Overview

Brief Summary

Biology

Bay duikers are nocturnal animals (6) that shelter during the day in dense vegetation, in hollow trees or under fallen trunks (2), which makes them a difficult animal to study (4). They are known to primarily eat fruit (7), such as wild mango and African fruitbread (2), and thus are likely to play an important role as seed dispersers in the forest environment (8). Bay duikers also browse frequently on leaves (7), and surprisingly, this timid antelope is also known to occasionally stalk, kill and eat birds (2). Duikers, as well as avoiding humans, do not even generally associate with each other. They live at very low densities (2), and usually occur alone, although sometimes they are seen in pairs (4), and are thought to be monogamous (4). The female gives birth to only a single calf, which hides among vegetation for the first few weeks, and spends very little time with the mother (4). The calf is weaned by five months of age, reaches sexual maturity around a year old, and has a lifespan of 10 to 12 years (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Duikers are small, shy antelopes which, while they do their best to avoid encountering humans, are being impacted by the unsustainable bushmeat trade. The name duiker comes from the Afrikaans word for 'diver', after their habit of diving for cover when disturbed (4). Bay duikers are fairly heavily built, with a coarsely textured red or yellowish-brown coat. A dark line runs along the back of the bay duiker, from the nose to the base of the tail, and a dark stripe may also run along the centre of the belly (2) (5) (6). The short forelegs and long hindlegs are black or dark brown (6). The head of the bay duiker is broader and flatter that in other duikers, with a short muzzle and eyes high on the head. This is due to its enlarged cheek muscles, an adaptation for efficient chewing action (2). Bay duikers have very short, conical horns, and underneath each of the eyes is a large scent gland, thought to be used to mark their territories (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Bay Duiker formerly occurred throughout the equatorial lowland forests of West and Central Africa, extending to a limited extent into forest patches in the adjoining forest-savanna mosaic. Its range stretches from Guinea-Bissau to the Rwenzori Mts, the Albertine Rift and Lake Tanganyika, and south to north-east Angola to about 11°S; there are no confirmed records from Gambia, Benin or Nigeria, west of the Cross River (Kingdon and Feer in press, and references therein). Formerly occurred in Uganda, but now extirpated (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs in the equatorial lowland forest belt of Africa, from Senegal to Lake Tanganyika (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits primary and relatively unmodified equatorial forests ranging from lowland to mid elevations. While it shows a preference for high primary rainforest, they may occupy patches of forest within savanna mosaics; also occurs in old farm-bush and old secondary forest (Kingdon and Feer in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bay duikers generally inhabit rainforest, where they can shelter in hollow trees, under fallen trunks and in dense thickets (2). They seem to have a preference for primary rainforest, and appear to be more common in areas where no forest destruction has taken place (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 17.5 years (captivity) Observations: One wild born specimen was 17-18 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalophus dorsalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGTTGATTATTCTCAACCAATCACAAAGACATTGGTACCCTGTACCTCCTATTCGGTGCTTGAGCCGGCATAGTAGGAACCGCTCTAAGCCTATTAATCCGCGCTGAATTAGGTCAACCCGGAACCTTACTCGGAGATGACCAGATTTACAACGTAATCGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCTATTATAATTGGGGGTTTCGGCAACTGACTAGTCCCTCTAATAATTGGTGCCCCAGATATAGCATTTCCCCGGATAAACAACATAAGTTTCTGACTTCTCCCTCCCTCTTTCCTGTTGCTCTTAGCGTCTTCCATAGTTGAAGCCGGAGCAGGAACTGGCTGAACCGTATACCCCCCTCTAGCAGGTAACTTAGCCCATGCAGGAGCCTCAGTAGACCTAACTATCTTCTCTCTACACCTAGCAGGTGTTTCTTCGATTTTAGGAGCTATTAATTTTATTACCACAATCATTAATATAAAACCCCCTGCAATATCTCAATACCAAACCCCCTTGTTTGTATGATCAGTACTAATTACTGCCGTATTATTACTCCTCTCCCTTCCTGTGCTAGCAGCTGGTATTACAATACTACTAACTGACCGAAATTTAAACACGACCTTCTTTGACCCAGCAGGAGGTGGAGACCCTATCCTATACCAGCACTTATTCTGATTTTTTGGACACCCCGAAGTATACATTCTTATTCTACCCGGATTTGGGATAATCTCTCACATCGTGACCTACTATTCAGGAAAAAAAGAACCATTTGGGTATATAGGGATAGTATGAGCCATGATATCAATTGGATTTCTAGGGTTTATTGTATGAGCCCACCATATATTCACAGTAGGAATAGACGTTGACACACGGGCCTATTTCACATCAGCTACCATAATTATTGCTATTCCTACTGGAGTAAAGGTCTTCAGCTGACTAGCTACGCTCCACGGAGGCAATATTAAATGATCTCCCGCTATAATATGAGCTCTAGGCTTCATCTTCCTTTTCACAGTCGGAGGCTTAACAGGAATTGTTCTAGCCAACTCCTCCCTTGATATTGTCCTTCACGATACATACTATGTAGTTGCACACTTCCACTACGTGCTATCAATAGGAGCCGTGTTCGCTATTATAGGGGGATTCGTACATTGATTCCCACTATTCTCAGGTTATACTCTCAATGCTACATGAGCTAAAATCCACTTTGTAATCATATTTGTAGGTGTAAACATAACCTTTTTCCCACAACACTTCTTAGGGCTATCTGGTATACCACGACGATACTCAGACTACCCAGACGCATACACAATATGAAACACCATTTCATCTATGGGCTCATTTATCTCACTAACAGCAGTTATACTAATAATTTTTATTATCTGAGAAGCATTCGCATCTAAACGAGAAGTCCTAACTGTAGACTTAACCACAACAAACCTAGAATGACTAAACGGATGCCCTCCACCATACCATACATTCGAAGAACCTACATATGTCAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalophus dorsalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the species is still widespread and relatively abundant, with an estimated population in excess of 700,000. However, increases in hunting pressure and deforestation, or alteration of primary forests, mean that this species is likely to be eliminated eventually from large parts of its current range, and may well be on its way towards qualifying for uplisting to Near Threatened. Its long-term future will be closely linked to the preservation of substantial areas of relatively unmodified equatorial forest.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Population densities are summarized by Wilson (2001) and Kingdon and Feer (in press). East (1999) produced a total population estimate of 725,000. While its numbers are generally stable in the less disturbed forests where hunting pressures are relatively low, its overall numbers are in decline because of loss of habitat and over-hunting for meat in other parts of its range (East 1999).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The major threats to this species include bushmeat hunting, which takes place across its range (using both cable snares and nets) and habitat loss and degradation (particularly in the face of expanding human settlement), especially given its preference for primary forest.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The bay duiker has a very large distribution but its popularity with bushmeat hunters and traders has resulted in numbers declining in many West African countries. The bay duiker is now rare in Nigeria and Sierra Leone and extinct in Uganda (2). Duikers are easily hunted with either gun or cable snare, easily transportable by foot, and have sufficient meat to be profitable, making them one of the primary targets for both subsistence and commercial hunting activities (8). Unfortunately, the majority of duiker hunting at present is unsustainable (8). In addition, the bay duiker's preference for undisturbed forest makes is vulnerable to habitat degradation, caused by human activities such as cultivation. For example, population numbers in Togo are declining due to a combination of habitat destruction and hunting (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Bay Duiker occurs in a number of protected areas including: Sapo (Liberia), Kakum (Ghana), Campo, Dja and Lobeke (Cameroon), Dzanga-Sangha and Bangassou (Central African Republic), Monte Aien (Equatorial Guinea), Lope, Minkebe and other forests (Gabon), Odzaia and Nouabate-Ndoki-Kabo (Congo-Brazzaville) and lturi, Kahuzi-Biega, Maiko and Salonga (Congo-Kinshasa) (East 1999; Wilson 2001).
Listed in CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The bay duiker is listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), which means that international trade in this species should be carefully regulated (3). However, to address the threat of the unregulated bushmeat trade, further action is required. Research into the factors influencing the trade, and efforts to educate the public about the threats facing duikers and their importance, are some of the measures suggested (8). This is required to protect not only the future of bay duikers, but also to ensure this valuable resource is around for future generations of Africans.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bay duiker

The bay duiker (Cephalophus dorsalis), also known as the black-backed duiker, is a forest-dwelling duiker found in Gabon, southern Cameroon and northern Congo, as well as Sierra Leone, Liberia, and the southern parts of Côte d'Ivoire, Ghana and Benin. It may be a subspecies of Ogilby's duiker.

Bay duikers stand around 50 cm (20 in) tall at the shoulder and weigh about 20 kg (44 lb). The bay duiker has a dark-brown coat, with a black stripe running along the back, from the nose to the tip of the tail, and a white underside and spots above the eyes. It has small, conical horns, 5 to 10 cm (2.0 to 3.9 in) long.

Bay duikers live in dense rainforests, where they eat mainly plants, but also insects, eggs, and small birds. Bay duikers are nocturnal, spending their days at rest in thickets, buttress roots, or even inside hollow trees. They form regular pathways through the dense undergrowth. Bay duikers live alone or in pairs, usually far from other bay duikers.

References

  1. ^ IUCN SSC Antelope Specialist Group (2008). Cephalophus dorsalis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 11 May 2008. Database entry includes a brief justification of why this species is of least concern
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!