Overview

Distribution

Geographic Range

Like most domestic animals, Bos taurus (domestic cow) is currently found throughout much of the world. The wild ancestors of cows were native to northern Africa, Europe, and southern Asia.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Introduced , Native ); neotropical (Introduced ); australian (Introduced )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Distributed worldwide in domestication. Feral populations occur on Kauai, Molokai, and Hawaii, Hawaiian Islands; see Tomich (1986) and Kramer (1971) for extensive accounts of historical and current status in Hawaii; Spain; France; Australia; New Guinea; U.S.; Colombia; Argentina; Galapagos; Hispaniola; Tristan da Cunha; New Amsterdam; and Juan Fernandez Islands (Grubb, in Wilson and Reeder 1993). The Eurasian-North African progenitor of domestic cattle is extinct.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Domestic cows are large, sturdy animals. Weight ranges from 147 kilograms to 1363 kilograms, and height from 49-52 inches. The body is covered in short hair, the color of which varies from black through white, reddish brown, and brown. Domestic cows have short necks with dewlaps hanging below the chin. They have two hollow horns and a long tufted tail. They can be used as working animals for plowing and moving heavy loads. Domestic cows have no upper incisors, instead they have a thick layer called the dental pad. The jaws are designed for the circular grinding motion used to crush coarse vegetation. (Rath 1998; Walker et al. 1975 Reprogen 1997)

Range mass: 147 to 1363 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Average basal metabolic rate: 306.77 W.

  • Rath, S. 1998. The Complete Cow. Vancouver, B.C: Raincoast Book.
  • Walker, E., F. Warnick, S. Hamlet, K. Lange, H. Uible. 1975. Mammals Of The World. London: THe Johns Hopkins University Press.
  • Reprogen, 1997. "Domestic Cattle" (On-line). Accessed October 6th, 2000 at http://www.hensonrobinsonzoo.org/p001.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Domestic cows are common and can be found throughout the world. Cattle are born and raised on rangelands. Rangelands are unfertilized, uncultured, and not irrigated. Also, they must contain adequate areas for grazing.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Domestic cows feed on grasses, stems, and other herbaceous plant material. An average cow can consume about 70kg of grass in an 8 hour day. Cows twist grasses around the tongue and cut them with their lower teeth. Domestic cows are ruminants. Ruminants have a special system of digestion which allows for the breakdown of the relatively indigestible plant material which they consume. Cows have a four chambered stomach including a rumen, reticulum, omasum, and abomasum. Grass passes through the rumen where it is mixed with specialized bacteria. From the rumen it moves to the reticulum, where it is broken down further. The partly digested food, known as cud, is regurgitated and chewed. It is then swallowed and moves into the omasum and abomasum, where digestive enzymes break it down further and nutrients are absorbed. The process of digestion takes 70-100 hours, one of the slowest passage rates of all animals. This method of digestion permits ruminants to obtain the most nutrients possible from these plant materials.

(Rath 1998; Hindsaw 1993; Walker et al. 1975)

Plant Foods: leaves; roots and tubers; wood, bark, or stems

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / pathogen
Actinomyces bovis infects jaw of Bos taurus (domestic)

Plant / resting place / within
imago of Aphodius coenosus may be found in dung of Bos taurus (domestic)

Plant / resting place / within
imago of Aphodius foetens may be found in dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung/debris feeder
larva of Aphodius fossor feeds on dung/debris dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung/debris feeder
larva of Aphodius granarius feeds on dung/debris dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung/debris feeder
larva of Aphodius haemorrhoidalis feeds on dung/debris dung of Bos taurus (domestic)
Other: major host/prey

Plant / resting place / within
imago of Aphodius obliteratus may be found in dung of Bos taurus (domestic)

Animal / dung/debris feeder
larva of Aphodius prodromus feeds on dung/debris dung of Bos taurus (domestic)
Other: unusual host/prey

Plant / resting place / within
imago of Aphodius putridus may be found in dung of Bos taurus (domestic)

Animal / dung/debris feeder
larva of Aphodius scrofa feeds on dung/debris dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
partly immersed perithecium of Arnium caballinum is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
perithecium of Arnium hirtum is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
perithecium of Arnium macrotheca is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
perithecium of Arnium olerum is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Ascobolus albidus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Ascobolus boudieri is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Ascobolus elegans is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Ascobolus equinus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Ascobolus immersus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
thick-stalked apothecium of Ascobolus lignatilis is saprobic in/on dung or excretions of manure heap of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Ascobolus roseopurpurascens is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Ascobolus stercorarius is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Ascobolus stictoideus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Ascophanus cinerellus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung associate
larva of Azelia nebulosa inhabits dung of Bos taurus (domestic)

Animal / pathogen
Blue Tongue virus (BTV) infects Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
basally immersed, mostly densely clustered perithecium of Cercophora coprophila is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
basally immersed, scattered or in small groups perithecium of Cercophora mirabilis is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
solitary or gregarious, sessile apothecium of Cheilymenia fimicola is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
sessile apothecium of Cheilymenia pulcherrima is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Cheilymenia raripila is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
solitary or gregarious, sessile apothecium of Cheilymenia stercorea is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Conocybe coprophila is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Conocybe farinacea is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinellus pellucidus is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)
Other: major host/prey

In Great Britain and/or Ireland:
Animal / dung saprobe
fruitbody of Coprinellus sassii is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinopsis cothurnata is saprobic in/on dung or excretions of straw-mixed dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinopsis filamentifer is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinopsis nivea is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
fruitbody of Coprinopsis pachysperma is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
fruitbody of Coprinopsis pseudofriesii is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinopsis pseudonivea is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinus foetidellus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinus poliomallus is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinus xenobius is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
sessile, often in large groups apothecium of Coprobia granulata is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Coprotus albidus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Coprotus aurora is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Coprotus granuliformis is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Coprotus lacteus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Coprotus niveus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Coprotus ochraceus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
sessile apothecium of Coprotus sexdecimsporus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
pseudothecium of Delitschia canina is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
pseudothecium of Delitschia niesslii is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
pseudothecium of Delitschia patagonica is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
pseudothecium of Delitschia winteri is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: minor host/prey

Animal / parasite / ectoparasite / blood sucker
Dermacentor reticulatus sucks the blood of Bos taurus (domestic)

Animal / parasite / endoparasite
hydatid cyst of Echinococcus granulosus endoparasitises brain of Bos taurus (domestic)

Animal / dung associate
larva of Eudasyphora cyanella inhabits dung of Bos taurus (domestic)
Other: sole host/prey

Animal / pathogen
Foot and Mouth virus (FMD) infects Bos taurus (domestic)
Other: major host/prey

Animal / parasite / ectoparasite / blood sucker
Haemaphysalis punctata sucks the blood of Bos taurus (domestic)

Animal / associate
imago of Haematobia irritans is associated with horn (base) of Bos taurus (domestic)
Other: sole host/prey

Plant / resting place / within
ovum of Haematobosca stimulans may be found in almost fresh dung of Bos taurus (domestic)
Other: sole host/prey

Animal / dung associate
larva of Helina impuncta inhabits dung of Bos taurus (domestic)

Animal / parasite / ectoparasite
adult of Hippobosca equina ectoparasitises Bos taurus (domestic)
Other: minor host/prey

Animal / dung associate
larva of Hydrotaea tuberculata inhabits dung of Bos taurus (domestic)

Animal / parasite / ectoparasite / blood sucker
Ixodes ricinus sucks the blood of Bos taurus (domestic)

Animal / dung saprobe
Scopulariopsis anamorph of Kernia nitida is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
Lasiobolus diversisporus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / parasite / endoparasite
larva of Linguatula serrata endoparasitises lymph node of Bos taurus (domestic)

Animal / dung associate
larva of Mesembrina meridiana inhabits dung of Bos taurus (domestic)
Other: sole host/prey

Animal / dung associate
larva of Morellia hortorum inhabits dung of Bos taurus (domestic)
Other: sole host/prey

Animal / dung associate
larva of Morellia simplex inhabits dung of Bos taurus (domestic)
Other: sole host/prey

Animal / dung associate
larva of Musca autumnalis inhabits dung of Bos taurus (domestic)

Animal / dung/debris feeder
gymnothecium of Myxotrichum chartarum feeds on dung/debris rotting leather of Bos taurus (domestic)

Plant / resting place / under
imago of Odonteus armiger may be found under dry dung of Bos taurus (domestic)

Animal / dung/debris feeder
larva of Onthophagus vacca feeds on dung/debris buried dung of Bos taurus (domestic)

Animal / carrion / dead animal feeder
ascoma of Onygena equina feeds on dead hoof of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Panaeolus semiovatus var. semiovatus is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
apothecium of Peziza badiofusca is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Peziza bovina is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
substipitate or sessile apothecium of Peziza fimeti is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
colony of Oedocephalum anamorph of Peziza vesiculosa is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
immersed perithecium of Phomatospora coprophila is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sporangiophore of Pilaira anomala is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sporangiophore of Pilaira moreaui is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / parasite
Pityrosporum anamorph of Pityrosporum pachydermatis parasitises Bos taurus (domestic)

Animal / dung/debris feeder
Podops inuncta feeds on dung/debris dung of Bos taurus (domestic)
Remarks: Other: uncertain

Animal / dung saprobe
superficial perithecium of Podospora appendiculata is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora communis is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
perithecium of Podospora conica is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora decipiens is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
partly immersed perithecium of Podospora ellisiana is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora fimiseda is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora globosa is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora granulostriata is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora intestinacea is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora myriospora is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora pauciseta is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora perplexens is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora pleiospora is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora pyriformis is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora setosa is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung associate
larva of Polietes lardaria inhabits dung of Bos taurus (domestic)
Other: sole host/prey

Animal / dung saprobe
stalked stroma of Poronia punctata is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Psathyrella coprophila is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Psathyrella hirta is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Psathyrella scatophila is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Psathyrella sphaerocystis is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Psathyrella stercoraria is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
solitary, gregarious to subcaespitose fruitbody of Psathyrella tenuicola is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Psilocybe moelleri is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
fruitbody of Psilocybe subcoprophila is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / pathogen
redwater disease protozoan infects erythrocyte of Bos taurus (domestic)

Animal / associate
larva of Rhingia campestris is associated with rotting dung of Bos taurus (domestic)

Animal / parasite / ectoparasite / blood sucker
Rhipicephalus sanguineus sucks the blood of Bos taurus (domestic)

Animal / dung saprobe
densely crowded apothecium of Ryparobius brunneus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
solitary or gregarious, superficial, sessile apothecium of Saccobolus citrinus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus depauperatus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
solitary or gregarious, superficial, sessile apothecium of Saccobolus glaber is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus versicolor is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / rests in
cyst of Sarcocystis rests inside striated muscle of Bos taurus (domestic)

Animal / carrion / dead animal feeder
fruitbody of Schizophyllum commune feeds on dead dead leather of Bos taurus (domestic)
Other: unusual host/prey

Animal / dung saprobe
perithecium of Schizothecium aloides is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
perithecium of Schizothecium hispidulum is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
perithecium of Schizothecium pilosum is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
stromatic perithecium of Selinia pulchra is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
gregarious perithecium of Sordaria alcina is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
gregarious perithecium of Sordaria fimicola is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
perithecium of Sordaria minima is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Sphaerobolus stellatus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Sphaeronaemella fimicola is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella australis is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella borealis is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella grandispora is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella intermedia is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella leporina is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella minima is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella nigropurpurea is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella pascua is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella pulchella is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
synnema of Stilbella anamorph of Stilbella erythrocephala is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: minor host/prey

Animal / dung associate
larva of Stomoxys calcitrans inhabits dung of Bos taurus (domestic)

Animal / parasite / endoparasite
Cysticercus larva of Taenia hydatigena endoparasitises body cavity of Bos taurus (domestic)

Animal / parasite / endoparasite
cyst of Taenia saginata endoparasitises muscle of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Thecotheus pelletieri is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
gregarious, sometimes confluent apothecium of Thelebolus crustaceus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
gregarious apothecium of Thelebolus microsporus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Thelebolus nanus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
scattered or gregarious, sessile apothecium of Thelebolus polysporus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Thelebolus stercoreus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Tubaria romagnesiana is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)
Other: unusual host/prey

Animal / dung saprobe
perithecium of Zygospermella insignis is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Cows modify environments through grazing. In areas where their population numbers are artificially increased by humans, they can severely impact natural systems, causing erosion, introduction of non-native grasses and herbaceous plants, destruction of riparian habitats, and overgrazing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The wild ancestors of domestic cows were likely preyed on by large carnivores such as wolves, lions, humans, and bears. The majority of predation would have been on calves or sick and elderly individuals. Currently cows are sometimes preyed on by large, wild carnivores but the vast majority of predation is by humans. Their large size and herding behavior would have provided protection against predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Bos taurus is prey of:
Homo sapiens
Canis lupus
Panthera leo

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Cows communicate via chemical signals, touch, visual cues, and sounds. They perceive their environment primarily using the same set of senses.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Maximum lifespan in domestic cows may exceed 20 years. However, lifespan is often limited by human culling.

Range lifespan

Status: captivity:
>20 (high) years.

Typical lifespan

Status: captivity:
20 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20 years (captivity) Observations: Estimating the maximum longevity of domestic cattle is troublesome since there are many conflicting reports. Females appear to remain fertile for about 12 years, and animals have been known to live over 20 years (Ronald Nowak 1999). Most likely, animals can live over 20 years and there are even anecdotal reports of a cow called "Big Bertha" that lived nearly 49 years. Lastly, there are unverified reports that miniature cattle live longer than normal animals.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Domestic cows are social animals and live in groups called herds. Each herd is led by a dominant male who is the sole male to mate with the rest of the females.

Mating System: polygynous

Mating may occur year round, though more calves are born in spring months. One calf is born after approximately nine months of gestation. Young Bos taurus are preocial, they learn to recognize their mother and are able to stand and walk soon after birth. Young domestic cows nurse for approximately six months. Females reach sexual maturity at approximately one year and mating can continue to about twelve years.

(Hindsaw 1993; Walker et al. 1975; Huffman 2000)

Breeding interval: Cattle tend to reproduce once yearly.

Breeding season: Breeding occurs throughout the year.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Average gestation period: 9 months.

Average weaning age: 6 months.

Average time to independence: 12 months.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous

Average gestation period: 277 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
548 days.

Young are nursed by their mother for approximately 6 months and become independent during the following 6 months.

Parental Investment: altricial ; female parental care

  • Hinshaw, D. 1993. Cattle. Minneapolis: Carolrhoda Books, Inc.
  • Walker, E., F. Warnick, S. Hamlet, K. Lange, H. Uible. 1975. Mammals Of The World. London: THe Johns Hopkins University Press.
  • Huffman, B. January 1st, 2000. "Artiodactyla" (On-line). Accessed November 22, 2000 at http://www.ultimateungulate.com.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bos taurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 178 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGACTATTCTCAACCAACCATAAAGATATTGGTACCCTTTATCTACTATTTGGTGCTTGGGCCGGTATAGTAGGAACAGCTCTAAGCCTTCTAATTCGCGCTGAATTAGGCCAACCCGGAACTCTGCTCGGAGACGACCAAATCTACAACGTAGTTGTAACCGCACACGCATTTGTAATAATCTTCTTCATAGTAATACCAATCATAATTGGAGGATTCGGTAACTGACTTGTTCCCCTAATAATTGGTGCTCCCGATATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTCCTCCCTCCCTCATTCCTACTACTCCTCGCATCCTCTATAGTTGAAGCTGGGGCAGGAACAGGCTGAACCGTGTACCCTCCCTTAGCAGGCAACCTAGCCCATGCAGGAGCTTCAGTAGATCTAACCATTTTCTCTTTACACTTAGCAGGAGTTTCCTCAATTTTAGGAGCCATCAACTTCATTACAACAATTATCAACATAAAGCCCCCCGCAATGTCACAATACCAAACCCCTCTGTTCGTATGATCCGTAATAATTACCGCCGTACTACTACTACTCTCGCTCCCTGTATTAGCAGCCGGCATCACAATGCTATTAACAGACCGGAACCTAAATACAACCTTCTTCGACCCGGCAGGAGGAGGAGACCCTATTCTATATCAACACTTATTCTGATTCTTTGGACACCCCGAAGTCTATATTTTAATCTTACCTGGGTTTGGAATAATCTCTCATATCGTGACCTACTACTCAGGAAAAAAAGAACCATTCGGATATATGGGAATAGTTTGGGCTATAATGTCAATCGGATTTCTAGGTTTCATCGTATGAGCCCACCATATATTCACTGTCGGAATAGACGTCGACACACGAGCCTACTTCACATCAGCCACTATAATTATTGCTATTCCAACCGGGGTAAAAGTCTTCAGCTGATTGGCAACACTTCATGGAGGTAATATCAAATGGTCTCCTGCTATAATGTGAGCCCTAGGCTTTATTTTCTTATTTACAGTAGGGGGTTTAACTGGAATTGTCTTAGCCAACTCTTCCCTCGATATTGTTCTTCACGACACATACTACGTTGTCGCACATTTCCACTATGTTTTATCAATAGGAGCTGTATTTGCTATTATAGGGGGATTTGTTCATTGATTCCCACTATTCTCAGGTTATACTCTCAACGATACATGAGCCAAAATCCACTTCGCAATTATATTTGTAGGCGTCAATATAACCTTCTTCCCACAACACTTTCTAGGACTATCTGGCATGCCTCGACGATACTCCGACTACCCAGATGCATACACAATATGAAATACTATCTCATCAATAGGCTCATTCATTTCCCTAACAGCAGTTATACTAATAGTTTTCATCATCTGAGAAGCATTTGCATCTAAACGAGAAGTCTTGACTGTAGACTTAACCACGACAAATCTAGAATGATTAAACGGATGCCCTCCACCATATCACACATTTGAAGAACCCACCTATGTTAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bos taurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 240
Specimens with Barcodes: 324
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

There is some interest in conserving rapidly disappearing rare breeds and breeds that may have desirable qualities, such as Texas longhorn cattle and a number of older European breeds. However, as a species, cattle are not threatened.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

A negative aspect of domestic cattle husbandry is the transmissible spongiform encephalopathy, Bovine Spongiform Encephalopathy, better known as Mad Cow Disease. An outbreak in British cattle has caused international concern and resulted in multiple human infections. Mad Cow Disease is a fatal degenerative brain disease, which is caused by a protein known as a prion. In humans, the equivalent of bovine spongiform encephalopaty is Creutzfeldt-Jakob Disease ("CJD"), which causes a rapid dementia, and neurological damage leading to death. The disease is now believed to be linked to eating beef from infected cows. This disease has killed many people in Europe, therefore causing a ban on all importation of British beef by European countries.

In addition, range cattle are responsible for the transmission of diseases to native wildlife and rapid, and sometimes irreversible, damage to natural ecosystems.

(Brown 1996)

Negative Impacts: injures humans (carries human disease); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Domestic cows are used widely by humans for a variety of purposes. Cows are used primarily for dairy products (milk, cheese, etc.) and meat. They are also used for things such as medicines, glue, soap, and leather. Males are used for pulling large loads or for plowing the soil because of their large size and strength. The dung is a good source of fertilizer and fuel. Cows are also often important culturally and as a form of currency. (Rath 1993; Hindsaw 1998; Encyclopedia Britannica Online 2000)

Positive Impacts: food ; body parts are source of valuable material; source of medicine or drug ; research and education; produces fertilizer

  • 1999-2000. "Britannica.com" (On-line). Accessed October 6th, 2000 at www.britannica.com.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: Cattle may counteract efforts to protect native plants: grazing suppresses reproduction of koa in Hawaii (Baldwin and Fagerlund 1943). See Cuddihy (1984) for more information on effects of grazing on native Hawaiian flora.

See Loft et al. (1987) and Kie (1991) for information on the impacts of cattle grazing on mule deer in California. See Telfer (1994) for information on cattle-cervid interactions in Alberta. See Kochert et al. (1988) for effects of livestock grazing on raptors in the southwestern U.S. See also Uresk and Paulson (1988), Oldemeyer et al. (1988), and Samson et al. (1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cattle

Cattle (colloquially cows) are the most common type of large domesticated ungulates. They are a prominent modern member of the subfamily Bovinae, are the most widespread species of the genus Bos, and are most commonly classified collectively as Bos primigenius. Cattle are raised as livestock for meat (beef and veal), as dairy animals for milk and other dairy products, and as draft animals (oxen or bullocks) (pulling carts, plows and the like). Other products include leather and dung for manure or fuel. In some countries, such as India, cattle are sacred. From as few as 80 progenitors domesticated in southeast Turkey about 10,500 years ago,[2] an estimated 1.3 billion cattle are in the world today.[3] In 2009, cattle became the first livestock animal to have a fully mapped genome.[4]

Contents

Species[edit]

Cattle were originally identified as three separate species: Bos taurus, the European or "taurine" cattle (including similar types from Africa and Asia); Bos indicus, the zebu; and the extinct Bos primigenius, the aurochs. The aurochs is ancestral to both zebu and taurine cattle. Recently, these three have increasingly been grouped as one species, with Bos primigenius taurus, Bos primigenius indicus and Bos primigenius primigenius as the subspecies.[5]

Zubron, a cross between wisent and cattle

Complicating the matter is the ability of cattle to interbreed with other closely related species. Hybrid individuals and even breeds exist, not only between taurine cattle and zebu (such as the sanga cattle, Bos taurus africanus), but also between one or both of these and some other members of the genus Bos – yaks (the dzo or yattle[6]), banteng, and gaur. Hybrids such as the beefalo breed can even occur between taurine cattle and either species of bison, leading some authors to consider them part of the genus Bos, as well.[7] The hybrid origin of some types may not be obvious – for example, genetic testing of the Dwarf Lulu breed, the only taurine-type cattle in Nepal, found them to be a mix of taurine cattle, zebu, and yak.[8] However, cattle cannot successfully be hybridized with more distantly related bovines such as water buffalo or African buffalo.

The aurochs originally ranged throughout Europe, North Africa, and much of Asia. In historical times, its range became restricted to Europe, and the last known individual died in Masovia, Poland, in about 1627.[9] Breeders have attempted to recreate cattle of similar appearance to aurochs by crossing traditional types of domesticated cattle, creating the Heck cattle breed.

Etymology[edit]

"Cattle" did not originate as the term for bovine animals. It was borrowed from Anglo-Norman catel, itself from Latin caput, head, and originally meant movable personal property, especially livestock of any kind, as opposed to real property (the land, which also included wild or small free-roaming animals such as chickens — they were sold as part of the land).[10] The word is closely related to "chattel" (a unit of personal property) and "capital" in the economic sense.[11][12] The term replaced earlier Old English feoh "cattle, property" (cf. German: Vieh, Gothic: faihu).

The word "cow" came via Anglo-Saxon (plural ), from Common Indo-European gʷōus (genitive gʷowes) = "a bovine animal", compare Persian gâv, Sanskrit go, Welsh buwch.[citation needed] The genitive plural of is cȳna, which gave the now archaic English plural of "kine". The Scots language singular is coo or cou, and the plural is "kye".

In older English sources such as the King James Version of the Bible, "cattle" refers to livestock, as opposed to "deer" which refers to wildlife. "Wild cattle" may refer to feral cattle or to undomesticated species of the genus Bos. Today, when used without any other qualifier, the modern meaning of "cattle" is usually restricted to domesticated bovines.[citation needed]

Terminology[edit]

A Hereford bull

In general, the same words are used in different parts of the world, but with minor differences in the definitions. The terminology described here contrasts the differences in definition between the United Kingdom and other British-influenced parts of world such as Canada, Australia, New Zealand, Ireland, and the United States.[13]

  • An "intact" (i.e., not castrated) adult male is called a bull. A wild, young, unmarked bull is known as a "micky" in Australia.[14] An unbranded bovine of either sex is called a "maverick" in the USA and Canada.
  • An adult female that has had a calf (or two, depending on regional usage) is a cow.
  • A young female before she has had a calf of her own[15] and is under three years of age is called a heifer (/ˈhɛfər/ HEF-ər).[16] A young female that has had only one calf is occasionally called a first-calf heifer.
  • Young cattle of both sexes are called calves until they are weaned, then weaners until they are a year old in some areas; in other areas, particularly with male beef cattle, they may be known as feeder calves or simply feeders. After that, they are referred to as yearlings or stirks[17] if between one and two years of age.[18]
  • A castrated male is called a steer in the United States; older steers are often called bullocks in other parts of the world,[19] but in North America this term refers to a young bull. Piker bullocks are micky bulls that were caught, castrated and then later lost.[14] In Australia, the term "Japanese ox" is used for grain-fed steers in the weight range of 500 to 650 kg that are destined for the Japanese meat trade.[20] In North America, draft cattle under four years old are called working steers. Improper or late castration on a bull results in it becoming a coarse steer known as a stag in Australia, Canada and New Zealand.[21] In some countries, an incompletely castrated male is known also as a rig.
  • A castrated male (occasionally a female or in some areas a bull) kept for draft purposes is called an ox (plural oxen); "ox" may also be used to refer to some carcass products from any adult cattle, such as ox-hide, ox-blood, oxtail, or ox-liver.[16]
  • A springer is a cow or heifer close to calving.[22]
  • In all cattle species, a female twin of a bull usually becomes an infertile partial intersex, and is a freemartin.
  • Neat (horned oxen, from which neatsfoot oil is derived), beef (young ox) and beefing (young animal fit for slaughtering) are obsolete terms, although poll, pollard or polled cattle are still terms in use for naturally hornless animals, or in some areas also for those that have been disbudded.
  • Cattle raised for human consumption are called beef cattle. Within the beef cattle industry in parts of the United States, the older term beef (plural beeves) is still used to refer to an animal of either sex. Some Australian, Canadian, New Zealand and British people use the term beast, especially for single animals when the sex is unknown.[23]
  • Cattle of certain breeds bred specifically for milk production are called milking or dairy cattle;[13] a cow kept to provide milk for one family may be called a house cow or milker.
  • The adjective applying to cattle in general is usually bovine. The terms "bull", "cow" and "calf" are also used by extension to denote the sex or age of other large animals, including whales, hippopotamuses, camels, elk and elephants

Singular terminology issue[edit]

A herd of cattle

Cattle can only be used in the plural and not in the singular: it is a plurale tantum.[24] Thus one may refer to "three cattle" or "some cattle", but not "one cattle". No universally used singular form in modern English of "cattle" exists, other than the sex- and age-specific terms such as cow, bull, steer and heifer. Historically, "ox" was not a sex-specific term for adult cattle, but generally this is now used only for draft cattle, especially adult castrated males. The term is also incorporated into the names of other species, such as the musk ox and "grunting ox" (yak), and is used in some areas to describe certain cattle products such as ox-hide and oxtail.[25]

A Brahman calf

"Cow" is in general use as a singular for the collective "cattle", despite the objections by those who insist it to be a female-specific term. Although the phrase "that cow is a bull" is absurd from a lexicographic standpoint, the word "cow" is easy to use when a singular is needed and the sex is unknown or irrelevant - when "there is a cow in the road", for example. Further, any herd of fully mature cattle in or near a pasture is statistically likely to consist mostly of cows, so the term is probably accurate even in the restrictive sense. Other than the few bulls needed for breeding, the vast majority of male cattle are castrated as calves and slaughtered for meat before the age of three years. Thus, in a pastured herd, any calves or herd bulls usually are clearly distinguishable from the cows due to distinctively different sizes and clear anatomical differences. Merriam-Webster, a US dictionary, recognizes the sex-nonspecific use of "cow" as an alternate definition,[26] whereas Collins, a UK dictionary, does not.[27]

Colloquially, more general nonspecific terms may denote cattle when a singular form is needed. Australian, New Zealand and British farmers use the term "beast" or "cattle beast". "Bovine" is also used in Britain. The term "critter" is common in the western United States and Canada, particularly when referring to young cattle.[28] In some areas of the American South (particularly the Appalachian region), where both dairy and beef cattle are present, an individual animal was once called a "beef critter", though that term is becoming archaic.

Other terminology[edit]

Cattle raised for human consumption are called "beef cattle". Within the beef cattle industry in parts of the United States, the term "beef" (plural "beeves") is still used in its archaic sense to refer to an animal of either sex. Cows of certain breeds that are kept for the milk they give are called "dairy cows" or "milking cows" (formerly "milch cows"). Most young male offspring of dairy cows are sold for veal, and may be referred to as veal calves.

The term "dogies" is used to describe orphaned calves in the context of ranch work in the American West, as in "Keep them dogies moving".[29] In some places, a cow kept to provide milk for one family is called a "house cow". Other obsolete terms for cattle include "neat" (this use survives in "neatsfoot oil", extracted from the feet and legs of cattle), and "beefing" (young animal fit for slaughter).

An onomatopoeic term for one of the most common sounds made by cattle is "moo" (also called lowing). There are a number of other sounds made by cattle, including calves bawling, and bulls bellowing. The bullroarer makes a sound similar to a bull's territorial call.[citation needed]

Anatomy[edit]

Cattle have one stomach with four compartments, the rumen, reticulum, omasum, and abomasum, with the rumen being the largest compartment. The reticulum, the smallest compartment, is known as the "honeycomb". Cattle sometimes consume metal objects which are deposited in the reticulum and irritation from the metal objects causes hardware disease. The omasum's main function is to absorb water and nutrients from the digestible feed. The omasum is known as the "many plies". The abomasum is like the human stomach; this is why it is known as the "true stomach".

Dairy farming and the milking of cattle was once performed largely by hand, but is now usually replaced by machine

Cattle are ruminants, meaning their digestive systems allows use of otherwise indigestible foods by regurgitating and rechewing them as "cud". The cud is then reswallowed and further digested by specialised microorganisms in the rumen. These microbes are primarily responsible for decomposing cellulose and other carbohydrates into volatile fatty acids cattle use as their primary metabolic fuel. The microbes inside the rumen also synthesize amino acids from nonprotein nitrogenous sources, such as urea and ammonia. As these microbes reproduce in the rumen, older generations die and their cells continue on through the digestive tract. These cells are then partially digested by the cattle, allowing them to gain a high-quality protein source. These features allow cattle to thrive on grasses and other vegetation.

The gestation period for a cow is nine months. A newborn calf weighs 25 to 45 kg (55 to 99 lb). The world record for the heaviest bull was 1,740 kg (3,840 lb), a Chianina named Donetto, when he was exhibited at the Arezzo show in 1955.[30] The heaviest steer was eight-year-old ‘Old Ben’, a Shorthorn/Hereford cross weighing in at 2,140 kg (4,720 lb) in 1910.[31] Steers are generally killed before reaching 750 kg (1,650 lb). Breeding stock usually live to about 15 years (occasionally as much as 25 years). The oldest recorded cow, Big Bertha, died at the age of 48 in 1993.

A common misconception about cattle (particularly bulls) is that they are enraged by the color red (something provocative is often said to be "like a red flag to a bull"). This is incorrect, as cattle are red-green color-blind.[32][33] The myth arose from the use of red capes in the sport of bullfighting; in fact, two different capes are used. The capote is a large, flowing, magenta and yellow cape. The more famous muleta is the smaller, red cape, used exclusively for the final, fatal segment of the fight. It is not the color of the cape that angers the bull, but rather the movement of the fabric that irritates the bull and incites it to charge.

Having two kinds of color receptors in the cone cells in their retinas, cattle are dichromatic, as are most other nonprimate land mammals.[34][35]

A cow's udder contains two pairs of mammary glands.

Weight[edit]

Adult weights of cattle always depend on the breed. Smaller kinds, such as Dexter and Jersey adults, range between 272 to 454 kg (600 to 1,000 lb). Large Continental breeds, such as Charolais, Marchigiana, Belgian Blue and Chianina, adults range up to 635 to 1,134 kg (1,400 to 2,500 lb). British-breeds, such as Hereford, Angus, and Shorthorn, mature between 454 to 907 kg (1,000 to 2,000 lb), occasionally higher, particularly with Angus and Hereford.

Bulls will always be a bit larger than cows by a few extra hundred pounds. Chianina bulls can weigh up to 1,500 kg (3,300 lb); British bulls, such as Angus and Hereford, can weigh as little as 907 kg (2,000 lb) to as much as 1,361 kg (3,000 lb).

It is difficult to generalize or average out the weight of all cattle because different kinds have different averages of weights. However, according to some sources, the average weight of all cattle is 753 kg (1,660 lb). Finishing steers in the feedlot average about 640 kg (1,400 lb); cows about 725 kg (1,600 lb), and bulls about 1,090 kg (2,400 lb).

Cattle genome[edit]

In the April 24, 2009, edition of the journal Science, a team of researchers led by the National Institutes of Health and the US Department of Agriculture reported having mapped the bovine genome.[36] The scientists found cattle have about 22,000 genes, and 80% of their genes are shared with humans, and they share about 1000 genes with dogs and rodents, but are not found in humans. Using this bovine "HapMap", researchers can track the differences between the breeds that affect the quality of meat and milk yields.[37]

Domestication and husbandry[edit]

Texas Longhorns are a US breed

Cattle occupy a unique role in human history, domesticated since at least the early Neolithic. Modern genetic research suggests the entire modern domestic stock may have arisen from as few as 80 aurochs tamed in the upper reaches of Mesopotamia about 10,500 years ago near the villages of Çayönü Tepesi in southeastern Turkey and Dja'de el-Mughara in northern Iraq.[2] They are raised for meat (beef cattle), dairy products and hides. They are also used as draft animals and in certain sports. Some consider cattle the oldest form of wealth, and cattle raiding consequently one of the earliest forms of theft.

This Hereford is being inspected for ticks; cattle are often restrained or confined in cattle crushes (squeeze chutes) when given medical attention.
This young bovine has a nose ring to prevent it from suckling, which is usually to assist in weaning.

Cattle are often raised by allowing herds to graze on the grasses of large tracts of rangeland. Raising cattle in this manner allows the use of land that might be unsuitable for growing crops. The most common interactions with cattle involve daily feeding, cleaning and milking. Many routine husbandry practices involve ear tagging, dehorning, loading, medical operations, vaccinations and hoof care, as well as training for agricultural shows and preparations. Also, some cultural differences occur in working with cattle; the cattle husbandry of Fulani men rests on behavioural techniques, whereas in Europe, cattle are controlled primarily by physical means, such as fences.[38] Breeders use cattle husbandry to reduce M. bovis infection susceptibility by selective breeding and maintaining herd health to avoid concurrent disease.[39]

Cattle are farmed for beef, veal, dairy, and leather, and they are less commonly used for conservation grazing, simply to maintain grassland for wildlife – for example, in Epping Forest, England. They are often used in some of the most wild places for livestock. Depending on the breed, cattle can survive on hill grazing, heaths, marshes, moors and semidesert. Modern cattle are more commercial than older breeds and, having become more specialized, are less versatile. For this reason, many smaller farmers still favor old breeds, such as the Jersey dairy breed. In Portugal, Spain, southern France and some Latin American countries, bulls are used in the activity of bullfighting; Jallikattu in India is a bull taming sport radically different from European bullfighting, humans are unarmed and bulls are not killed. In many other countries bullfighting is illegal. Other activities such as bull riding are seen as part of a rodeo, especially in North America. Bull-leaping, a central ritual in Bronze Age Minoan culture (see Bull (mythology)), still exists in southwestern France. In modern times, cattle are also entered into agricultural competitions. These competitions can involve live cattle or cattle carcases in hoof and hook events.

In terms of food intake by humans, consumption of cattle is less efficient than of grain or vegetables with regard to land use, and hence cattle grazing consumes more area than such other agricultural production when raised on grains.[40] Nonetheless, cattle and other forms of domesticated animals can sometimes help to use plant resources in areas not easily amenable to other forms of agriculture.

Sleep[edit]

The average sleep time of a domestic cow is about four hours a day.[41]

Economy[edit]

Holstein cattle are the primary dairy breed, bred for high milk production.

The meat of adult cattle is known as beef, and that of calves is veal. Other animal parts are also used as food products, including blood, liver, kidney, heart and oxtail. Cattle also produce milk, and dairy cattle are specifically bred to produce the large quantities of milk processed and sold for human consumption. Cattle today are the basis of a multi-billion dollar industry worldwide. The international trade in beef for 2000 was over $30 billion and represented only 23% of world beef production.[42] The production of milk, which is also made into cheese, butter, yogurt, and other dairy products, is comparable in economic size to beef production, and provides an important part of the food supply for many of the world's people. Cattle hides, used for leather to make shoes, couches and clothing, are another widespread product. Cattle remain broadly used as draft animals in many developing countries, such as India.

Environmental impact[edit]

Cattle have been identified as a contributing factor in the rise in greenhouse gas emissions.

A report from the Food and Agriculture Organization (FAO) states that the livestock sector is "responsible for 18% of greenhouse gas emissions".[43] The report concludes, unless changes are made, the damage thought to be linked to livestock may more than double by 2050, as demand for meat increases. Another concern is manure, which if not well-managed, can lead to adverse environmental consequences. However, manure also is a valuable source of nutrients and organic matter when used as a fertilizer.[44] Manure was used as a fertilizer on about 15.8 million acres of US cropland in 2006, with manure from cattle accounting for nearly 70% of manure applications to soybeans and about 80% or more of manure applications to corn, wheat, barley, oats and sorghum.[45] Further, substitution of manure for synthetic fertilizers in crop production can be environmentally significant, as between 43 and 88 MJ of fossil fuel energy are used per kg of nitrogen in manufacture of synthetic nitrogenous fertilizers.[46]

One of the cited changes suggested to reduce greenhouse gas emissions is intensification of the livestock industry, since intensification leads to less land for a given level of production. This assertion is supported by studies of the US beef production system, suggesting practices prevailing in 2007 involved 8.6% less fossil fuel use, 16.3% less greenhouse gas emissions, 12.1% less water use, and 33.0% less land use, per unit mass of beef produced, than those used in 1977.[47] However, these numbers included not only feedlots, but also feed production, forage-based cow-calf operations, backgrounding before cattle enter a feedlot, and animals culled from the dairy industry.[48]

The number of American cattle kept in confined feedlot conditions fluctuates. From January 1, 2002 through January 1, 2012, there was no significant overall upward or downward trend in the number of US cattle on feed for slaughter, which averaged about 14.046 million head over that period.[49][50] Previously, the number had increased; it was 12.453 million in 1985.[51] Cattle on feed (for slaughter) numbered about 14.121 million on January 1, 2012, i.e. about 15.5% of the estimated inventory of 90.8 million US cattle (including calves) on that date. Of the 14.121 million, US cattle on feed (for slaughter) in operations with 1000 head or more were estimated to number 11.9 million.[50] Cattle feedlots in this size category correspond to the regulatory definition of "large" concentrated animal feeding operations (CAFOs) for cattle other than mature dairy cows or veal calves.[52] Significant numbers of dairy, as well as beef cattle, are confined in CAFOs. CAFOs are defined as "new and existing operations which stable or confine and feed or maintain for a total of 45 days or more in any 12-month period more than the number of animals specified"[53] where "[c]rops, vegetation, forage growth, or post-harvest residues are not sustained in the normal growing season over any portion of the lot or facility."[54] They may be designated as small, medium and large. Such designation of cattle CAFOs is according to cattle type (mature dairy cows, veal calves or other) and cattle numbers, but medium CAFOs are so designated only if they meet certain discharge criteria, and small CAFOs are designated only on a case-by-case basis.[55]

A CAFO that discharges pollutants is required to obtain a permit, which requires a plan to manage nutrient runoff, manure, chemicals, contaminants, and other wastewater pursuant to the Clean Water Act.[56] The regulations involving CAFO permitting have been extensively litigated.[57] Commonly, CAFO wastewater and manure nutrients are applied to land at agronomic rates for use by forages or crops, and it is often assumed that various constituents of wastewater and manure, e.g. organic contaminants and pathogens, will be retained, inactivated or degraded on the land with application at such rates; however, additional evidence is needed to test reliability of such assumptions .[58] Concerns raised by opponents of CAFOs have included risks of contaminated water due to feedlot runoff,[59] soil erosion, human and animal exposure to toxic chemicals, development of antibiotic resistant bacteria and an increase in E. coli contamination.[60] While research suggests some of these impacts can be mitigated by developing wastewater treatment systems[59] and planting cover crops in larger setback zones,[61] the Union of Concerned Scientists released a report in 2008 concluding that CAFOs are generally unsustainable and externalize costs.[62]

An estimated 935,000 cattle operations were operating in the USA in 2010.[63] In 2001, the US Environmental Protection Agency (EPA) tallied 5,990 cattle CAFOs then regulated, consisting of beef (2,200), dairy (3,150), heifer (620) and veal operations (20).[64] Since that time, the EPA has established CAFOs as an enforcement priority. EPA enforcement highlights for fiscal year 2010 indicated enforcement actions against 12 cattle CAFOs for violations that included failures to obtain a permit, failures to meet the terms of a permit, and discharges of contaminated water.[65]

Grazing by cattle at low intensities can create a favourable environment for native herbs and forbs; in many world regions, though, cattle are reducing biodiversity due to overgrazing.[66] A survey of refuge managers on 123 National Wildlife Refuges in the US tallied 86 species of wildlife considered positively affected and 82 considered negatively affected by refuge cattle grazing or haying.[67] Proper management of pastures, notably managed intensive rotational grazing and grazing at low intensities can lead to less use of fossil fuel energy, increased recapture of carbon dioxide, fewer ammonia emissions into the atmosphere, reduced soil erosion, better air quality, and less water pollution.[62]

Some microbes in the cattle gut carry out anaerobic process known as methanogenesis, which produces methane. Cattle and other livestock emit about 80 to 93 Tg of methane per year,[68] accounting for an estimated 37% of anthropogenic methane emissions,[43] and additional methane is produced by anaerobic fermentation of manure in manure lagoons and other manure storage structures.[69] The 100-year global warming potential of methane, including effects on ozone and stratospheric water vapor, is 25 times as great as that of carbon dioxide.[70] Methane's effect on global warming is correlated with changes in atmospheric methane content, not with emissions. The net change in atmospheric methane content was recently about 1 Tg per year,[71] and in some recent years there has been no increase in atmospheric methane content.[72] Mitigation options for reducing methane emission from ruminant enteric fermentation include genetic selection, immunization, rumen defaunation, diet modification and grazing management, among others.[73][74][75] While cattle fed forage actually produce more methane than grain-fed cattle, the increase may be offset by the increased carbon recapture of pastures, which recapture three times the CO2 of cropland used for grain.[62]

Health[edit]

Cow urine is commonly used in India for medical purposes. It is distilled and then consumed by patients seeking treatment for a wide variety of illnesses. At present, no conclusive medical evidence shows this has any effect.[76]

Oxen[edit]

Oxen (singular ox) are cattle trained as draft animals. Often they are adult, castrated males of larger breeds, although females and bulls are also used in some areas. Usually, an ox is over four years old due to the need for training and to allow it to grow to full size. Oxen are used for plowing, transport, hauling cargo, grain-grinding by trampling or by powering machines, irrigation by powering pumps, and wagon drawing. Oxen were commonly used to skid logs in forests, and sometimes still are, in low-impact, select-cut logging. Oxen are most often used in teams of two, paired, for light work such as carting, with additional pairs added when more power is required, sometimes up to a total of 20 or more.

An ox is a mature bovine which has learned to respond appropriately to a teamster's signals. These signals are given by verbal commands or by noise (whip cracks). Verbal commands vary according to dialect and local tradition. In one tradition in North America, the commands are:[citation needed]

  • "Get up": walk forward
  • "Whoa": stop
  • "Back up": go backwards
  • "Gee": turn right
  • "Haw": turn left
Riding an ox in Hova, Sweden

Oxen can pull harder and longer than horses. Though not as fast as horses, they are less prone to injury because they are more sure-footed.

Many oxen are used worldwide, especially in developing countries. About 11.3 million draft oxen are used in sub-Saharan Africa.[77] In India, the number of draft cattle in 1998 was estimated at 65.7 million head.[78] About half the world's crop production is thought to depend on land preparation (such as plowing) made possible by animal traction.[79]

Ure-Ox

Religion, traditions and folklore[edit]

Hindu tradition[edit]

In Hinduism, the cow is a symbol of wealth, strength, abundance, selfless giving and a full Earthly life.

Cattle are venerated within the Hindu religion of India.[clarification needed] According to Vedic scriptures they are to be treated with the same respect 'as one's mother' because of the milk they provide; "The cow is my mother" (Mahabharata)[80] They appear in numerous stories from the Puranas and Vedas. The deity Krishna was brought up in a family of cowherders, and given the name Govinda (protector of the cows). Also, Shiva is traditionally said to ride on the back of a bull named Nandi. In ancient rural India every household had a few cows which provided a constant supply of milk and a few bulls that helped as draft animals.[citation needed]

Observant Hindus, though they might eat meat of other animals, almost always abstain from beef, and the slaughter of cows is considered a heinous sin in mainstream Orthodox Hinduism. Slaughter of cows (including oxen, bulls and calves) is forbidden by law in several states of the Indian Union. McDonalds outlets in India do not serve any beef burgers. At one time, the death sentence was imposed for killing a cow in India.[81] According to a Lodi News-Sentinel news story written in the 1960s, in then contemporary Nepal an individual could serve three months in jail for killing a pedestrian, but one year for injuring a cow, and life imprisonment for killing a cow.[82]

Other traditions[edit]

Legend of the founding of Durham Cathedral is that monks carrying the body of Saint Cuthbert were led to the location by a milk maid who had lost her dun cow, which was found resting on the spot.
An idealized depiction of girl cow herders in 19th Century Norway by Knud Bergslien.

In heraldry[edit]

Cattle are typically represented in heraldry by the bull.

Population[edit]

The world cattle population is estimated to be about 1.3 billion.[3] The following table shows the cattle population in 2009[85]

Africa has about 20,000,000 head of cattle, many of which are raised in traditional ways and serve partly as tokens of their owner's wealth.[citation needed]

Cattle population  (View diagram)
RegionCattle population
India281,700,000
Brazil187,087,000
China139,721,000
US96,669,000
EU87,650,000
Argentina51,062,000
Australia29,202,000
Mexico26,489,000
Russian Federation18,370,000
South Africa14,187,000
Canada13,945,000
Other49,756,000

See also[edit]

Notes[edit]

  1. ^ Grubb, P. (2005). "Bos taurus primigenius". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 637–722. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b Bollongino, Ruth & al. Molecular Biology and Evolution. "Modern Taurine Cattle descended from small number of Near-Eastern founders". 7 Mar 2012. Accessed 2 Apr 2012. Op. cit. in Wilkins, Alasdair. io9.com. "DNA reveals that cows were almost impossible to domesticate". 28 Mar 2012. Accessed 2 Apr 2012.
  3. ^ a b Breeds of Cattle at CATTLE TODAY
  4. ^ Brown, David (2009-04-23). "Scientists Unravel Genome of the Cow". The Washington Post. Retrieved 2009-04-23. 
  5. ^ Opinions, Bulletin of Zoological Nomenclature 60 (1), 2003
  6. ^ "Yattle What?", Washington Post, August 11, 2007
  7. ^ Groves, C. P., 1981. Systematic relationships in the Bovini (Artiodactyla, Bovidae). Zeitschrift für Zoologische Systematik und Evolutionsforschung, 4:264-278., quoted in Grubb, P. (2005). "Genus Bison". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 637–722. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  8. ^ Takeda, Kumiko; et al. (April 2004). "Mitochondrial DNA analysis of Nepalese domestic dwarf cattle Lulu". Animal Science Journal (Blackwell Publishing) 75 (2): 103–110. doi:10.1111/j.1740-0929.2004.00163.x. Retrieved 2006-11-07. 
  9. ^ Van Vuure, C.T. 2003. De Oeros – Het spoor terug (in Dutch), Cis van Vuure, Wageningen University and Research Centrum: quoted by The Extinction Website: Bos primigenius primigenius.
  10. ^ Harper, Douglas (2001). "Cattle". Online Etymological Dictionary. Retrieved 2007-06-13. 
  11. ^ Harper, Douglas (2001). "Chattel". Online Etymological Dictionary. Retrieved 2007-06-13. 
  12. ^ Harper, Douglas (2001). "Capital". Online Etymological Dictionary. Retrieved 2007-06-13. 
  13. ^ a b "Cattle Terminology". experiencefestival.com. 
  14. ^ a b Coupe, Sheena (ed.), Frontier Country, Vol. 1, Weldon Russell Publishing, Willoughby, 1989, ISBN 1-875202-01-3
  15. ^ "Definition of heifer". Merriam-Webster. Retrieved 2006-11-29. 
  16. ^ a b Delbridge, Arthur, The Macquarie Dictionary, 2nd ed., Macquarie Library, North Ryde, 1991
  17. ^ McIntosh, E., The Concise Oxford Dictionary of Current English, Clarendon Press, 1967
  18. ^ Warren, Andrea. "Pioneer Girl: Growing Up on the Prairie" (PDF). Lexile. Archived from the original on 2006-11-01. Retrieved 2006-11-29. 
  19. ^ Delbridge, A, et al., Macquarie Dictionary, The Book Printer, Australia, 1991
  20. ^ Meat & Livestock Australia, Feedback, June/July 2008
  21. ^ Sure Ways to Lose Money on Your Cattle
  22. ^ FAQs: What is meant by springer cows and heifers?, Dr. Rick Rasby, Professor of Animal Science, University of Nebraska - Lincoln, September 6th, 2005. Retrieved: 2010-08-12.
  23. ^ Australians Camdraft Assoc. Retrieved on 2009-7-31
  24. ^ "Cattle (5, 6)". Oxford English Dictionary (3rd ed.). Oxford University Press. September 2005. 
  25. ^ "Ox (1, 2)". Oxford English Dictionary (3rd ed.). Oxford University Press. September 2005. 
  26. ^ Merriam Webster Online
  27. ^ Collins Language.com[dead link]
  28. ^ "Critter," definition 2.
  29. ^ Beales, Terry (1999). "Keep Those Dogies Movin!" (PDF). Texas Animal Health Commission News Release. Archived from the original on 2008-06-02. Retrieved 2008-06-28. 
  30. ^ Friend, John B., Cattle of the World, Blandford Press, Dorset, 1978
  31. ^ McWhirter, Norris & Ross, Guinness Book of Records, Redwood Press, Trowbridge, 1968
  32. ^ Itla.net, Longhorn information - handling.
  33. ^ "?". iacuc.tennessee.edu. [dead link]
  34. ^ Jacobs, G. H., J. F.Deegan, and J. Neitz. 1998. Photopigment basis for dichromatic color vision in cows, goats and sheep. Vis. Neurosci. 15:581–584
  35. ^ Perception of Color by Cattle and its Influence on Behavior C.J.C. Phillips* and C. A. Lomas†2 J. Dairy Sci. 84:807–813
  36. ^ "Cow genome unraveled in bid to improve meat, milk". Associated Press. 2009-04-23. Retrieved 2009-04-23. [dead link]
  37. ^ BBC: Cow genome 'to transform farming'
  38. ^ Lott, Dale F.; Hart, Benjamin L. (October 1979). "Applied ethology in a nomadic cattle culture". Applied Animal Ethology (Elsevier B.V.) 5 (4): 309–319. doi:10.1016/0304-3762(79)90102-0. 
  39. ^ Krebs JR, Anderson T, Clutton-Brock WT, et al. (1997). Bovine tuberculosis in cattle and badgers: an independent scientific review (PDF). Ministry of Agriculture, Fisheries and Food. Retrieved 2006-09-04. [dead link]
  40. ^ Edward O. Wilson, The Future of Life, 2003, Vintage Books, 256 pages ISBN 0-679-76811-4
  41. ^ "40 Winks?" Jennifer S. Holland, National Geographic Vol. 220, No. 1. July 2011.
  42. ^ (Clay 2004).
  43. ^ a b Steinfeld, H. et al. 2006, Livestock’s Long Shadow: Environmental Issues and Options. Livestock, Environment and Development, FAO.
  44. ^ http://www.fao.org/ag/againfo/programmes/en/lead/toolbox/Tech/20ManMgn.htm
  45. ^ McDonald, J. M. et al. 2009. Manure use for fertilizer and for energy. Report to Congress. USDA, AP-037. 53pp.
  46. ^ Shapouri, H. et al. 2002. The energy balance of corn ethanol: an update. USDA Agricultural Economic Report 814.
  47. ^ Capper, J. L. 2011. The environmental impact of beef production in the United States: 1977 compared with 2007. J. Anim. Sci. 89: 4249-4261
  48. ^ http://www.ers.usda.gov/publications/ldp/LDGTables.htm , SlaughterCounts (Excel file)
  49. ^ USDA. 2011. Agricultural Statistics 2011. US Government Printing Office, Washington. 509 pp. Table 7.6.
  50. ^ a b USDA. 2012. Cattle. http://usda01.library.cornell.edu/usda/current/Catt/Catt-01-27-2012.pdf
  51. ^ USDA 1994. Agricultural Statistics 1994. US Government Printing Office, Washington. 485 pp. Table 377.
  52. ^ US Code of Federal Regulations 40 CFR 122.23
  53. ^ "What is a Factory Farm?" Sustainable Table
  54. ^ US Code of Federal Regulations 40 CFR 122
  55. ^ "http://www.epa.gov/npdes/pubs/sector_table.pdf "Regulatory Definitions of Large CAFOs, Medium CAFO, and Small CAFOs." Environmental Protection Agency Fact Sheet.
  56. ^ US Code of Federal Regulations 40 CFR 122.23, 40 CFR 122.42
  57. ^ See, e.g., Waterkeeper Alliance et al. v. EPA, 399 F.3d 486 (2nd cir. 2005); National Pork Producers Council, et al. v. United States Environmental Protection Agency, 635 F. 3d 738 (5th Cir. 2011).
  58. ^ Bradford, S. A., E. Segal, W. Zheng, Q. Wang, and S. R. Hutchins. 2008. Reuse of concentrated animal feeding operation wastewater on agricultural lands. J. Env. Qual. 37 (supplement): S97-S115.
  59. ^ a b APPLYING ALTERNATIVE TECHNOLOGIES TO CAFOS: A CASE STUDY Richard Koelsch, Carol Balvanz, John George, Dan Meyer, John Nienaber, Gene Tinker
  60. ^ Ikerd, John. The Economics of CAFOs & Sustainable Alternatives
  61. ^ Hansen, Dave, Nelson, Jennifer and Volk, Jennifer. Setback Standards and Alternative Compliance Practices to Satisfy CAFO Requirements: An assessment for the DEF-AG group
  62. ^ a b c Gurian-Sherman, Doug. CAFOs Uncovered: The Untold Costs of Confined Animal Feeding Operations
  63. ^ USDA. 2011. Agricultural Statistics 2011. US Government Printing Office, Washington. 509 pp. Table 7.1.
  64. ^ EPA. 2001. Environmental and economic benefit analysis of proposed revisions to the National Pollutant Discharge Elimination System Regulation and the effluent guidelines for concentrated animal feeding operations. US Environmental Protection Agency. EPA-821-R-01-002. 157 pp.
  65. ^ http://www.epa.gov/compliance/data/planning/priorities/cwacafo.html
  66. ^ E.O. Wilson, The Future of Life, 2003, Vintage Books, 256 pages ISBN 067976811
  67. ^ Strassman, B. I. 1987. Effects of cattle grazing and haying on wildlife conservation at National Wildlife Refuges in the United States. Environmental Mgt. 11: 35-44 .
  68. ^ IPCC. 2001. Third Assessment Report. Intergovernmental Panel on Climate Change. Working Group I: The Scientific Basis. Table 4.2
  69. ^ US EPA. 2012. Inventory of U.S. greenhouse gase emissions and sinks: 1990-2010. US. Environmental Protection Agency. EPA 430-R-12-001. Section 6.2.
  70. ^ IPCC. 2007. Fourth Assessment Report. Intergovernmental Panel on Climate Change
  71. ^ IPCC. 2007. Fourth Assessment Report. Intergovernmental Panel on Climate Change.
  72. ^ Dlugokencky, E. J. et al. 2011. Global atmospheric methane: budget, changes and dangers. Phil. Trans. Royal Soc. 369: 2058-2072.
  73. ^ Boadi, D. et al. 2004. Mitigation strategies to reduce enteric methane emissions from dairy cows: Update review . Can. J. Anim. Sci. 84: 319-335.
  74. ^ Martin, C. et al. 2010. Methane mitigation in ruminants: from microbe to the farm scale. Animal 4 : pp 351-365.
  75. ^ Eckard, R. J. et al. 2010. Options for the abatement of methane and nitrous oxide from ruminant production: A review. Livestock Science 130: 47-56.
  76. ^ "(video) Indian Doctors Use Cow Urine As Medicine". Retrieved 27 November 2010.  Unknown parameter |news= ignored (|newspaper= suggested) (help)
  77. ^ Muruvimi, F. and J. Ellis-Jones. 1999. A farming systems approach to improving draft animal power in Sub-Saharan Africa. In: Starkey, P. and P. Kaumbutho. 1999. Meeting the challenges of animal traction. Intermediate Technology Publications, London. pp. 10-19.
  78. ^ Phaniraja, K. L. and H. H. Panchasara. 2009. Indian draught animals power. Veterinary World 2:404-407.
  79. ^ Nicholson, C. F, R. W. Blake, R. S. Reid and J. Schelhas. 2001. Environmental impacts of livestock in the developing world. Environment 43(2): 7-17.
  80. ^ Mahabharata, Book 13-Anusasana Parva, Section LXXVI
  81. ^ Subramanian Swamy (21 November 2001). "Save the cow, save earth". Express Buzz. Retrieved 27 November 2010. 
  82. ^ "Injured cow in Nepal is serious matter". Yahoo! News. Retrieved 27 November 2010. 
  83. ^ Kane, J.; Anzovin, S., & Podell, J. (1997). Famous First Facts. New York, NY: H. W. Wilson Company. p. 5. ISBN 0-8242-0930-3. 
  84. ^ Madden, Thomas (May 1992). "Akabeko". OUTLOOK. Online copy accessed 18 January 2007.
  85. ^ [1][dead link]

References[edit]

  • Bhattacharya, S. 2003. Cattle ownership makes it a man's world. Newscientist.com. Retrieved December 26, 2006.
  • Cattle Today (CT). 2006. Website. Breeds of cattle. Cattle Today. Retrieved December 26, 2006
  • Clay, J. 2004. World Agriculture and the Environment: A Commodity-by-Commodity Guide to Impacts and Practices. Washington, D.C., USA: Island Press. ISBN 1-55963-370-0.
  • Clutton-Brock, J. 1999. A Natural History of Domesticated Mammals. Cambridge UK : Cambridge University Press. ISBN 0-521-63495-4.
  • Purdy, Herman R.; R. John Dawes; Dr. Robert Hough (2008). Breeds Of Cattle (2nd ed.).  - A visual textbook containing History/Origin, Phenotype & Statistics of 45 breeds.
  • Huffman, B. 2006. The ultimate ungulate page. UltimateUngulate.com. Retrieved December 26, 2006.
  • Invasive Species Specialist Group (ISSG). 2005. Bos taurus. Global Invasive Species Database.
  • Nowak, R.M. and Paradiso, J.L. 1983. Walker's Mammals of the World. Baltimore, Maryland, USA: The Johns Hopkins University Press. ISBN 0-8018-2525-3
  • Oklahoma State University (OSU). 2006. Breeds of Cattle. Retrieved January 5, 2007.
  • Public Broadcasting Service (PBS). 2004. Holy cow. PBS Nature. Retrieved January 5, 2007.
  • Rath, S. 1998. The Complete Cow. Stillwater, Minnesota, USA: Voyageur Press. ISBN 0-89658-375-9.
  • Raudiansky, S. 1992. The Covenant of the Wild. New York: William Morrow and Company, Inc. ISBN 0-688-09610-7.
  • Spectrum Commodities (SC). 2006. Live cattle. Spectrumcommodities.com. Retrieved January 5, 2007.
  • Voelker, W. 1986. The Natural History of Living Mammals. Medford, New Jersey, USA: Plexus Publishing, Inc. ISBN 0-937548-08-1.
  • Yogananda, P. 1946. The Autobiography of a Yogi. Los Angeles, California, USA: Self Realization Fellowship. ISBN 0-87612-083-4.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Frankeston

The Frankeston Red is a genetically improved bovine cattle, its creation focus was for it to be a dual-purpose cattle to be used as both dairy and beef cattle.

Contents

History of the breed [edit]

The Frankeston Red is the first breed of cattle in the world created in the 21st Century by the scientist director of the Frankeston project, Dr. Francisco A. Restom Bitar; a specialist in human and animal genetics, and his team at the Bovine Genetic Experimental Center Remanso Caribe (Centro de Experimentación Genética Bovina Remanso Caribe in Spanish) located in the municipality of Arjona, Colombia, in the vicinity of Cartagena de Indias.

Restom started his genetic experiments in the middle of the year 1984, combining strategic and orderly in vivo chromosomes the native races x Cebu with semen of purebreds and their subsequent mating inter se to create the Frankeston breed, a cattle race biologically adapted for adverse conditions of the warm tropics, capable of producing more milk and more meat (dual purpose), surpassing not only the performance of every other breed, but also of crossed foreign cattle throughout the Caribbean region.

The scientist published his work during the first quarter of 2001 and the breed was officially introduced by the end of 2003 in the III Scientific Convention of the University of Cartagena, an institution that through a cooperation agreement evaluated in situ the last 3 years of research and endorsed the results of the work done with the breed.

This breed was born from a desperate search for a sustainable and profitable solution to the repeated failure of foreign cattle to produce properly in the region due to the environmental conditions of the tropics, and their indiscriminate use in crosses carried out without control, without order, goals, or scientific studies throughout history.

It is a new biotype of dual-purpose bovine (milk and meat), more efficient and biologically resistant to heat, high solar radiation, and tropical diseases. A breed created to lessen the ecological and economic cost that has represented Colombia's needs to import genetic material, incalculable losses due to productivity, and progressive deterioration of farmers in the society.

The work has also been successfully submitted in other conventions such as the First Congress and V Scientific Convention of the University of Panama (2004), and III International Congress and IV National Congress of Human Genetics at Universidad del Norte in Barranquilla, Colombia (2004).

The creation of the Frankeston breed has been a long and complex work and has required the application of the scientific method, mathematics, planning, and execution. All of them adjusted to the principles and laws of genetics.

Methodology [edit]

In each of the stages of crosses to achieve genetic recombination that gave rise to the F1, F2, F3 and F4 and following, the scientist carried out biometric analysis, he confronted the development and general biological behavior of animals, and verified that the best genes of adaptation, milk and meat production, were inheriting from the different races and through gene interaction of them, had created the prototype which was planned based on the best phenotypic features of its predecessors, constituting, finally, the Frankeston race.

Once the prototype was obtained, the scientist proceeded to do successive chromosomal recombination inter se, in other words, to mate female and male Frankeston to form the F5, F6, etc.

That way the new breed consolidated the traits pursued throughout the investigation, indicating that the genes have been set by the phenomenon of interbreeding that allowed a genetic linkage resulting in the creation of the new breed Frankeston.

Racial pattern [edit]

In the coat or fur of the race is the predominant red colour

(95%). This allows filtering UV rays protecting the animal of solar erythema. It is covered by hair very short and fine, a quality of cattle adapted to the tropics. Dewlap of regular size, wrinkled and gently attached. Hump of medium size in the bulls and superficial in females. Height at wither medium. Body enlarged with fine bones, compact and balanced. Its dorsal line is straight and strong. Good thoracic depth. Very good limbs, provided with strong, high, and pigmented hooves, very suitable to withstand humidity and long journeys.

The sire is very vigorous, masculine, and very sexually active. Testicles are very well shaped and of good size. And the cow's mammary system has a glandular udder, good size, quite firm and well irrigated.

Productive advantages [edit]

The females have in their first lactation good productions improving in the second the average of the average of 2,580 kg. per lactation in 313 days as one of the breed's trait is high productive periods.

These productions are 338% above the regional milk production, and +28% in meat production, surpassing not only the performance of the other breeds, but also to all crossings with foreign cattle that are milked in the Caribbean region.

The production of this race is clean, organic, obtained in the regime of foraging tropical pastures and managed without the administration of hormones, animal waste products, or antibiotics.

Milk production curve

It also responds generously when the environmental conditions involved in production and reproduction are improved. Cows that are daughters of Frankeston bulls by natural mating have produced up to 28.1 kg. of milk a day and over 4.800 kg. per lactation, and many of the males come to increase about 1.000 grams of weight a day when they are given the right nutritional and handling conditions to not limit them their potential.

The prediction of the total milk production of cows of the Frankeston breed in the second and third delivery through the registry of performance at the peak of lactation, yields for this breed a total estimated production of 6.750 kg in a lactation of 313 days for a peak of 28 kg./day and 6000 kg. to a peak of 25 kg./day.(Factor 0.416 was used for this breed).

The peak presented itself between 50 and 75 days after delivery. More information about these investigations can be found in the work "Dual purpose livestock of the XXI Century in the tropics".

Female Frankeston show more fertility, its productive longevity and durability are one of its many enhanced traits, making it common to find calves whose grandmothers have exceeded 14 calves in their productive life.

Other characteristics [edit]

In addition to dams with good productive potential in their environment, and good growth rate of calves at weaning and post-weaning, other traits of this breed that highlight further advantages in the overall productivity in the warm tropics are:

  • Calving ease
  • Good birth rate
  • Strength and foraging ability
  • Maternal ability and viability
  • Solar Erythema, photosensitisation, and cancer resistance
  • Tolerance to Boophilus microplus tick and other internal and external parasites
  • Rigorous control of lethal and semilethal genes
  • Resistance to tropical diseases
  • Excellent type and conformation
  • Docility and tameness
  • Low maintenance cost.

Also, Frankeston bulls are chosen to be mated with different crossed cows f1 because it maintains the levels of hybrid vigor retained in future generations. It also prevent the harmful increase (%) in inheritance of Bos Taurus or Bos Indicus genes; and because it can improve production in the new generations f2, f3, etc.

Conclusions and recommendations [edit]

Frankeston is an ideal breed for sustained agricultural production that will make possible the farmer his dignified stay in the agricultural field. With this new breed is being provided a solution for the production of animal protein in the warm tropical environment.

It is recommended to continue with this process of multiplication and permanent improvement of this biological prototype in the rebreeding centers in the region of study and the country, to subsequently proceed to its dissemination in all the tropical countries of Latin American and Caribbean.

See also [edit]

References [edit]

  • Restom, Francisco (1996). Ganadería, herencia y doble propósito. Bogota, III Scientific Convention, Universidad de Cartagena, 2003: Produmedios. ISBN 958-33-4564-4. 
  • Restom, Francisco (2010). Ganadería de doble propósito Siglo XXI en los trópicos. Bogota: Ecoe ediciones. ISBN 978-958-648-680-4. 
  • Gómez, Alberto; Briceño, Ignacio; Bernal, Jaime (2007). Frankeston: una nueva raza de ganado bovino para el trópico colombiano. En hereditas diversitas et variatio. Aproximación a la historia de la genética humana en Colombia. Bogotá Universidad Pontificia Javeriana: Universidad Pontificia Javeriana. ISBN 978-958-683-943-3. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Grubb (in Wilson and Reeder 2005) for a discussion of the relationships and taxonomy of Bos taurus, B. primigenius, and B. indicus, here regarded as conspecific.

Woodward and Sponenberg (1992) specified any remaining cattle in Okefenokee Swamp and possibly the cattle on Hawaii as important stores of genetic variation.

See Georgiadis et al. (1991) for a phylogeny of the Bovidae based on allozyme divergence among 27 species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!