Overview

Distribution

Range Description

This species is endemic to the western part of the Great Caucasus Mountains in Georgia and Russia. Its range stretches in a narrow stripe from Tchugush Mountain massif (apprroximately 44ºN, 39º45?E) to the Balkar Cherek River headwaters on the north slope and Inguri River headwaters on the south slope (appr. 43ºN, 42º50?E), just east of the Mount Elbrus massif (Dinnik, 1910; Heptner et al., 1961; Kotov, 1966; Tsalkin, 1955; Vereshchagin, 1959). The present length of the range hardly exceeds 250 km. The distribution reaches its maximal width near Mount. Elbrus ? up to 70 km. Thus, the range of the West Caucasian tur is the smallest one among all the genus Capra.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

West Caucasian turs are native only to the western Caucasus Mountains in Georgia and south-western Russia ("Protected Areas Program" 2001).

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Body length for adult males is between 120 and 165 cm, with shoulder height between 78 and 109 cm. Horns of West Caucasian tur average 75 cm and occur in both males and females. They are scimitar-shaped, ridged, and appear as rounded triangles in cross-sections. Their pelage is "rusty gray to rusty chestnut, becoming lighter in the flanks" (Nowak 1991). The legs are dark brown. Males have a small beard under the chin. Tail length ranges from 10 to 14 cm (Nowak 1991).

Range mass: 65 to 100 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: ornamentation

  • Nowak, R. 1991. Walker's Mammals of the World. Baltimore: Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The habitat and ecology of western and eastern tur do not differ noticeably. Western tur are more influenced by high precipitation and heavy snow cover. They mostly inhabit subalpine and alpine zones between 800 and 4,000 m asl. They rarely live in forests outside snowy season, probably because forest in the West Caucasus is composed predominantly of fir and spruce and forms closed stands. Where pine are more abundant, Western tur stay more readily in forests (Bobyr, 2002). During the region's harsh winters, tur concentrate on sunny slopes, with 30 to 80% of the animals staying below timberline; during the summer, tur expand their distribution to slopes of different exposures (Kotov, 1968; Bobyr, 2002).

At high population densities, summer herd size average 11.7 animals, while in winter this rises to 20.3 individuals (Kotov, 1968). Population densities in summer may reach 13 animals/km², more than tripling in wintering areas to 44 animals/km² (Kotov, 1968). The sex ratio usually favors females (Kotov, 1968; Bobyr, 2002; Romashin, 2001).

The rut lasts from mid-November until the beginning of January; birthing season takes place in May-July. Only one kid is born. One month after parturition, average proportion of kids is 13%, but yearlings only 5-9% (Bobyr, 2002; Kotov, 1968; Romashin, 2001; Zalikhanov, 1967). Western tur are preyed upon by wolf (Canis lupus) and lynx (Lynx lynx), but snow avalanches cause most natural deaths (Bobyr, 2002; Kotov, 1968; Zalikhanov, 1967). The leopard (Panthera pardus), while formerly a major predator of C. caucasica, is now very rare in the Caucasus.

Western tur coexist with chamois (Rupicapra rupicapra), dominating the latter throughout the year (Kotov, 1968; Romashin, 2001). The proportions of kids in the populations are mutually negatively correlated in both species, but more markedly so in chamois (Romashin, 2001). The diet of C. caucasica contains over a hundred recorded species of plants, especially grasses. In winter, animals often browse on pine, spruce and willow. Salt licks are visited mostly in the end of spring ? beginning of summer (Bobyr, 2002; Kotov, 1968; Zalikhanov, 1967).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

West Caucasian turs have one of the smallent habitats of all ungulates. They are native only to about 4,500 square kilometers in the western Caucasus Mountains. They live in elevations ranging from 800 to 4,200 meters. Forests are found leading up to 2,000 meters. Above this, there are alpine meadows and rocky talus slopes. Elevations above 2,900 meters are permanantly snow-covered (Huffman 2000; "Protected Areas Program" 2001).

Terrestrial Biomes: taiga ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

West Caucasian turs are herbivorous. In summer their diet consists of a wide variety of plants and grasses. They tend to feed in the morning, rest in the heat of early afternoon, then feed again in late afternoon and evening. In winter their diet contains the leaves of trees and shrubs and they graze in open pastures throughout the day. Turs have been known to travel as much as 20 km a day if their resting and feeding sites are separated (Nowak 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
19.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.3 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The mating season for West Caucasian turs lasts from late November to early January. Males fight aggressively during this season over females. Gestation lasts for 150 to 160 days. There is usually only one young born, rarely two, which average 3.5 to 4.2 kg at birth. Although young kids starts eating grass at about one month old, they are not weaned until three months old. Sexual maturity is reached at about two years old in females and five years old for males. Life expectancy is 12 to 13 years (Grzimek 1990; Nowak 1991).

Range number of offspring: 1 to 2.

Average number of offspring: 1.08.

Range gestation period: 5 to 5.33 months.

Average birth mass: 3850 g.

Average number of offspring: 1.

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Capra caucasica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGACTATTTTCAACCAACCACAAAGACATTGGCACCCTCTACCTTCTGTTCGGTGCCTGAGCTGGTATAGTAGGGACCGCCTTAAGCTTACTAATTCGCGCCGAACTAGGTCAACCCGGAACCCTACTTGGAGATGACCAGATCTACAATGTAATTGTAACTGCACACGCATTCGTAATAATTTTCTTTATAGTAATACCTATTATGATTGGAGGGTTTGGCAACTGACTAGTCCCCCTAATAATTGGAGCCCCCGACATAGCATTTCCTCGGATAAATAATATAAGCTTCTGACTCCTTCCCCCCTCCTTCCTATTACTTCTAGCATCCTCTATAGTTGAAGCCGGAGCAGGAACAGGTTGAACCGTGTATCCTCCTCTAGCAGGTAATTTAGCCCATGCAGGAGCCTCAGTAGACCTAACTATTTTCTCCCTACACCTAGCAGGCATCTCTTCAATTCTAGGAGCCATTAATTTTATCACAACCATCATTAATATAAAACCACCTGCAATATCACAGTATCAAACTCCCCTATTTGTGTGATCTGTCTTAATTACTGCCGTACTACTCCTCCTTTCACTTCCTGTATTAGCAGCTGGCATCACAATACTACTAACAGACCGAAACCTAAACACAACCTTCTTTGACCCAGCAGGAGGAGGAGACCCTATTTTATATCAACACCTATTCTGATTCTTTGGACACCCTGAAGTATATATTCTTATTTTACCTGGATTTGGAATAATCTCCCACATCGTAACCTATTACTCAGGGAAAAAAGAACCATTCGGGTACATAGGAATAGTATGAGCCATAATATCAATCGGATTTCTAGGATTTATTGTATGAGCCCACCATATATTTACAGTCGGAATAGACGTCGATACACGGGCTTACTTCACATCAGCTACCATAATTATCGCTATCCCAACTGGAGTAAAAGTCTTCAGTTGATTAGCAACACTTCACGGAGGCAATATCAAATGGTCCCCCGCCATGATATGAGCCCTAGGCTTCATCTTCCTTTTTACAGTGGGAGGCTTAACTGGAATTGTTTTAGCTAACTCGTCTCTTGATACTGTTCTCCACGACACATACTATGTAGTAGCTCATTTTCACTACGTTCTATCAATAGGAGCTGTGTTCGCCATCATAGGAGGATTCGTACACTGATTTCCCCTATTCTCAGGCTACACTCTTAATGATACATGAGCCAAAATCCACTTCGCAATTATATTTGTAGGTGTTAACATGACCTTCTTCCCACAACATTTCCTGGGGTTATCTGGTATACCACGACGATACTCTGATTACCCAGACGCATATACAATATGAAATACTATTTCATCTATAGGCTCATTCATTTCACTGACAGCAGTAATATTAATAATCTTTATTATCTGAGAAGCATTTGCATCCAAACGAGAGGTCCTAACTGTAGACCTAACCACAACAAATCTAGAGTGACTGAACGGATGCCCCCCACCATACCACACATTTGAAGAACCCACATACGTTACCCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Capra caucasica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2ad

Version
3.1

Year Assessed
2008

Assessor/s
Weinberg, P.

Reviewer/s
Festa-Bianchet, M. & Harris, R. (Caprinae Red List Authority)

Contributor/s

Justification
Listed as Endangered because of a serious population decline, estimated to be more than 50% over the last three generations (estimated at 21 years), inferred from an observed reduction in the number of mature individuals, especially due to over-harvesting.

History
  • 1996
    Endangered
  • 1994
    Rare
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Unregulated hunting in the early 1900's seriously threatened populations of West Caucasian turs. The creation of a nature preserve where they occur has enabled their numbers to increase slightly in recent years. The current population is estimated at under 10,000 (Nowak 1991).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total population estimate in the late 1980s was ca. 12,000 animals (Weinberg et al., 1997), but in recent years numbers have been declining significantly (P. Weinberg, unpubl. data). In 2001, numbers were estimated at 6,000-10,000 (Krever et al., 2001), but the latest available data indicate about 2,500 in the Caucasus Nature Reserve (Romashin, 2001), up to 1,000 animals in Teberda Nature Reserve, with probably few animals outside it (Bobyr, 2002), and approximately 1,000 tur in Svaneti region in Georgia (NACRES, 2006). The total population was given at 5,000-6,000 animals by Weinberg (2004), and might now be lower.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Livestock grazing and poaching are the major threats to the western tur, combined with the impacts of severe winters. Poaching is probably the most significant cause of the recently observed serious declines. Livestock grazing results in competition for resources, especially with domestic sheep and goats. The species is also impacted by habitat loss and degradation (Weinberg et al., 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed in Karachai-Circassia Red Data Book (1988). This tur is protected in the Caucasus Nature Reserve (Russia), which has played a major part in its conservation (Bannikov, 1977). It also occurs in the Teberda Nature Reserve (Karachai-Circassia, Russia). It has been reported from Pskhu-Gumista and Ritsa Nature Reserves in Georgia, but recent surveys indicate that it is no longer present there (P. Weinberg pers. comm.). Hunting under license is permitted in some areas. The most useful conservation measure at present would be to increase the level and effectiveness of protection in existing reserves, because organization of new ones seems improbable for the time being.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

None known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

West Caucasian turs are popular trophies for hunters. Safaris make large amounts of money allowing hunters to kill these animals ("Safari and Expeditions" 2001).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

West Caucasian tur

The West Caucasian tur (Capra caucasica) is a mountain-dwelling goat-antelope found only in the western half of the Caucasus Mountains range.

West Caucasian turs stand up to 1 m (3.3 ft) tall at the shoulder and weigh around 65 kg (143 lb). They have large but narrow bodies and short legs. West Caucasian turs have a chestnut coat with a yellow underbelly and darker legs. Their horns are scimitar-shaped and heavily ridged. In males, these horns are around 70 cm (28 in), while in females they are much smaller.

West Caucasian turs live in rough mountainous terrain between 800 and 4,000 m (2,600 and 13,000 ft) above sea level, where they eat mainly grasses and leaves and are preyed upon by wolves and lynxes. They are nocturnal, eating in the open at night and sheltering during the day. Females live in herds of around 10 individuals, while males are solitary.

The wild population is estimated to be between 5,000 and 6,000 individuals.

See also[edit]

References[edit]

  1. ^ Weinberg, P. (2008). Capra caucasica. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 31 March 2009. Database entry includes a brief justification of why this species is of endangered.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!