two, with large ears fringed with hair hanging below their massive horns (3). It has a short, dark brown to black coat. The slightly smaller and lighter forest buffalo S.c. nanus has a reddish to dark red-brown coat (3), and smaller, swept-back horns (2). Distinctive tassels hang from the tips of the forest buffalo's ears (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The species is distributed throughout sub-Saharan Africa, but is now generally confined to protected areas, within which it is well represented, and other areas which are sparsely settled. In West Africa, they are now extinct in The Gambia, probably occur only as vagrants in Guinea, and the population in Mali’s Bafing Faunal Reserve is probably the country’s last (East 1999; Prins and Sinclair in press). African Buffalo are also extinct in Eritrea (East 1999). In South Africa, they have been reintroduced to areas from which they were formerly extirpated; likewise, they were reintroduced in Swaziland, where the indigenous population was extirpated.

African Buffalo were probably extirpated from Bioko Island sometime between 1860 and 1910 (Butynski et al. 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range

The African buffalo occurs in sub-Saharan Africa. It used to roam across all but the driest parts (2), but today few populations exist outside the confines of national parks and large conservation areas (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The African buffalo is an extremely large animal. The length from the head to the back ranges from 2,100 mm to 3,000 mm; tail length ranges from 750 mm to 1,100 mm; and the shoulder height ranges from 1,000 mm to 1,700 mm. African buffalos have large heads and limbs along with a broad chest. The ears on these buffalos are large and droopy. The horns of the African buffalo either spread out and downward, upward, or out and back. In males, the two horns are joined by a boss, which is a shield that covers the entire head. Size varies between subspecies of the African buffalo; S. c. caffer, found in the eastern savannahs, may be twice as large as S. c. nana, which occurs in equatorial forests. The color of buffalo hair ranges from brown to black. Young buffalos have a dense covering of hair; adults have sparce hair; and very little hair is present on the very old (Nowak, 1983).

Range mass: 500 to 900 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
African Buffalo inhabit a wide range of habitats, including semi-arid bushland, Acacia woodland, miombo Brachystegia woodland, montane grasslands and forest (to elevations well over 4,000 m asl), coastal savannas, and moist lowland rainforests. They are absent only from deserts and subdeserts, such as the Namib and the Saharan/Sahelian transition zone (Prins and Sinclair in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

African buffaloes are found in arid biomes, including areas with rivers, lakes, and swamps. They are found at sea level as well as in mountainous altitudes. African buffaloes like dense cover, but are found in open woodlands as well (Estes, 1991).

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The savanna buffalo inhabits open woodland savanna, with abundant grass and drinking water, and areas of montane rainforest (3). The forest buffalo occupies more closed habitats, in lowland and highland forests (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

African buffalos are herbivorous and are grazing animals. In the dry season, the pastures diminish and the buffalos move toward water or a depression in the ground and feed off of low nutrient grass. Once the rainy season begins, grasses increase considerably and are heavily grazed by the buffalo (Mloszewski, 1983). African buffalo spend 8 1/2 to 10 1/3 hours a day grazing. These animals graze slightly more at night than in the day. African buffalo also water once every day (Estes, 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
29.5 years.

Average lifespan

Status: wild:
26.0 years.

Average lifespan

Status: captivity:
16.0 years.

Average lifespan

Status: wild:
18.0 years.

Average lifespan

Status: captivity:
29.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29.8 years (captivity) Observations: These animals live up to 18 years (Ronald Nowak 1999) and 29.8 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction occurs throughout the year in African buffalo, but reproduction peaks are associated with seasonal rainfall. On the Serengeti Plain, heavy rains occur from February to July. Conception usually occurs at the end of this wet season, and the birth of the calf takes place during the second half of the following wet season. Females are in heat for 23 days and estrus lasts 5 - 6 days. Once the egg is fertilized, gestation takes almost a year, 340 days.

Usually only one calf is born, and it weighs around 40 kg. Males leave their mother after two years to join a bachelor group. Females remain with the mother until they have produced their own young or longer (Nowak, 1983). Females reach sexual maturity at 5 years of age, which is 3 - 4 years before males (Estes, 1991).

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 11.43 to 11.53 months.

Range weaning age: 4 to 12 months.

Average birth mass: 44000 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1674 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1475 days.

Parental Investment: altricial ; post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Syncerus caffer

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGCTGATTATTTTCAACCAACCACAAAGATATCGGTACCCTGTATTTATTATTCGGTGCCTGAGCCGGCATGGTAGGGACAGCCCTAAGCCTATTAATTCGCGCTGAACTAGGTCAACCCGGAACCCTACTCGGAGATGACCAAATCTACAACGTAGTCGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGGTTTGGCAATTGACTTGTCCCTCTAATAATTGGCGCTCCTGATATAGCATTTCCCCGGATAAACAATATGAGCTTCTGACTCCTTCCACCCTCTTTCCTACTACTTCTAGCATCATCCATAGTTGAAGCTGGGGCAGGAACAGGTTGAACTGTATATCCCCCTTTAGCAGGCAACCTAGCCCACGCAGGAGCCTCAGTAGACTTAACTATCTTCTCTTTACATTTGGCAGGTGTCTCCTCAATCCTAGGAGCTATTAACTTTATCACAACAATTATTAACATAAAACCTCCTGCAATATCACAATATCAAACCCCCCTATTCGTGTGATCCGTAATAATTACCGCCGTACTACTACTCCTTTCACTCCCTGTACTAGCAGCTGGCATTACAATATTACTTACAGATCGAAATCTAAATACAACTTTCTTTGACCCAGCAGGAGGAGGAGACCCCATCCTATACCAACACTTATTTTGATTCTTTGGGCACCCCGAAGTGTATATTCTTATTCTACCCGGGTTCGGTATGATCTCTCACATTGTAACCTACTACTCAGGAAAAAAAGAACCATTTGGATACATAGGAATAGTTTGAGCTATGATATCAATTGGATTTTTAGGATTCATCGTATGGGCTCACCACATGTTCACAGTTGGAATAGACGTTGATACACGGGCCTATTTTACATCAGCTACCATAATTATTGCTATCCCAACCGGGGTGAAAGTCTTTAGCTGACTAGCAACACTTCATGGGGGTAATATCAAATGATCTCCTGCTATAATATGGGCCCTGGGCTTCATCTTCCTCTTTACAGTAGGAGGCTTAACCGGAATTGTCCTAGCCAACTCTTCCCTCGACATCGTTCTCCACGACACATACTATGTCGTCGCACATTTCCACTATGTCCTTTCAATGGGAGCTGTGTTCGCCATTATAGGAGGATTTGTACATTGATTCCCACTATTTTCAGGCTACACTCTCAATGACACATGAGCTAAAATCCACTTCGCAATCATATTTGTAGGCGTTAATATAACCTTCTTTCCACAGCACTTCTTAGGACTATCTGGCATGCCACGACGATACTCCGATTACCCAGATGCATACACAATATGAAATACTATCTCATCAATAGGCTCATTCATTTCTCTGACAGCAGTTATACTGATAGTTTTCATCATCTGAGAAGCATTCGCGTCTAAACGAGAGGTCTCAACTGTAGATTTAACCACAACAAATCTAGAATGACTGAACGGATGTCCTCCACCATACCACACATTTGAAGAGCCTACATATGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Syncerus caffer

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 44
Specimens with Barcodes: 45
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the species remains widespread, with a global population estimated at nearly 900000 animals, of which more than three-quarters are in protected areas. While some populations (subspecies) are decreasing, others will remain unchanged in the long term if large, healthy populations continue to persist in a substantial number of national parks, equivalent reserves and hunting zones in southern and eastern Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The population of African buffaloes has decreased a little to due an increase in human activities (Nowak, 1983).

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
East (1999) produced a total population estimate of 830,000 for the three subspecies of savanna buffalo (27,000 West African Savanna Buffalo, 133,000 Central African Savanna Buffalo and 670,000 Southern Savanna Buffalo), probably conservative. East (1999) thought it likely that the total number of buffalo remaining in Africa’s savannas is in the approximate range of 500,000-1,000,000. Savanna buffalo populations are in decline over extensive areas because of meat hunting and continuing toss of habitat, and rinderpest continues to pose a major threat to these subspecies in some regions of Africa.

Few population estimates are available for the forest buffalo. It tends to occur locally at relatively high densities in open, grassy areas within the equatorial forest, but at much lower densities in extensive areas of continuous forest. East (1999) produced a total population estimate for the forest buffalo of about 60,000. This estimate is probably very conservative, but forest buffalo populations are in decline over most of the subspecies’ remaining range.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
In the past, numbers of African Buffalo suffered their most severe collapse during the great rinderpest epidemic of the 1890s, which, coupled with pleuro-pneumonia, caused mortalities as high as 95% among livestock and wild ungulates (Winterbach 1998). Rinderpest and other diseases such as anthrax have continued to result in localized declines and extinctions of populations throughout the 20th century, as rinderpest has spread from cattle to wildlife.

The species’ distribution and numbers have also been greatly reduced by habitat loss and poaching. It is a favourite target of meat hunters in many countries, and poaching has been a major contributor to the recent decline of buffalo populations in many protected areas, e.g., national parks such as Comoe (Ivory Coast), Garamba (Congo-Kinshasa) and Serengeti (Tanzania), and probably in many other areas. It is also susceptible to drought, which has caused substantial declines in some populations during the 1990s, alone or in combination with diseases such as anthrax or rinderpest, e.g., in Tsavo, Serengeti/Mara, Gonarezhou and Kruger (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Both the savanna and the forest buffalo still occur in considerable numbers, but populations have been greatly reduced by hunting, habitat loss and disease (3) (6). In several southern parts of its range, the African buffalo has never recovered from the devastating rinderpest epidemic that struck in the 1890s (6), and the potential for another rinderpest outbreak continues today. Another disease, bovine tuberculosis, is also known to affect African buffalo; a recent outbreak has impacted populations in Kruger National Park, South Africa (7). Outside of national parks in some areas, buffalos come into contact with humans; breaking fences, raiding crops and potentially spreading bovine diseases to livestock (4), and may be persecuted as a result.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
About 70% of the population of the three savanna buffalo subspecies occurs in and around protected areas, including: Queen Elizabeth and Murchison Falls National Parks (Uganda), Tarangire, Moyowosi-Kigosi, Katavi-Rukwa and Selous-Kilombero (Tanzania), Kafue and North and South Luangwa National Parks (Zambia), Chobe (Botswana), Sebungwe and the Middle Zambezi Valley (Zimbabwe), Hluhluwe-iMfolozi (South Africa) (Southern Savanna Buffalo), Mole (Ghana), Pendjari (Benin) and the national parks and hunting zones of North Province (Cameroon) (West African Savanna Buffalo), and Zakouma (Chad), and Sangba (CAR) (Central African Savanna Buffalo).

About 75% of the estimated total population of the forest buffalo occurs in nominally protected areas, including Lobeke (Cameroon) - Dzanga-Sangha (CAR) - Nouabale-Ndoki-Kabo (Congo-Brazzaville), Lope, Wonga-Wongue and Gamba (Gabon), Odzala (Congo-Brazzaville) and Maiko (Congo-Kinshasa).

The future status of this species is closely linked to the future of protected areas and well-managed hunting zones, since it is a frequent target of poachers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The survival of most of the world's wild cattle species is believed to rely on their existence in properly protected reserves (6). Luckily, the African buffalo is well represented in numerous national parks and protected areas (2), such as Serengeti National Park and Kilimanjaro National Park, Tanzania (8) (9). As one of the 'big five', African buffalo are sought after by tourists on wildlife safaris, and by game hunters (5), giving people great economic incentive to conserve this impressive mammal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Some people consider African buffaloes to be the most dangerous big game animal in Africa. Old bulls have been known to stalk and attack humans. Scientists discredit this claim and say that these stories come from hunters who were trying to hunt down a wounded animal (Nowak, 1983).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the past, African buffaloes have been hunted for food and for sport (Nowak, 1983).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

African buffalo

The African buffalo or Cape buffalo (Syncerus caffer), is a large African bovine.[2]

It is not closely related to the slightly larger wild Asian water buffalo, and its ancestry remains unclear. The African buffalo is not the ancestor of domestic cattle, and is only distantly related to other larger bovines. Owing to its unpredictable nature, which makes it highly dangerous to humans, the African buffalo has never been domesticated unlike its Asian counterpart, the Asian buffalo.

Description[edit]

Skull of an African buffalo

The African buffalo is a very robust species. Its shoulder height can range from 1 to 1.7 m (3.3 to 5.6 ft) and its head-and-body length can range from 1.7 to 3.4 m (5.6 to 11.2 ft). Compared with other large bovids, it has a long but stocky body (the body length can exceed the wild water buffalo, which is rather heavier and taller) and short but thickset legs, resulting in a relatively short standing height. The tail can range from 70 to 110 cm (28 to 43 in) long. Savannah-type buffaloes weigh 500 to 900 kg (1,100 to 2,000 lb), with males normally larger than females, reaching the upper weight range.[3] In comparison, forest-type buffaloes, at 250 to 450 kg (600 to 1,000 lb), are only half that size.[4][5] Its head is carried low; its top is located below the backline. The front hooves of the buffalo are wider than the rear, which is associated with the need to support the weight of the front part of the body, which is heavier and more powerful than the back.

Savannah-type buffaloes have black or dark brown coats with age. Old bulls have whitish circles around their eyes. Females tend to have more-reddish coats. Forest-type buffaloes are reddish brown in colour with horns that curve back and slightly up. Calves of both types have red coats.

Range of the commonly accepted forms of the African buffalo

The horns of African buffalo are very peculiar. A characteristic feature of them is the adult bull’s horns have fused bases, forming a continuous bone shield referred to as a “boss’, which can not always be penetrated even by a rifle bullet. From the base, the horns diverge, then bend down, and then smoothly curve upwards and outwards. The distance between the ends of the horns of large bulls is more than a metre. The young buffalo horn boss forms fully only upon reaching the age of five to six years. In cows, the horns are, on average, 10–20% smaller, and the boss is less prominent. Forest buffalo horns are much smaller and weaker than those of the savannah buffaloes and are almost never fused. They rarely reach a length of even 40 centimetres (16 in).

Subspecies[edit]

  • Syncerus caffer caffer, the Cape buffalo, is the typical subspecies, and the largest one, with large males weighing up to 910 kg (2,010 lb). It is peculiar to South and East Africa. Buffaloes of this subspecies living in the south of the continent, notably tall in size and ferocity, are the so-called Cape buffalo. Color of this subspecies is the darkest, almost black.
  • S. c. nanus (forest buffalo) is the smallest subspecies; the height at the withers is less than 120 cm and average weight is about 270 kg (600 lb). Their color is red, with darker patches on the head and shoulders in the ears forming a brush. The dwarf buffalo is common in forest areas of Central and West Africa. This subspecies is so different from the standard model, some researchers consider it still a separate species, S. nanus. Hybrids between the typical subspecies and dwarf hybrids are not uncommon.
  • S. c. brachyceros (Sudanese buffalo) is, in morphological terms, intermediate between those two subspecies. It occurs in West Africa . Its dimensions are relatively small, especially compared to other buffalo found in Cameroon, which weigh half as much as the South African subspecies (bulls weighing 600 kg (1,300 lb) are considered to be very large).
  • S. c. aequinoctialis (Nile buffalo) is confined to the savannas of Central Africa. It is similar to the Cape buffalo, but somewhat smaller, and its color is lighter. This subspecies is sometimes included in the Sudanese buffalo.[6]
  • S. c. mathewsi (mountain buffalo) is not universally recognized. It lives in mountainous areas of East Africa.

Ecology[edit]

The African buffalo is one of the most successful grazers in Africa. It lives in swamps and floodplains, as well as mopane grasslands and forests of the major mountains of Africa. This buffalo prefers habitat with dense cover, such as reeds and thickets, but can also be found in open woodland.[7] While not particularly demanding with regard to habitat, they require water daily, so depend on perennial sources of water. Like the plains zebra, the buffalo can live on tall, coarse grasses. Herds of buffalo mow down grasses and make way for more selective grazers. When feeding, the buffalo makes use of its tongue and wide incisor row to eat grass more quickly than most other African herbivores. Buffaloes do not stay on trampled or depleted areas for long.

Other than humans, African Cape buffaloes have few predators and are capable of defending themselves against (and killing) lions.[8] Lions do kill and eat buffalo regularly, and in some regions, the buffaloes are the lions’ primary prey. It typically takes several lions to bring down a single adult buffalo; however, several incidents have been reported in which lone adult male lions have been able to successfully bring down adult animals. The Nile crocodile will typically attack only old solitary animals and young calves, though they can kill healthy adults.[4] The cheetah, leopard and spotted hyena are a threat only to newborn calves, though spotted hyenas have been recorded killing full grown bulls on rare occasions.[9]

Diseases[edit]

The Cape buffalo is susceptible to many diseases, including bovine tuberculosis, corridor disease, and foot and mouth disease. As with many diseases, these problems will remain dormant within a population as long as the health of the animals is good. These diseases do, however, restrict the legal movements of the animals and fencing infected areas from unaffected areas is enforced. Some wardens and game managers have managed to protect and breed “disease-free” herds which become very valuable because they can be transported. Most well-known are Lindsay Hunt’s efforts to source uninfected animals from the Kruger National Park in South Africa. Some disease-free buffaloes in South Africa have been sold to breeders for close to US$130,000.[citation needed]

Social behavior[edit]

Buffalo herd

Herd size is highly variable. The core of the herds is made up of related females, and their offspring, in an almost linear dominance hierarchy. The basic herds are surrounded by subherds of subordinate males, high-ranking males and females and old or invalid animals. The young males keep their distance from the dominant bull, who is recognizable by the thickness of his horns. During the dry season, males will split from the herd and form bachelor groups.[10] Two types of bachelor herds occur: ones made of males aged four to seven years and those of males 12 years or older.[11] During the wet season, the younger bulls rejoin a herd to mate with the females. They stay with them throughout the season to protect the calves.[12] Some older bulls cease to rejoin the herd, as they can no longer compete with the younger, more aggressive males. Males have a linear dominance hierarchy based on age and size. Since a buffalo is safer when a herd is larger, dominant bulls may rely on subordinate bulls and sometimes tolerate their copulation.[10]

Bulls in position to spar

Adult bulls will spar in play, dominance interactions or actual fights. A bull will approach another, lowing, with his horns down and wait for the other bull to do the same thing. When sparring, the bulls twist their horns from side to side.[13] If the sparring is for play, the bull may rub its opponent’s face and body during the sparring session. Actual fights are violent but rare and brief. Calves may also spar in play, but adult females rarely spar at all.

African buffaloes are notable for their apparent altruism. Females appear to exhibit some sort of “voting behavior”. During resting time, the females will stand up, shuffle around, and sit back down again. They will sit in the direction they think they should move. After an hour of more shuffling, the females will travel in the direction they decide. This decision is communal and not based on hierarchy or dominance.[14] When chased by predators, a herd will stick close together and make it hard for the predators to pick off one member. Calves are gathered in the middle. A buffalo herd will respond to the distress call of a captured member and try to rescue it.[13] A calf’s distress call will get the attention of not only the mother, but also the herd. Buffaloes will engage in mobbing behavior when fighting off predators. They have been recorded killing a lion[15] and chasing lions up a tree and keeping them there for two hours, after the lions have killed a member of their group. Lion cubs can get trampled and killed. In one videotaped instance, known as the Battle at Kruger, a calf survived an attack by both lions and a crocodile after intervention of the herd.

Vocalizations[edit]

African buffaloes make various vocalizations. Many calls are lower-pitched versions of those emitted by domestic cattle. They emit low-pitched, two- to four-second calls intermittently at three- to six-second intervals to signal the herd to move. To signal to the herd to change direction, leaders will emit “gritty”, “creaking gate” sounds.[7] When moving to drinking places, some individuals make long maaa calls up to 20 times a minute. When being aggressive, they make explosive grunts that may last long or turn into rumbling growl. Cows produce croaking calls when looking for their calves. Calves will make a similar call of a higher pitch when in distress.[7] When threatened by predators, they make drawn-out waaaa calls. Dominant individuals make calls to announce their presence and location. A more intense version of the same call is emitted as a warning to an encroaching inferior.[7] When grazing, they will make various sounds, such as brief bellows, grunts, honks and croaks.

Reproduction[edit]

Cape buffalo and her calf

Buffaloes mate and give birth only during the rainy seasons. Birth peak takes place early in the season, while mating peaks later. A bull will closely guard a cow that comes into heat, while keeping other bulls at bay.[7][10] This is difficult, as cows are quite evasive and attract many males to the scene. By the time a cow is in full estrus, only the most dominant bull in the herd/subherd is there.[7]

Cows first calve at five years of age, after a gestation period of 11.5 months. Newborn calves remain hidden in vegetation for the first few weeks while being nursed occasionally by the mother before joining the main herd. Older calves are held in the centre of the herd for safety. [16] The maternal bond between mother and calf lasts longer than in most bovids. However, when a new calf is born, the bonding ends and the mother will keep her previous offspring at bay with horn jabs. Nevertheless, the yearling will follow its mother for another year or so. Males leave their mothers when they are two years old and join the bachelor groups. Young calves, unusually for bovids, suckle from behind their mothers, pushing their heads between the mothers' legs.[17]

Relationship with humans[edit]

Ernest Hemingway poses with a Cape Buffalo he shot in 1953.

Status[edit]

The current status of African Cape buffalo is dependent on the animal’s value to both trophy hunters and tourists, paving the way for conservation efforts through anti-poaching patrols, village crop damage payouts, and CAMPFIRE payback programs to local areas.

The buffalo is listed as Least Concern by the IUCN “as the species remains widespread, with a global population estimated at nearly 900,000 animals, of which more than three-quarters are in protected areas. While some populations (subspecies) are decreasing, others will remain unchanged in the long term if large, healthy populations continue to persist in a substantial number of national parks, equivalent reserves and hunting zones in southern and eastern Africa”.[1]

In the past, numbers of African buffaloes suffered their most severe collapse during the great rinderpest epidemic of the 1890s, which, coupled with pleuro-pneumonia, caused mortalities as high as 95% among livestock and wild ungulates.[18]

Being a member of the big five game family, a term originally used to describe the five most dangerous animals to hunt, the Cape buffalo is a sought-after trophy, with some hunters paying over $10,000 for the opportunity to hunt one. The larger bulls are targeted for their trophy value, although in some areas, buffaloes are still hunted for meat.

Attacks[edit]

Known within Africa as one of the “big five”, “The Black Death” or “widowmaker”, the African buffalo is widely regarded as a very dangerous animal, as it gores and kills over 200 people every year. Buffaloes are sometimes reported to kill more people in Africa than any other animal, although the same claim is also made of hippos and crocodiles.[19] Buffaloes are notorious among big game hunters as very dangerous animals, with wounded animals reported to ambush and attack pursuers.[20]

Gallery[edit]

See also[edit]

  • Anoa
  • Gaur
  • Zebu, the common type of cattle from India: Gaur may have contributed to some breeds.

References[edit]

  1. ^ a b IUCN SSC Antelope Specialist Group (2008). Syncerus caffer. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 695–696. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ Raphael, Marcel (2006) African Buffalo.
  4. ^ a b Huffman, Brent (2010-05-24). "Syncerus caffer – African buffalo". Ultimateungulate.com. Retrieved 2010-10-23. 
  5. ^ Boitani, Luigi, Simon & Schuster's Guide to Mammals. Simon & Schuster/Touchstone Books (1984), ISBN 978-0-671-42805-1
  6. ^ C. P. Groves, D. M. Leslie Jr. (2011) Family Bovidae (Hollow-horned Ruminants). pp. 585–588. In: Wilson, D. E., Mittermeier, R. A., (Hrsg.). Handbook of the Mammals of the World. Volume 2: Hooved Mammals. Lynx Edicions, 2009. ISBN 978-84-96553-77-4
  7. ^ a b c d e f Estes, R. (1991) The Behavior Guide to African Mammals, Including Hoofed Mammals, Carnivores, Primates. Los Angeles, The University of California Press. pp. 195–200 ISBN 0520080858
  8. ^ "Cape Buffalo". Canadian Museum of Nature. Retrieved 2010-10-23. 
  9. ^ Kruuk, Hans (1979). The Spotted Hyena: A study of predation and social behaviour. University of Chicago Press. p. 335. ISBN 978-0-226-45508-2. 
  10. ^ a b c Turner, W. C., Jolles, A. E., Owen-Smith, N. (2005). "Alternating Sexual Segregation During the Mating Season By Male African Buffalo (Syncerus caffer)". Journal of Zoology 267 (3): 291–299. doi:10.1017/S095283690500748X. 
  11. ^ Ryan, S. J., Knetchtel, Christiane U., Wayne M. (2006). "Range and habitat Selection of African Buffalo in South Africa". Journal of Wildlife Management 70 (3): 764–776. doi:10.2193/0022-541X(2006)70[764:RAHSOA]2.0.CO;2. 
  12. ^ Main, M. B., Coblentz, Bruce E. (1990). "Sexual Segregation among Ungulate: A Critique". Wildlife Society Bulletin 18 (2): 204–210. JSTOR 3782137. 
  13. ^ a b Sinclair, A. R. E. (1977) The African Buffalo. Chicago, The University of Chicago Press.
  14. ^ Wilson, D. S. (1997). "Altruism and Organism: Disentangling the Themes of Multilevel Selection Theory". The American Naturalist 150: S122–S134. doi:10.1086/286053. JSTOR 2463504. PMID 18811309. 
  15. ^ http://www.youtube.com/watch?v=PJjcQBSPDaI
  16. ^ "African Buffalo". British Broadcasting Corporation. Archived from the original on 27 October 2010. Retrieved 2010-10-23. 
  17. ^ H.H.T Prins (1996). Ecology and Behaviour of the African Buffalo: Social Inequality and Decision Making. Springer. p. 118. ISBN 978-0-412-72520-3. Retrieved 31 July 2013. 
  18. ^ Winterbach, H. E. K. (1998). "Research review: the status and distribution of Cape buffalo Syncerus caffer caffer in southern Africa". South African Journal of Wildlife Research 28 (3): 82–88. 
  19. ^ Stumpf, Bruce G. "Africa on the Matrix: The Cape Buffalo". Retrieved 2010-10-23. 
  20. ^ "African Animals Hunting facts and tips – Buffalo Hunting". safariBwana newsletter. Retrieved 2010-10-23. 

Further reading[edit]

  • Ecology and Behaviour of the African Buffalo – Social Inequality and Decision Making (Chapman & Hall Wildlife Ecology & Behaviour)
  • Huffman, B. 2006. The ultimate ungulate page. UltimateUngulate.com. Retrieved January 9, 2007.
  • International Union for Conservation of Nature and Natural Resources (IUCN). (2006) Syncerus caffer,
  • Nowak, R.M. and Paradiso, J.L. 1983. Walker’s Mammals of the World. Baltimore, Maryland, USA: The Johns Hopkins University Press. ISBN 978-0-8018-2525-5
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!