Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Distributed worldwide in domestication. Feral populations occur on Kauai, Molokai, and Hawaii, Hawaiian Islands; see Tomich (1986) and Kramer (1971) for extensive accounts of historical and current status in Hawaii; Spain; France; Australia; New Guinea; U.S.; Colombia; Argentina; Galapagos; Hispaniola; Tristan da Cunha; New Amsterdam; and Juan Fernandez Islands (Grubb, in Wilson and Reeder 1993). The Eurasian-North African progenitor of domestic cattle is extinct.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Like most domestic animals, Bos taurus (domestic cow) is currently found throughout much of the world. The wild ancestors of cows were native to northern Africa, Europe, and southern Asia.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Introduced , Native ); neotropical (Introduced ); australian (Introduced )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Domestic cows are large, sturdy animals. Weight ranges from 147 kilograms to 1363 kilograms, and height from 49-52 inches. The body is covered in short hair, the color of which varies from black through white, reddish brown, and brown. Domestic cows have short necks with dewlaps hanging below the chin. They have two hollow horns and a long tufted tail. They can be used as working animals for plowing and moving heavy loads. Domestic cows have no upper incisors, instead they have a thick layer called the dental pad. The jaws are designed for the circular grinding motion used to crush coarse vegetation. (Rath 1998; Walker et al. 1975 Reprogen 1997)

Range mass: 147 to 1363 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Average basal metabolic rate: 306.77 W.

  • Rath, S. 1998. The Complete Cow. Vancouver, B.C: Raincoast Book.
  • Walker, E., F. Warnick, S. Hamlet, K. Lange, H. Uible. 1975. Mammals Of The World. London: THe Johns Hopkins University Press.
  • Reprogen, 1997. "Domestic Cattle" (On-line). Accessed October 6th, 2000 at http://www.hensonrobinsonzoo.org/p001.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Domestic cows are common and can be found throughout the world. Cattle are born and raised on rangelands. Rangelands are unfertilized, uncultured, and not irrigated. Also, they must contain adequate areas for grazing.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Domestic cows feed on grasses, stems, and other herbaceous plant material. An average cow can consume about 70kg of grass in an 8 hour day. Cows twist grasses around the tongue and cut them with their lower teeth. Domestic cows are ruminants. Ruminants have a special system of digestion which allows for the breakdown of the relatively indigestible plant material which they consume. Cows have a four chambered stomach including a rumen, reticulum, omasum, and abomasum. Grass passes through the rumen where it is mixed with specialized bacteria. From the rumen it moves to the reticulum, where it is broken down further. The partly digested food, known as cud, is regurgitated and chewed. It is then swallowed and moves into the omasum and abomasum, where digestive enzymes break it down further and nutrients are absorbed. The process of digestion takes 70-100 hours, one of the slowest passage rates of all animals. This method of digestion permits ruminants to obtain the most nutrients possible from these plant materials.

(Rath 1998; Hindsaw 1993; Walker et al. 1975)

Plant Foods: leaves; roots and tubers; wood, bark, or stems

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Animal / pathogen
Actinomyces bovis infects jaw of Bos taurus (domestic)

Plant / resting place / within
imago of Aphodius coenosus may be found in dung of Bos taurus (domestic)

Plant / resting place / within
imago of Aphodius foetens may be found in dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung/debris feeder
larva of Aphodius fossor feeds on dung/debris dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung/debris feeder
larva of Aphodius granarius feeds on dung/debris dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung/debris feeder
larva of Aphodius haemorrhoidalis feeds on dung/debris dung of Bos taurus (domestic)
Other: major host/prey

Plant / resting place / within
imago of Aphodius obliteratus may be found in dung of Bos taurus (domestic)

Animal / dung/debris feeder
larva of Aphodius prodromus feeds on dung/debris dung of Bos taurus (domestic)
Other: unusual host/prey

Plant / resting place / within
imago of Aphodius putridus may be found in dung of Bos taurus (domestic)

Animal / dung/debris feeder
larva of Aphodius scrofa feeds on dung/debris dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
partly immersed perithecium of Arnium caballinum is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
perithecium of Arnium hirtum is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
perithecium of Arnium macrotheca is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
perithecium of Arnium olerum is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Ascobolus albidus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Ascobolus boudieri is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Ascobolus elegans is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Ascobolus equinus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Ascobolus immersus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
thick-stalked apothecium of Ascobolus lignatilis is saprobic in/on dung or excretions of manure heap of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Ascobolus roseopurpurascens is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Ascobolus stercorarius is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Ascobolus stictoideus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Ascophanus cinerellus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung associate
larva of Azelia nebulosa inhabits dung of Bos taurus (domestic)

Animal / pathogen
Blue Tongue virus (BTV) infects Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
basally immersed, mostly densely clustered perithecium of Cercophora coprophila is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
basally immersed, scattered or in small groups perithecium of Cercophora mirabilis is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
solitary or gregarious, sessile apothecium of Cheilymenia fimicola is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
sessile apothecium of Cheilymenia pulcherrima is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Cheilymenia raripila is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
solitary or gregarious, sessile apothecium of Cheilymenia stercorea is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Conocybe coprophila is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Conocybe farinacea is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinellus pellucidus is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)
Other: major host/prey

In Great Britain and/or Ireland:
Animal / dung saprobe
fruitbody of Coprinellus sassii is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinopsis cothurnata is saprobic in/on dung or excretions of straw-mixed dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinopsis filamentifer is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinopsis nivea is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
fruitbody of Coprinopsis pachysperma is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
fruitbody of Coprinopsis pseudofriesii is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinopsis pseudonivea is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinus foetidellus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinus poliomallus is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Coprinus xenobius is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
sessile, often in large groups apothecium of Coprobia granulata is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Coprotus albidus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Coprotus aurora is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Coprotus granuliformis is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Coprotus lacteus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Coprotus niveus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Coprotus ochraceus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
sessile apothecium of Coprotus sexdecimsporus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
pseudothecium of Delitschia canina is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
pseudothecium of Delitschia niesslii is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
pseudothecium of Delitschia patagonica is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
pseudothecium of Delitschia winteri is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: minor host/prey

Animal / parasite / ectoparasite / blood sucker
Dermacentor reticulatus sucks the blood of Bos taurus (domestic)

Animal / parasite / endoparasite
hydatid cyst of Echinococcus granulosus endoparasitises brain of Bos taurus (domestic)

Animal / dung associate
larva of Eudasyphora cyanella inhabits dung of Bos taurus (domestic)
Other: sole host/prey

Animal / pathogen
Foot and Mouth virus (FMD) infects Bos taurus (domestic)
Other: major host/prey

Animal / parasite / ectoparasite / blood sucker
Haemaphysalis punctata sucks the blood of Bos taurus (domestic)

Animal / associate
imago of Haematobia irritans is associated with horn (base) of Bos taurus (domestic)
Other: sole host/prey

Plant / resting place / within
ovum of Haematobosca stimulans may be found in almost fresh dung of Bos taurus (domestic)
Other: sole host/prey

Animal / dung associate
larva of Helina impuncta inhabits dung of Bos taurus (domestic)

Animal / parasite / ectoparasite
adult of Hippobosca equina ectoparasitises Bos taurus (domestic)
Other: minor host/prey

Animal / dung associate
larva of Hydrotaea tuberculata inhabits dung of Bos taurus (domestic)

Animal / parasite / ectoparasite / blood sucker
Ixodes ricinus sucks the blood of Bos taurus (domestic)

Animal / dung saprobe
Scopulariopsis anamorph of Kernia nitida is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
Lasiobolus diversisporus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / parasite / endoparasite
larva of Linguatula serrata endoparasitises lymph node of Bos taurus (domestic)

Animal / dung associate
larva of Mesembrina meridiana inhabits dung of Bos taurus (domestic)
Other: sole host/prey

Animal / dung associate
larva of Morellia hortorum inhabits dung of Bos taurus (domestic)
Other: sole host/prey

Animal / dung associate
larva of Morellia simplex inhabits dung of Bos taurus (domestic)
Other: sole host/prey

Animal / dung associate
larva of Musca autumnalis inhabits dung of Bos taurus (domestic)

Animal / dung/debris feeder
gymnothecium of Myxotrichum chartarum feeds on dung/debris rotting leather of Bos taurus (domestic)

Plant / resting place / under
imago of Odonteus armiger may be found under dry dung of Bos taurus (domestic)

Animal / dung/debris feeder
larva of Onthophagus vacca feeds on dung/debris buried dung of Bos taurus (domestic)

Animal / carrion / dead animal feeder
ascoma of Onygena equina feeds on dead hoof of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Panaeolus semiovatus var. semiovatus is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
apothecium of Peziza badiofusca is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sessile apothecium of Peziza bovina is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
substipitate or sessile apothecium of Peziza fimeti is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
colony of Oedocephalum anamorph of Peziza vesiculosa is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
immersed perithecium of Phomatospora coprophila is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sporangiophore of Pilaira anomala is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
sporangiophore of Pilaira moreaui is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / parasite
Pityrosporum anamorph of Pityrosporum pachydermatis parasitises Bos taurus (domestic)

Animal / dung/debris feeder
Podops inuncta feeds on dung/debris dung of Bos taurus (domestic)
Remarks: Other: uncertain

Animal / dung saprobe
superficial perithecium of Podospora appendiculata is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora communis is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
perithecium of Podospora conica is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora decipiens is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
partly immersed perithecium of Podospora ellisiana is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora fimiseda is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora globosa is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora granulostriata is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora intestinacea is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora myriospora is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora pauciseta is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora perplexens is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora pleiospora is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora pyriformis is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Podospora setosa is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung associate
larva of Polietes lardaria inhabits dung of Bos taurus (domestic)
Other: sole host/prey

Animal / dung saprobe
stalked stroma of Poronia punctata is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Psathyrella coprophila is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Psathyrella hirta is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Psathyrella scatophila is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Psathyrella sphaerocystis is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Psathyrella stercoraria is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
solitary, gregarious to subcaespitose fruitbody of Psathyrella tenuicola is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Psilocybe moelleri is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)
Other: major host/prey

Animal / dung saprobe
fruitbody of Psilocybe subcoprophila is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)

Animal / pathogen
redwater disease protozoan infects erythrocyte of Bos taurus (domestic)

Animal / associate
larva of Rhingia campestris is associated with rotting dung of Bos taurus (domestic)

Animal / parasite / ectoparasite / blood sucker
Rhipicephalus sanguineus sucks the blood of Bos taurus (domestic)

Animal / dung saprobe
densely crowded apothecium of Ryparobius brunneus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
solitary or gregarious, superficial, sessile apothecium of Saccobolus citrinus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus depauperatus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
solitary or gregarious, superficial, sessile apothecium of Saccobolus glaber is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus versicolor is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / rests in
cyst of Sarcocystis rests inside striated muscle of Bos taurus (domestic)

Animal / carrion / dead animal feeder
fruitbody of Schizophyllum commune feeds on dead dead leather of Bos taurus (domestic)
Other: unusual host/prey

Animal / dung saprobe
perithecium of Schizothecium aloides is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
perithecium of Schizothecium hispidulum is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
perithecium of Schizothecium pilosum is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
stromatic perithecium of Selinia pulchra is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
gregarious perithecium of Sordaria alcina is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
gregarious perithecium of Sordaria fimicola is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
perithecium of Sordaria minima is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Sphaerobolus stellatus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
partly immersed perithecium of Sphaeronaemella fimicola is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella australis is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella borealis is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella grandispora is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella intermedia is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella leporina is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella minima is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella nigropurpurea is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella pascua is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella pulchella is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
synnema of Stilbella anamorph of Stilbella erythrocephala is saprobic in/on dung or excretions of dung of Bos taurus (domestic)
Other: minor host/prey

Animal / dung associate
larva of Stomoxys calcitrans inhabits dung of Bos taurus (domestic)

Animal / parasite / endoparasite
Cysticercus larva of Taenia hydatigena endoparasitises body cavity of Bos taurus (domestic)

Animal / parasite / endoparasite
cyst of Taenia saginata endoparasitises muscle of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Thecotheus pelletieri is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
gregarious, sometimes confluent apothecium of Thelebolus crustaceus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
gregarious apothecium of Thelebolus microsporus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Thelebolus nanus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
scattered or gregarious, sessile apothecium of Thelebolus polysporus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
apothecium of Thelebolus stercoreus is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Animal / dung saprobe
fruitbody of Tubaria romagnesiana is saprobic in/on dung or excretions of weathered dung of Bos taurus (domestic)
Other: unusual host/prey

Animal / dung saprobe
perithecium of Zygospermella insignis is saprobic in/on dung or excretions of dung of Bos taurus (domestic)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Cows modify environments through grazing. In areas where their population numbers are artificially increased by humans, they can severely impact natural systems, causing erosion, introduction of non-native grasses and herbaceous plants, destruction of riparian habitats, and overgrazing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

The wild ancestors of domestic cows were likely preyed on by large carnivores such as wolves, lions, humans, and bears. The majority of predation would have been on calves or sick and elderly individuals. Currently cows are sometimes preyed on by large, wild carnivores but the vast majority of predation is by humans. Their large size and herding behavior would have provided protection against predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Bos taurus is prey of:
Homo sapiens
Canis lupus
Panthera leo

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

There are several diseases that domestic cows are prone to, but mastitis is a disease on a rampage.  Mastitis is a mammary gland infection that damages the teat and udder.  Clinical symptoms include inflammation, pain, and clotting of the milk in the infected quarter.  One study showed that while testing for mastitis, 39.3 percent of lactating cows had at least one infected quarter (Tebug et al., 2012).  Mastitis is the most common disease in dairy cattle and the most costly to farmers and the dairy industry (Hammami et al., 2013; Tebug et al., 2012). The average cost of mastitis per cow is $179, which is composed of the cost of treatment, loss of milk production, and death expenses (Bar et al., 2008).  Cows that are housed in clean stables with dry ground and fresh bedding are not as susceptible to get mastitis as opposed to cows that are housed on wet and dirty concrete floors (Tebug et al., 2012). When pens do not get cleaned properly, the bedding accumulates manure, urine, and several other types of moisture that create an excellent environment for bacteria to grow.  Wet concrete floors and overpopulated stables are a great milieu for many different pathogens.  The most common pathogen for mastitis is staphylococci bacteria (Graber et al., 2013).  Mastitis is an immune response to bacteria invading the teat canal. The bacteria damages the tissue linings of the teats.  Once a cow has been subject to mastitis, she is more likely to get it again, especially during the rainy season (Tebug et al., 2012).

  • Tebug S, Njunga G, Chagunda M, Wiedermann S (2012) Health constraints and farm management factors influencing udder health of dairy cows in Malawi. Journal of Agricultural Science 4, 136-141.
  • Graber H, Pfister S, Burgener P, Boss R, Meylan M, Hummerjohann, J (2013) Bovine Staphylococcus aureus: diagnostic properties of specific media. Research in Veterinary Science 95, 38-44.
  • Hammami R, Fernandez B, Lacroix C, Fliss I (2013) Anti-infective properties of bacteriocins: an update. Cellular and Molecular Life Sciences 70, 2947-2967.
  • Bar D, Tauer L, Bennett G, González R, Hertl J, Schukken Y, Schulte H, Welcome F, Gröhn Y (2008) The cost of generic clinical mastitis in dairy cows as estimated by using dynamic programming. Journal of Dairy Science. 91, 2205-14.
Creative Commons Attribution 3.0 (CC BY 3.0)

© jeneilboles

Supplier: jeneilboles

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Cows communicate via chemical signals, touch, visual cues, and sounds. They perceive their environment primarily using the same set of senses.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Maximum lifespan in domestic cows may exceed 20 years. However, lifespan is often limited by human culling.

Range lifespan

Status: captivity:
>20 (high) years.

Typical lifespan

Status: captivity:
20 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20 years (captivity) Observations: Estimating the maximum longevity of domestic cattle is troublesome since there are many conflicting reports. Females appear to remain fertile for about 12 years, and animals have been known to live over 20 years (Ronald Nowak 1999). Most likely, animals can live over 20 years and there are even anecdotal reports of a cow called "Big Bertha" that lived nearly 49 years. Lastly, there are unverified reports that miniature cattle live longer than normal animals.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Domestic cows are social animals and live in groups called herds. Each herd is led by a dominant male who is the sole male to mate with the rest of the females.

Mating System: polygynous

Mating may occur year round, though more calves are born in spring months. One calf is born after approximately nine months of gestation. Young Bos taurus are preocial, they learn to recognize their mother and are able to stand and walk soon after birth. Young domestic cows nurse for approximately six months. Females reach sexual maturity at approximately one year and mating can continue to about twelve years.

(Hindsaw 1993; Walker et al. 1975; Huffman 2000)

Breeding interval: Cattle tend to reproduce once yearly.

Breeding season: Breeding occurs throughout the year.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Average gestation period: 9 months.

Average weaning age: 6 months.

Average time to independence: 12 months.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous

Average gestation period: 277 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
548 days.

Young are nursed by their mother for approximately 6 months and become independent during the following 6 months.

Parental Investment: altricial ; female parental care

  • Hinshaw, D. 1993. Cattle. Minneapolis: Carolrhoda Books, Inc.
  • Walker, E., F. Warnick, S. Hamlet, K. Lange, H. Uible. 1975. Mammals Of The World. London: THe Johns Hopkins University Press.
  • Huffman, B. January 1st, 2000. "Artiodactyla" (On-line). Accessed November 22, 2000 at http://www.ultimateungulate.com.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bos taurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 178 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGACTATTCTCAACCAACCATAAAGATATTGGTACCCTTTATCTACTATTTGGTGCTTGGGCCGGTATAGTAGGAACAGCTCTAAGCCTTCTAATTCGCGCTGAATTAGGCCAACCCGGAACTCTGCTCGGAGACGACCAAATCTACAACGTAGTTGTAACCGCACACGCATTTGTAATAATCTTCTTCATAGTAATACCAATCATAATTGGAGGATTCGGTAACTGACTTGTTCCCCTAATAATTGGTGCTCCCGATATAGCATTTCCCCGAATAAATAATATAAGCTTCTGACTCCTCCCTCCCTCATTCCTACTACTCCTCGCATCCTCTATAGTTGAAGCTGGGGCAGGAACAGGCTGAACCGTGTACCCTCCCTTAGCAGGCAACCTAGCCCATGCAGGAGCTTCAGTAGATCTAACCATTTTCTCTTTACACTTAGCAGGAGTTTCCTCAATTTTAGGAGCCATCAACTTCATTACAACAATTATCAACATAAAGCCCCCCGCAATGTCACAATACCAAACCCCTCTGTTCGTATGATCCGTAATAATTACCGCCGTACTACTACTACTCTCGCTCCCTGTATTAGCAGCCGGCATCACAATGCTATTAACAGACCGGAACCTAAATACAACCTTCTTCGACCCGGCAGGAGGAGGAGACCCTATTCTATATCAACACTTATTCTGATTCTTTGGACACCCCGAAGTCTATATTTTAATCTTACCTGGGTTTGGAATAATCTCTCATATCGTGACCTACTACTCAGGAAAAAAAGAACCATTCGGATATATGGGAATAGTTTGGGCTATAATGTCAATCGGATTTCTAGGTTTCATCGTATGAGCCCACCATATATTCACTGTCGGAATAGACGTCGACACACGAGCCTACTTCACATCAGCCACTATAATTATTGCTATTCCAACCGGGGTAAAAGTCTTCAGCTGATTGGCAACACTTCATGGAGGTAATATCAAATGGTCTCCTGCTATAATGTGAGCCCTAGGCTTTATTTTCTTATTTACAGTAGGGGGTTTAACTGGAATTGTCTTAGCCAACTCTTCCCTCGATATTGTTCTTCACGACACATACTACGTTGTCGCACATTTCCACTATGTTTTATCAATAGGAGCTGTATTTGCTATTATAGGGGGATTTGTTCATTGATTCCCACTATTCTCAGGTTATACTCTCAACGATACATGAGCCAAAATCCACTTCGCAATTATATTTGTAGGCGTCAATATAACCTTCTTCCCACAACACTTTCTAGGACTATCTGGCATGCCTCGACGATACTCCGACTACCCAGATGCATACACAATATGAAATACTATCTCATCAATAGGCTCATTCATTTCCCTAACAGCAGTTATACTAATAGTTTTCATCATCTGAGAAGCATTTGCATCTAAACGAGAAGTCTTGACTGTAGACTTAACCACGACAAATCTAGAATGATTAAACGGATGCCCTCCACCATATCACACATTTGAAGAACCCACCTATGTTAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bos taurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 240
Specimens with Barcodes: 418
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There is some interest in conserving rapidly disappearing rare breeds and breeds that may have desirable qualities, such as Texas longhorn cattle and a number of older European breeds. However, as a species, cattle are not threatened.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

A negative aspect of domestic cattle husbandry is the transmissible spongiform encephalopathy, Bovine Spongiform Encephalopathy, better known as Mad Cow Disease. An outbreak in British cattle has caused international concern and resulted in multiple human infections. Mad Cow Disease is a fatal degenerative brain disease, which is caused by a protein known as a prion. In humans, the equivalent of bovine spongiform encephalopaty is Creutzfeldt-Jakob Disease ("CJD"), which causes a rapid dementia, and neurological damage leading to death. The disease is now believed to be linked to eating beef from infected cows. This disease has killed many people in Europe, therefore causing a ban on all importation of British beef by European countries.

In addition, range cattle are responsible for the transmission of diseases to native wildlife and rapid, and sometimes irreversible, damage to natural ecosystems.

(Brown 1996)

Negative Impacts: injures humans (carries human disease); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Domestic cows are used widely by humans for a variety of purposes. Cows are used primarily for dairy products (milk, cheese, etc.) and meat. They are also used for things such as medicines, glue, soap, and leather. Males are used for pulling large loads or for plowing the soil because of their large size and strength. The dung is a good source of fertilizer and fuel. Cows are also often important culturally and as a form of currency. (Rath 1993; Hindsaw 1998; Encyclopedia Britannica Online 2000)

Positive Impacts: food ; body parts are source of valuable material; source of medicine or drug ; research and education; produces fertilizer

  • 1999-2000. "Britannica.com" (On-line). Accessed October 6th, 2000 at www.britannica.com.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: Cattle may counteract efforts to protect native plants: grazing suppresses reproduction of koa in Hawaii (Baldwin and Fagerlund 1943). See Cuddihy (1984) for more information on effects of grazing on native Hawaiian flora.

See Loft et al. (1987) and Kie (1991) for information on the impacts of cattle grazing on mule deer in California. See Telfer (1994) for information on cattle-cervid interactions in Alberta. See Kochert et al. (1988) for effects of livestock grazing on raptors in the southwestern U.S. See also Uresk and Paulson (1988), Oldemeyer et al. (1988), and Samson et al. (1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Frankeston

The Frankeston Red is a genetically improved bovine cattle, its creation focus was for it to be a dual-purpose cattle to be used as both dairy and beef cattle.

History of the breed[edit]

The Frankeston Red is the first breed of cattle in the world created in the 21st Century by the scientist director of the Frankeston project, Dr. Francisco A. Restom Bitar; a specialist in human and animal genetics, and his team at the Bovine Genetic Experimental Center Remanso Caribe (Centro de Experimentación Genética Bovina Remanso Caribe in Spanish) located in the municipality of Arjona, Colombia, in the vicinity of Cartagena de Indias.

Restom started his genetic experiments in the middle of the year 1984, combining strategic and orderly in vivo chromosomes the native races x Cebu with semen of purebreds and their subsequent mating inter se to create the Frankeston breed, a cattle race biologically adapted for adverse conditions of the warm tropics, capable of producing more milk and more meat (dual purpose), surpassing not only the performance of every other breed, but also of crossed foreign cattle throughout the Caribbean region.

The scientist published his work during the first quarter of 2001 and the breed was officially introduced by the end of 2003 in the III Scientific Convention of the University of Cartagena, an institution that through a cooperation agreement evaluated in situ the last 3 years of research and endorsed the results of the work done with the breed.

This breed was born from a desperate search for a sustainable and profitable solution to the repeated failure of foreign cattle to produce properly in the region due to the environmental conditions of the tropics, and their indiscriminate use in crosses carried out without control, without order, goals, or scientific studies throughout history.

It is a new biotype of dual-purpose bovine (milk and meat), more efficient and biologically resistant to heat, high solar radiation, and tropical diseases. A breed created to lessen the ecological and economic cost that has represented Colombia's needs to import genetic material, incalculable losses due to productivity, and progressive deterioration of farmers in the society.

The work has also been successfully submitted in other conventions such as the First Congress and V Scientific Convention of the University of Panama (2004), and III International Congress and IV National Congress of Human Genetics at Universidad del Norte in Barranquilla, Colombia (2004).

The creation of the Frankeston breed has been a long and complex work and has required the application of the scientific method, mathematics, planning, and execution. All of them adjusted to the principles and laws of genetics.

Methodology[edit]

In each of the stages of crosses to achieve genetic recombination that gave rise to the F1, F2, F3 and F4 and following, the scientist carried out biometric analysis, he confronted the development and general biological behavior of animals, and verified that the best genes of adaptation, milk and meat production, were inheriting from the different races and through gene interaction of them, had created the prototype which was planned based on the best phenotypic features of its predecessors, constituting, finally, the Frankeston race.

Once the prototype was obtained, the scientist proceeded to do successive chromosomal recombination inter se, in other words, to mate female and male Frankeston to form the F5, F6, etc.

That way the new breed consolidated the traits pursued throughout the investigation, indicating that the genes have been set by the phenomenon of interbreeding that allowed a genetic linkage resulting in the creation of the new breed Frankeston.

Racial pattern[edit]

In the coat or fur of the race is the predominant red colour

(95%). This allows filtering UV rays protecting the animal of solar erythema. It is covered by hair very short and fine, a quality of cattle adapted to the tropics. Dewlap of regular size, wrinkled and gently attached. Hump of medium size in the bulls and superficial in females. Height at wither medium. Body enlarged with fine bones, compact and balanced. Its dorsal line is straight and strong. Good thoracic depth. Very good limbs, provided with strong, high, and pigmented hooves, very suitable to withstand humidity and long journeys.

The sire is very vigorous, masculine, and very sexually active. Testicles are very well shaped and of good size. And the cow's mammary system has a glandular udder, good size, quite firm and well irrigated.

Productive advantages[edit]

The females have in their first lactation good productions improving in the second the average of the average of 2,580 kg. per lactation in 313 days as one of the breed's trait is high productive periods.

These productions are 338% above the regional milk production, and +28% in meat production, surpassing not only the performance of the other breeds, but also to all crossings with foreign cattle that are milked in the Caribbean region.

The production of this race is clean, organic, obtained in the regime of foraging tropical pastures and managed without the administration of hormones, animal waste products, or antibiotics.

Milk production curve

It also responds generously when the environmental conditions involved in production and reproduction are improved. Cows that are daughters of Frankeston bulls by natural mating have produced up to 28.1 kg. of milk a day and over 4.800 kg. per lactation, and many of the males come to increase about 1.000 grams of weight a day when they are given the right nutritional and handling conditions to not limit them their potential.

The prediction of the total milk production of cows of the Frankeston breed in the second and third delivery through the registry of performance at the peak of lactation, yields for this breed a total estimated production of 6.750 kg in a lactation of 313 days for a peak of 28 kg./day and 6000 kg. to a peak of 25 kg./day.(Factor 0.416 was used for this breed).

The peak presented itself between 50 and 75 days after delivery. More information about these investigations can be found in the work "Dual purpose livestock of the XXI Century in the tropics".

Female Frankeston show more fertility, its productive longevity and durability are one of its many enhanced traits, making it common to find calves whose grandmothers have exceeded 14 calves in their productive life.

Other characteristics[edit]

In addition to dams with good productive potential in their environment, and good growth rate of calves at weaning and post-weaning, other traits of this breed that highlight further advantages in the overall productivity in the warm tropics are:

  • Calving ease
  • Good birth rate
  • Strength and foraging ability
  • Maternal ability and viability
  • Solar Erythema, photosensitisation, and cancer resistance
  • Tolerance to Boophilus microplus tick and other internal and external parasites
  • Rigorous control of lethal and semilethal genes
  • Resistance to tropical diseases
  • Excellent type and conformation
  • Docility and tameness
  • Low maintenance cost.

Also, Frankeston bulls are chosen to be mated with different crossed cows f1 because it maintains the levels of hybrid vigor retained in future generations. It also prevent the harmful increase (%) in inheritance of Bos Taurus or Bos Indicus genes; and because it can improve production in the new generations f2, f3, etc.

Conclusions and recommendations[edit]

Frankeston is an ideal breed for sustained agricultural production that will make possible the farmer his dignified stay in the agricultural field. With this new breed is being provided a solution for the production of animal protein in the warm tropical environment.

It is recommended to continue with this process of multiplication and permanent improvement of this biological prototype in the rebreeding centers in the region of study and the country, to subsequently proceed to its dissemination in all the tropical countries of Latin American and Caribbean.

See also[edit]

References[edit]

  • Restom, Francisco (1996). Ganadería, herencia y doble propósito. Bogota, III Scientific Convention, Universidad de Cartagena, 2003: Produmedios. ISBN 958-33-4564-4. 
  • Restom, Francisco (2010). Ganadería de doble propósito Siglo XXI en los trópicos. Bogota: Ecoe ediciones. ISBN 978-958-648-680-4. 
  • Gómez, Alberto; Briceño, Ignacio; Bernal, Jaime (2007). Frankeston: una nueva raza de ganado bovino para el trópico colombiano. En hereditas diversitas et variatio. Aproximación a la historia de la genética humana en Colombia. Bogotá Universidad Pontificia Javeriana: Universidad Pontificia Javeriana. ISBN 978-958-683-943-3. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Grubb (in Wilson and Reeder 2005) for a discussion of the relationships and taxonomy of Bos taurus, B. primigenius, and B. indicus, here regarded as conspecific.

Woodward and Sponenberg (1992) specified any remaining cattle in Okefenokee Swamp and possibly the cattle on Hawaii as important stores of genetic variation.

See Georgiadis et al. (1991) for a phylogeny of the Bovidae based on allozyme divergence among 27 species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!