Overview

Distribution

West Caucasian turs are native only to the western Caucasus Mountains in Georgia and south-western Russia ("Protected Areas Program" 2001).

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Body length for adult males is between 120 and 165 cm, with shoulder height between 78 and 109 cm. Horns of West Caucasian tur average 75 cm and occur in both males and females. They are scimitar-shaped, ridged, and appear as rounded triangles in cross-sections. Their pelage is "rusty gray to rusty chestnut, becoming lighter in the flanks" (Nowak 1991). The legs are dark brown. Males have a small beard under the chin. Tail length ranges from 10 to 14 cm (Nowak 1991).

Range mass: 65 to 100 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: ornamentation

  • Nowak, R. 1991. Walker's Mammals of the World. Baltimore: Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

West Caucasian turs have one of the smallent habitats of all ungulates. They are native only to about 4,500 square kilometers in the western Caucasus Mountains. They live in elevations ranging from 800 to 4,200 meters. Forests are found leading up to 2,000 meters. Above this, there are alpine meadows and rocky talus slopes. Elevations above 2,900 meters are permanantly snow-covered (Huffman 2000; "Protected Areas Program" 2001).

Terrestrial Biomes: taiga ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

West Caucasian turs are herbivorous. In summer their diet consists of a wide variety of plants and grasses. They tend to feed in the morning, rest in the heat of early afternoon, then feed again in late afternoon and evening. In winter their diet contains the leaves of trees and shrubs and they graze in open pastures throughout the day. Turs have been known to travel as much as 20 km a day if their resting and feeding sites are separated (Nowak 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
19.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.3 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The mating season for West Caucasian turs lasts from late November to early January. Males fight aggressively during this season over females. Gestation lasts for 150 to 160 days. There is usually only one young born, rarely two, which average 3.5 to 4.2 kg at birth. Although young kids starts eating grass at about one month old, they are not weaned until three months old. Sexual maturity is reached at about two years old in females and five years old for males. Life expectancy is 12 to 13 years (Grzimek 1990; Nowak 1991).

Range number of offspring: 1 to 2.

Average number of offspring: 1.08.

Range gestation period: 5 to 5.33 months.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual

Average birth mass: 3850 g.

Average number of offspring: 1.

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Capra caucasica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGACTATTTTCAACCAACCACAAAGACATTGGCACCCTCTACCTTCTGTTCGGTGCCTGAGCTGGTATAGTAGGGACCGCCTTAAGCTTACTAATTCGCGCCGAACTAGGTCAACCCGGAACCCTACTTGGAGATGACCAGATCTACAATGTAATTGTAACTGCACACGCATTCGTAATAATTTTCTTTATAGTAATACCTATTATGATTGGAGGGTTTGGCAACTGACTAGTCCCCCTAATAATTGGAGCCCCCGACATAGCATTTCCTCGGATAAATAATATAAGCTTCTGACTCCTTCCCCCCTCCTTCCTATTACTTCTAGCATCCTCTATAGTTGAAGCCGGAGCAGGAACAGGTTGAACCGTGTATCCTCCTCTAGCAGGTAATTTAGCCCATGCAGGAGCCTCAGTAGACCTAACTATTTTCTCCCTACACCTAGCAGGCATCTCTTCAATTCTAGGAGCCATTAATTTTATCACAACCATCATTAATATAAAACCACCTGCAATATCACAGTATCAAACTCCCCTATTTGTGTGATCTGTCTTAATTACTGCCGTACTACTCCTCCTTTCACTTCCTGTATTAGCAGCTGGCATCACAATACTACTAACAGACCGAAACCTAAACACAACCTTCTTTGACCCAGCAGGAGGAGGAGACCCTATTTTATATCAACACCTATTCTGATTCTTTGGACACCCTGAAGTATATATTCTTATTTTACCTGGATTTGGAATAATCTCCCACATCGTAACCTATTACTCAGGGAAAAAAGAACCATTCGGGTACATAGGAATAGTATGAGCCATAATATCAATCGGATTTCTAGGATTTATTGTATGAGCCCACCATATATTTACAGTCGGAATAGACGTCGATACACGGGCTTACTTCACATCAGCTACCATAATTATCGCTATCCCAACTGGAGTAAAAGTCTTCAGTTGATTAGCAACACTTCACGGAGGCAATATCAAATGGTCCCCCGCCATGATATGAGCCCTAGGCTTCATCTTCCTTTTTACAGTGGGAGGCTTAACTGGAATTGTTTTAGCTAACTCGTCTCTTGATACTGTTCTCCACGACACATACTATGTAGTAGCTCATTTTCACTACGTTCTATCAATAGGAGCTGTGTTCGCCATCATAGGAGGATTCGTACACTGATTTCCCCTATTCTCAGGCTACACTCTTAATGATACATGAGCCAAAATCCACTTCGCAATTATATTTGTAGGTGTTAACATGACCTTCTTCCCACAACATTTCCTGGGGTTATCTGGTATACCACGACGATACTCTGATTACCCAGACGCATATACAATATGAAATACTATTTCATCTATAGGCTCATTCATTTCACTGACAGCAGTAATATTAATAATCTTTATTATCTGAGAAGCATTTGCATCCAAACGAGAGGTCCTAACTGTAGACCTAACCACAACAAATCTAGAGTGACTGAACGGATGCCCCCCACCATACCACACATTTGAAGAACCCACATACGTTACCCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Capra caucasica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Unregulated hunting in the early 1900's seriously threatened populations of West Caucasian turs. The creation of a nature preserve where they occur has enabled their numbers to increase slightly in recent years. The current population is estimated at under 10,000 (Nowak 1991).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

None known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

West Caucasian turs are popular trophies for hunters. Safaris make large amounts of money allowing hunters to kill these animals ("Safari and Expeditions" 2001).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

West Caucasian tur

The West Caucasian tur (Capra caucasica) is a mountain-dwelling goat-antelope found only in the western half of the Caucasus Mountains range.

West Caucasian turs stand up to 1 m (3.3 ft) tall at the shoulder and weigh around 65 kg (143 lb). They have large but narrow bodies and short legs. West Caucasian turs have a chestnut coat with a yellow underbelly and darker legs. Their horns are scimitar-shaped and heavily ridged. In males, these horns are around 70 cm (28 in), while in females they are much smaller.

West Caucasian turs live in rough mountainous terrain between 800 and 4,000 m (2,600 and 13,100 ft) above sea level, where they eat mainly grasses and leaves and are preyed upon by wolves and lynxes. They are nocturnal, eating in the open at night and sheltering during the day. Females live in herds of around 10 individuals, while males are solitary.

The wild population is estimated to be between 5,000 and 6,000 individuals.

See also[edit]

References[edit]

  1. ^ Weinberg, P. (2008). Capra caucasica. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 31 March 2009. Database entry includes a brief justification of why this species is of endangered.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!