Overview

Distribution

Range Description

Aders' Duiker occurs on the main island of Unguja, Zanzibar, as a near endemic since, although the species has been described by Kingdon (1982) as widespread in the forests, woodland and thickets north of Mombasa (Kenya) almost up to the Somali border, in the light of rapidly shrinking suitable habitat, it would appear the population has succumbed to a severe decline in numbers. In the Arabuko-Sokoke Forest, northwest of Kilifi (Kenya), the species is still present, but very few substantiated sightings are made each year. This forest covers approximately 416.8 km². In 2004, what is thought to be an Aders' Duiker was sighted in the Dodori National F.R. north of the Tana River Delta on the north Kenya coast (Andanje and Wacher 2004).

There is a possibility that Aders' Duiker may have once occurred on Fundo Island, off the coast of Pemba Island (Williams 1998)) and is reported to have been introduced on to Funzi Island, Pemba (Kingdon 1997), but has since become extinct on both these islands. Archer and Mwinyi (1995) mention, "unconfirmed?(but) reliable reports (which) indicate a thriving population on Tumbatu Island". Further confirmation of this is yet to be forthcoming.

In February 2000, five Aders' Duikers were translocated to Chumbe Island from mainland Zanzibar, where a female was already in place.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
In Zanzibar, Aders' Duiker inhabits tall, undisturbed coral rag thicket known locally as msitu mkubwa (Archer 1994) of the Zanzibar-Inhambane regional mosaic (XIII). It is usually found singly, sometimes in pairs or trios and often, when encountered, may be following a troop of Sykes (Cercopithecus mitis albogularis) or Kirk's Red Colobus (Procolobus kirkii) monkeys feeding on discards and dislodged edibles from the canopy above (Swai 1983; Imani pers. comm. to Williams 1998).

Williams et al. (1996) found that Aders' Duiker has very specific habitat requirements. They were only found in older growth thicket areas and the highest population densities (11.4±5.18 per km²) were recorded in undisturbed high thicket. In contrast, Kanga (1999) did encounter the occasional Aders' in secondary thicket. In the Arabuko-Sokoke Forest, Aders' Duiker inhabits Cyanometra forest, one of three major habitat types dictated by local soils.

Aders' Duiker appears to be loosely diurnal (Williams et al. 1996), with a very acute sense of hearing and possibly smell (Archer 1994, Williams 1998). Aders' is a browser selecting for dicotyledenous leaves, seeds, sprouts, buds and fruits (Swai 1983). Territories are maintained by facial gland secretions on prominent twigs and faecal heaps (Swai 1983). No formal study of behavioural or ecological allopatric separation of Aders' Duiker with other small antelope has yet been attempted. Moreover, little is known about the population dynamics of this species or of its reproductive biology. Williams (in press) summarizes the available knowledge on the species.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalophus adersi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGCTGACTGTTCTCAACTAATCACAAAGACATTGGTACCCTGTACCTCCTATTCGGTGCTTGAGCTGGCATAGTAGGAACTGCTCTAAGCTTATTAATCCGCGCTGAACTAGGTCAACCCGGGACCTTGCTCGGAGACGACCAAATCTACAATGTAATCGTAACCGCACATGCATTCGTAATAATTTTCTTCATAGTAATACCCATCATAATCGGAGGCTTTGGCAACTGACTGGTTCCTCTGATAATTGGTGCCCCAGACATAGCATTTCCCCGAATAAACAACATAAGCTTCTGACTTCTCCCTCCTTCTTTCCTACTACTCCTAGCATCCTCTATAGTTGAAGCCGGAGCAGGAACTGGCTGGACCGTATATCCCCCTCTAGCAGGTAACCTCGCCCATGCGGGAGCCTCAGTGGATCTAACTATCTTCTCTCTACACCTAGCGGGTGTTTCTTCAATCTTAGGAGCTATTAATTTTATTACCACAATTATTAATATAAAACCCCCTGCAATATCTCAATATCAAACCCCCTTGTTTGTATGATCGGTACTAATTACTGCCGTATTATTACTCCTCTCCCTTCCTGTATTAGCAGCTGGTATTACAATATTATTAACAGACCGAAATTTAAATACAACCTTCTTCGACCCAGCAGGAGGTGGAGATCCCATCCTATATCAACACCTATTCTGATTCTTTGGACACCCAGAAGTATATATTCTTATTTTACCTGGATTTGGAATAATCTCCCACATCGTGACCTACTATTCAGGAAAAAAAGAACCATTTGGGTACATAGGAATGGTGTGAGCCATAATATCAATTGGATTCCTAGGATTTATTGTATGAGCCCACCATATATTCACAGTAGGAATAGACGTCGACACACGAGCCTACTTCACATCAGCCACCATAATTATCGCTATTCCTACTGGAGTAAAAGTCTTCAGCTGACTAGCTACACTCCACGGAGGTAATATCAAATGATCCCCAGCTATAATATGAGCCCTGGGCTTCATTTTCCTTTTTACAGTCGGGGGCTTAACAGGAATTGTACTAGCCAACTCTTCTCTTGACATTGTTCTTCACGACACATATTATGTAGTTGCACACTTCCACTACGTACTGTCGATAGGAGCTGTATTTGCTATTATAGGGGGATTCGTACACTGATTCCCACTATTCTCAGGCTATACCCTCAACGCTACATGAGCCAAAATCCACTTTGTAATTATATTTGTAGGTGTAAACATAACTTTCTTCCCACAACATTTCTTAGGATTATCTGGCATACCACGACGATACTCCGACTACCCAGACGCATATACAATATGAAATACTATCTCATCTATAGGCTCATTCATCTCACTAACAGCAGTTATACTAATAATTTTCATCATCTGAGAAGCCTTCGCATCTAAACGAGAAGTCCTAACTGTGGACTTAACCACAACAAATCTAGAATGACTAAACGGATGCCCTCCACCATATCATACATTTGAAGAGCCTACATATGTAAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalophus adersi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A4cd

Version
3.1

Year Assessed
2008

Assessor/s
Finnie, D.

Reviewer/s
Masoud, T.S. & Plowman, A. (Antelope Red List Authority)

Contributor/s

Justification
Listed as Critically Endangered as there has been an observed decline on Zanzibar from 5,000 individuals (1983), to 2,000 (1996) to 640 (1999). There are no recent population estimates, but on the basis that the known reasons for the decline are still occurring (i.e., a continued decline in the area and quality of habitat due to illegal wood-cutting, and the continuation of illegal hunting), it is suspected that the population will continue to decline at a similar rate.

History
  • 2004
    Critically Endangered
  • 1996
    Endangered
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
To date, three surveys have been carried out within Zanzibar. The first in 1982 (Swai 1983) estimated the Aders' Duiker population to be in the region of 5,000 individuals. A second, more detailed survey undertaken in 1995 (Williams et al. 1996) placed the population at below 2000. The populations were shown to be located in five main subpopulations with varying degrees of interconnectedness: Kiwengwa Forest in the north, localities in the central Jozani-Chwaka Bay area and Mtende in the south. A third survey carried out in 1999 (Kanga 1999) placed the population at 614±46 within the same study area as Williams et al. (1996). This represents an 87.7±0.7% decrease in the calculated population size in 17 years. However, as each survey method used different methodologies, the results are not directly comparable. Nevertheless, it is evident that there has been a significant decline in the population in recent decades.

The Kenyan population in Arabuko-Sokoke is probably even closer to extinction. A figure of around 500 individuals was estimated in 1999 based on a drive-count survey. However, this figure was extrapolated from just three individuals and is extremely approximate (Kanga 2002b). Recent surveys have only sighted very low numbers (three in 1999, two in 2002 and two in 2003) (Kanga 2002a, 2002b and 2003).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The major threats to Aders' Duiker are hunting and habitat loss.

There has been a long tradition of hunting in Zanzibar and Kenya. In Zanzibar, there is likely to have been an increase in hunting pressure following the revolution of 1964 after which enforcement of the wildlife laws became largely non-existent. It would appear that, partly as a result of hunting, the mini-antelope populations of Zanzibar and, especially Aders' Duiker, have undergone long-term declines. The Department of Commercial Crops, Fruits and Forestry (DCCFF) began to address the hunting situation in Zanzibar in 1994. Although hunting has come under an increasing level of control in Zanzibar (both at the village and governmental level), it remains a significant threat at present (Finnie 2002). In the Arabuko-Sokoke Forest hunting and trapping are common. Over 2,600 households live within 2 km of the forest and at least 33% carry out hunting and/or trapping (FitzGibbon et al. 1995). It is assumed that the high level of trapping represents a significant threat to the continued existence of Aders' Duiker in Kenya.

In Zanzibar there has been a substantial amount of deforestation and forest degradation over the last 30 years. This has led to loss of habitat for Aders' Duiker, but also severe habitat fragmentation. Firewood is the primary source of income for a significant proportion of people living near the forest (Ely et al. 2000) and there are few alternative means of income generation. Habitat destruction is probably the most significant threat to Aders' Duiker survival on Zanzibar.

The Arabuko-Sokoke Forest is one of the last major remnants of lowland forests on the East African coast, indicating the massive loss of habitat suffered by Aders' Duiker. Illegal wood-cutting continues to modify Aders' Duiker habitat and is assumed to negatively impact habitat quality. Wood-cutting continued to increase between surveys undertaken in 1998 and 2002 (Kanga 2002a). It is likely that habitat destruction will constitute the most difficult threat to address in terms of Aders' Duikers' future security.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In Zanzibar, the revised version of the Aders' Duiker Species Recovery Plan (SRP) constitutes a framework for conservation of the species (Finnie 2002). In Kenya, a conservation and recovery plan has been proposed by Kanga (2002a).

Aders' Duiker has been protected under Zanzibar law since 1919, while in Kenya Aders' Duiker is a protected species.

In Zanzibar, the newly designated Jozani-Chakwa Bay National Park has secured part of the Aders' Duiker range within a strictly protected area. Another important subpopulation in Kiwengwa Forest is now protected as a nature reserve. In Kenya, the Arabuko-Sokoke Forest is designated as a National Park, part of which is a strict nature reserve. Further survey work is needed to determine whether a viable population persists in the Dodori National F.R.

Intensive fieldwork undertaken in the Arabuko-Sokoke Forest by the Kenya Wildlife Service has involved population surveys for Aders' Duiker and other species as well as monitoring illegal human activities. In 2003, fieldwork also involved the removal of animal snares from Aders' Duiker habitat.

In Zanzibar a community wildlife management programme commenced in 1995 in an effort to reduce antelope hunting to a more sustainable level. Village Hunter Associations have been set up to manage local wildlife. This will be continued and expanded. Community Forest Management Agreements are in place for the eight villages surrounding Jozani Forest, and the programme has been extended to cover most of southern Unguja. Part of these agreements involves the designation of high protection zones that allow extremely limited use of forest products. All five major subpopulations are covered by some form of community protection.

Conservation education programmes have had some success in increasing awareness in rural areas in both Kenya and Zanzibar. However, in Zanzibar a lot of work is still required in urban areas, the main market for firewood.

An investigation into the feasibility and efficacy of a captive breeding programme on Zanzibar was undertaken in December 2001 (Finnie 2001). An in-country captive-breeding programme has also been proposed for Kenya (Kanga 2001).

Trophy hunting has also been suggested in Zanzibar as a conservation tool (Finnie and Ely 2001). However, for such a rare species, the likely success of this programme must be investigated thoroughly.

The status of Aders' Duiker needs to be monitored closely so the efficacy of the recovery plans can be judged and, if necessary, altered. A simple research programme to understand more about the behavioural and population ecology of Aders' Duiker is necessary.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Aders' duiker

The Aders' duiker (Cephalophus adersi), also known as nunga in Swahili, kunga marara in Kipokomo, and harake in Giriama), is a small, forest-dwelling duiker found only in Zanzibar and a small coastal enclave in Kenya. It is also critically endangered. It may be a subspecies of the red, Harvey's, or Peters's duiker or a hybrid of a combination of these. It has a population of fewer than 1,400.

Characteristics[edit]

The Aders' duiker stands at around 30 cm (12 in) tall at the shoulder. Its weight varies greatly depending on geographical location; those in eastern Zanzibar weigh 12 kg (26 lb), while those in the south weigh only 7.5 kg (17 lb).[citation needed] Its coat is reddish-brown, grayer on the neck, and lighter down the backside and underneath. A small red crest runs along the head. It also has small, simple horns of 3 to 6 cm (1.2 to 2.4 in). The muzzle is pointed, and the nose has a flat front. The ears measure 7.0–8.3 cm (2.8–3.3 in) long, with a marked cowlick or whorl of hair on the nape of the neck.

Distribution and habitat[edit]

Aders' duikers live primarily in coastal forests and woodlands in Africa. The species can live in quite dry scrub near the sea or among coral outcrops; in Zanzibar, they are restricted to tall thicket forest growing on waterless coral rag.[citation needed] In Arabuko Sokoke (Kenya), they are most often trapped within Cynometra vegetation, especially on "red soil". C. adersi is sympatric with C. harveyi on the mainland and with C. monticola sundevalli on Zanzibar, although nothing is known regarding their ecological separation.

Ecology and behavior[edit]

The species is very shy, alert, and sensitive to sound. As a result, common methods of hunting include the brute-force method of driving the duikers into nets with dogs, or silent ambush at feeding sites.[citation needed]

Aders' duikers live in coastal forests, thickets and woodlands, where they eat flowers, leaves, and fruit which has fallen from the forest canopy. The species appears to be diurnal, as it is rarely seen active at night. Typical feeding patterns are from dawn to late morning, which is followed by a period of rest and rumination. At midafternoon, Aders' duikers generally become active, and will continue foraging until nightfall.

They are generally solitary or found in small groups of two or three. They often pick up scraps dropped by monkeys and birds foraging in the trees.[2]

C. adersi shows a particular dependence on the flowers and berries which grow prolifically from trees common to the area, such as ebony (Diospyros consolataei), kudu berry (Cassine aethiopica) and bush guarri (Euclea schimperi), and bushes such as turkey berry (Canthium spp.) and Polyspheria. In addition to these, they will eat sprouts, buds, and other fresh growth found at ground level. This duiker species can apparently manage without drinking, getting most of the hydration they need from their diets.

These duikers have extremely specific habitat requirements, being found only in areas of old-growth thicket, with the highest population densities (11.4±5.18 per kms)[3] recorded in relatively undisturbed high thicket. However, Kanga (1999) did report some Aders' duikers in secondary thicket. In the Arabuko-Sokoke Forest in Kenya, Aders' duikers inhabit regions of Cyanometra forest.

Not much is known of the Aders' reproductive habits, although they may breed all year long.[citation needed]

Conservation[edit]

An estimated 1,400 Aders' duikers are left in the world. They are threatened by habitat destruction, feral dogs, and overhunting. They are particularly sought by humans due to their soft skin and meat.[citation needed] The population in Zanzibar had declined from 5000 in 1983 to 640 in 1999,[citation needed] and it will probably continue to decrease rapidly. In Kenya, the duiker is present at very low densities, though the decline is probably not as severe as the other population.[citation needed]

Several conservation plans have been made, and a captive-breeding program has been proposed.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!