Overview

Brief Summary

Biology

Peter's duikers are active only during the day (2), and like all duikers, have a secretive life (4), favouring dense undergrowth where they can hide from potential predators (6). Their diet is composed primarily of fruits, which are often picked from the forest floor (3), with the remainder consisting of leaves (2), and small amounts of flowers and fungi (3). Duikers give birth to only a single calf at a time, which then hides in vegetation for the first few weeks of life (4). Peter's duikers are believed to be territorial animals (2), and the large scent glands beneath each eye may be used to mark their territory, by rubbing them on trees (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Peter's duiker belongs to a group of shy, secretive African mammals that are most often glimpsed as they dive for cover in thick vegetation (4). It is a fairly large duiker, with a coat that varies between pale tawny, rich russet and dark brown (2), and a broad, dark band runs from between the shoulders, along the spine, and expands over the rear flanks (3). Whatever the coat colour, a tuft of russet-coloured hair sits upon the forehead between the short, pointed horns (2) (3). The forehead of Peter's duiker is one of the most heavily reinforced of any duiker species, with the dense bone measuring up to 13 millimetres thick in some males (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Endemic to western Central Africa in moist lowland forests of south and south-eastern Cameroon, south-western Central African Republic, mainland Equatorial Guinea, Gabon, and north and south-western Congo (East 1999; Wilson 2001; Feer and Mockrin in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs in central Africa, with a range extending from Cameroon and Gabon eastwards to Kenya and Tanzania (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found in areas with relatively undisturbed or primary forests, but also present in logged forest with dense undergrowth; sometimes recorded in secondary forest and farm-bush (East 1999; Feer and Mockrin in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Peter's duiker occurs in moist equatorial forest in both lowland and montane areas. They prefer areas with dense undergrowth in which they can shelter (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalophus callipygus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 29 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCGTCAACCGCTGACTATTCTCAACCAATCACAAAGACATTGGTACCCTATATCTCTTATTTGGTGCTTGAGCTGGCATAGTAGGAACCGCTCTAAGCTTATTAATCCGCGCTGAATTAGGTCAACCTGGAACCTTGCTCGGAGATGACCAAATTTACAACGTAATCGTAACCGCACATGCATTCGTAATAATTTTCTTCATAGTAATACCAATCATAATTGGAGGCTTCGGCAACTGGCTAGTTCCCCTGATAATTGGTGCCCCAGATATAGCATTTCCCCGAATGAATAACATAAGTTTCTGACTTCTCCCTCCCTCTTTCCTACTACTTCTGGCATCTTCTATAGTAGAAGCTGGGGCAGGAACTGGCTGAACAGTATACCCCCCTCTAGCAGGCAACCTAGCCCATGCAGGAGCCTCAGTAGACCTAACCATCTTCTCTCTTCACCTGGCAGGTGTTTCTTCAATTTTAGGGGCTATTAATTTTATCACCACAATTATTAATATGAAACCCCCTGCAATATCTCAATACCAAACCCCCTTATTTGTATGATCAGTATTAATCACTGCCGTATTATTACTTCTCTCCCTTCCTGTACTAGCAGCTGGTATTACAATATTACTAACAGACCGAAATTTAAATACAACCTTCTTCGACCCAGCAGGAGGCGGAGACCCTATCCTGTACCAACACTTATTCTGATTCTTCGGACACCCTGAAGTATATATTCTCATTCTACCCGGATTTGGAATAATCTCTCACATCGTAACCTACTATTCAGGAAAAAAAGAACCATTCGGATACATAGGAATAGTATGGGCTATAATATCAATTGGATTCCTAGGATTCATTGTATGGGCCCATCATATATTCACAGTAGGGATAGACGTCGACACACGGGCCTACTTCACATCAGCCACCATAATTATTGCTATCCCTACTGGAGTAAAAGTCTTTAGCTGACTAGCTACACTTCACGGGGGTAATATTAAATGATCTCCCGCTATAATATGAGCTCTGGGCTTCATTTTCCTTTTCACAGTCGGAGGCCTAACAGGAATTGTTCTAGCCAACTCTTCTCTTGACATCGTTCTTCACGACACATACTATGTAGTTGCACACTTCCACTATGTATTGTCAATAGGAGCTGTGTTTGCTATTATAGGGGGATTTGTACACTGATTCCCATTATTCTCAGGCTACACCCTCAACACTACATGAGCCAAAATCCACTTTGTAATTATATTTGTAGGTGTAAACATAACTTTCTTCCCACAACATTTCCTCGGATTATCTGGTATGCCACGACGATACTCTGACTATCCAGACGCATACACAATATGAAATACTATTTCATCTATAGGCTCTTTCATCTCACTAACAGCGGTCATACTAATAATTTTTATTATCTGAGAGGCATTCGCATCTAAACGAGAAGTCCTAACTGTAGACTTAACCACGACAAACCTAGAATGACTAAACGGGTGCCCTCCACCATATCACACATTTGAAGAACCTACATACGTCAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalophus callipygus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 24
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the species is still widespread and relatively abundant, with a population estimated at more than 300,000 animals. However, increases in hunting pressure which often accompany the opening up and human colonization of the forest indicate that this species is likely to be eliminated eventually from large parts of its current range. Unless excessive hunting is brought under control this species is likely to be eliminated eventually from large parts of its current range as the human population of the Central African forest zone expands and increases.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
it remains widespread and locally common and is frequently the most abundant medium-sized duiker species in undisturbed areas, but its populations are generally reduced to very low levels where hunting pressure is high (East 1999). Densities are summarized by Wilson (2001) and Feer and Mockrin (in press).

East (1999) produced a total population estimate of 382,000. Population trends are generally stable in the core areas of its range where human densities are low, but declining elsewhere.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The primary threats to the survival of the species are habitat loss due to human settlement and expansion of agriculture and hunting (especially through the use of snares). In some areas where the hunting pressure and human disturbance is high, these factors have caused localized reductions in numbers to very low levels.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Classified as Near Threatened by the IUCN, Peter's duiker is vulnerable to the impact of hunting (1). It is the third most frequent species hunted for bushmeat in Gabon, where bushmeat is an important source of protein for both urban and rural people (6), and in the Central African Republic, Peter's duiker accounted for 29 percent of all animals captured in snares (7). Even with optimistic estimates of population density, snare hunting at this level is unsustainable for Peter's duiker (7). In addition, the loss and degradation of critical forest habitat, through human settlements and infrastructure development, threatens the future of Peter's duiker (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Major and generally stable populations occur in areas such as Dja and Lobeke (Cameroon), Dzanga-Sangha and Bangassou (Central African Republic), Monte Alen (Equatorial Guinea), Lope, Minkebe and other relatively undisturbed forests (Gabon), and Odzala, Nouabale-Ndoki and Lake Tele-Likouala (Congo-Brazzaville) (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Peter's duiker occurs in several protected areas, such as the Lope and Sette-Cama Reserves in Gabon (6). However, in addition to effectively protected areas, further measures may be required to prevent populations from declining under the pressure of bushmeat hunting. It may be necessary to manage wildlife populations outside parks, to ensure both the continued availability of bushmeat for human consumption, and the continued survival of the species (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Peters's duiker

Peters's duiker (Cephalophus callipygus) is a small antelope found in Gabon, Equatorial Guinea, southern Cameroon and northern Republic of Congo.

Peters's duikers weigh about 40 lb (18 kg) on average, and are about 20 in (50 cm) at the shoulder. They have grey-brown coats. Peters's duikers live in dense undergrowth in mountain rainforests. The total population is estimated at 380,000 individuals, with a declining trend.

References[edit]

  1. ^ IUCN SSC Antelope Specialist Group (2008). Cephalophus callipygus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!