Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

With the exception of the lion (Panthera leo), the cheetah is more gregarious than the other big cats; siblings stay together for around 6 months after leaving their mother (3), and brothers will often remain together for life (2). In the Serengeti, where the majority of research has been undertaken, male coalitions are common and around a third of the time these include unrelated males (2). It is thought that males benefit from living in groups by being able to obtain and keep territories, which in turn allows them greater access to females (2). Apart from when they have young, females are solitary and non-territorial, occupying vast home ranges as large as 800km2 (2). Females are sexually mature at around 24 months and can give birth throughout the year. At 3-4 cubs, the litter size is larger than that of the other big cats (3). The cubs are nursed in a lair amongst a rocky outcrop or within tall grasses, and until they are around 8 weeks old, the female must leave them alone whist she hunts (2). The death rate of young cheetahs is high and they are at risk from predation by lions, hyenas and even baboons (3). Cheetahs are the fastest land mammal and use their speed to run-down their prey. Observing from a vantage point, an individual will pick off an antelope at the edge of the herd, stalk and then give chase (6). Cheetahs are able to maintain a speed of up to 87 kilometres an hour for 200-300 metres, before bringing the prey to the ground and then lunging for the throat (3). The carcass is devoured quickly as cheetahs are often displaced from their kills by the more aggressive carnivores of the plains; medium sized antelope such as Thomson's gazelle (Gazella thomsoni) make up the majority of the diet (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The fastest land mammal in the world, the cheetah has many adaptations that allow it to sprint across the plains; the rangy frame supports long limbs and a deep chest cavity together with a small waist and extremely flexible spine (3). Unlike other cats, the claws are not retractable providing further grip on the ground. The large nostrils allow greater amounts of air to enter the lungs and the tail is particularly long to provide extra balance when cornering (3). The coat is a yellowish colour with black spots (5) and a paler, whitish underbelly (3). Genetic colour morphs with large, blotchy markings that can merge into stripes occasionally appear in the population; these 'king cheetahs' as they are known were once considered to be a distinct species (6). The small head has high-set eyes and small, flattened ears (2) and is instantly recognisable by the black tear lines running from the corners of the eyes to the muzzle (3). Cubs have a 'mane' of tufty pale hair on the back of their neck, which sticks upright (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

A large, slender, small-headed cat, leopard-sized, but built on greyhound lines. Above, flanks and outside of legs buffish to yellow covered with solid, round, dark spots never arranged in rosettes as in the Leopard. Below, paler with more diffuse spotting. Fur gener­ally short and dense, but longer below and with an erectile mane along the shoulders and back. In the cubs, this is larger and distinctly pale, a pattern said to provide protection through mimicry of the Honey Badger. Head proportionately small with flat top and small ears. Head densely spotted, chin white. Most distinctive feature is the blackish 'tear mark' running from the eye down the side of the face. Muzzle short. Tail long and full, broad­er at tip than base. Spotted above for the basal half, latter half ringed with up to 6 blackish rings, the final one being the broadest. Tail tip white. Claws only semi-retractile.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description of Acinonyx jubatus

Acinonyx jubatus is the cheetah, ia large-sized cat that inhabits most of Africa and parts of the Middle East. It is one of three cats with non-retractable claws and so cannot climb vertical trees. The cheetah is the fastest land animal achieving between 112 and 120 km/h in short bursts covering distances up to 500 m (1,600 ft), and has the ability to accelerate from 0 to over 100 km/h (62 mph) in three seconds - about the same as a Maclaren F1 (and similar supercars). The coarse, short tan fur with round black spots affords some camouflage while hunting. The cheetah has a small head with high-set eyes. An adult cheetah weighs from 35 to 72 kg.Head-and-body length is about 110 to 150 cm. Males are slightly larger than females. There are several subspecies, one (ex) subspecies is the distinctively marked king cheetah that is very rare in the wild but has been bred in captivity. Cheetahs have been domesticated and used for hunting. group of dogs. The cheetah can purr as it inhales, but cannot roar. The cheetah is considered by some to be the smallest of the big cats. While it is often mistaken for the leopard, but the cheetah has tear-streak lines that run from the corners of its eyes to its mouth, and spots that are not rosettes. The cheetah is a vulnerable species. It adapts poorly to new environments. It is difficult to breed in captivity. Once widely hunted for its fur, the cheetah now suffers more from the loss of both habitat and prey. There are several geographically isolated populations in Africa or southwestern Asia. A small population survives in the Khorasan Province of Iran, and there have been unconfirmed reports of Asiatic Cheetahs in the Balochistan province of Pakistan. The cheetah thrives best in vast expanses of land where prey is abundant. Open habitats include semidesert, prairie, and thick brush. 
Creative Commons Attribution 3.0 (CC BY 3.0)

David

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Cheetahs have disappeared from huge areas of their historic range. They still occur widely, but sparsely, in Africa, but Ray et al. (2005) estimate that the cheetahs have disappeared from 76% of their historic range on the continent.

In Asia, the cheetah has lost almost all its vast historic range, which within the last century extended from the shores of the Mediterranean and the Arabian peninsula, north to the northern shores of the Caspian and Aral Seas, and west through Uzbekistan, Turkmenistan, Afghanistan, Pakistan into central India (Nowell and Jackson 1996; Habibi 2004; Mallon 2007). Part of the reason for their disappearance in Asia is live captures of cheetahs, which were trained to hunt for the aristocracy (Divyabhanusingh, 1995). The main cause, however, was likely depletion of the wild prey base, especially gazelles, as well as direct killing of cheetahs and development of their habitat (Mallon, 2007). The Asiatic cheetah (A. j. venaticus) is now known to survive only in Iran, where it is Critically Endangered. Persistence in Pakistan is unlikely (Husain 2001). While Habibi (2004) considers it extinct in Afghanistan, a cheetah skin of unknown origin was found in a marketplace in western Afghanistan in 2007 (L. Hunter pers. comm.).

Southern and Eastern Africa are the species strongholds, although there has been significant range loss in parts of these regions. Cheetahs are known to occur only in 6% of their historical range in Eastern Africa (310,586 km²), and possibly occur in another 892,658 km² (Anon. 2007). Current distribution in several countries remains largely unknown (Sudan, Somalia, Eritrea, Angola, Mozambique and Zambia). Cheetahs are known to be extirpated from large areas in Uganda, Tanzania, South Africa, Zimbabwe and Malawi (Anon. 2007, 2008). In some parts of southern Africa they occur extensively outside protected areas on commercial ranch land where other large predators (lions and hyenas) have been extirpated (Botswana, Namibia and Zimbabwe) (Purchase et al. 2007).

Cheetahs have declined most drastically in northern and western Africa (Ray et al. 2005). The subspecies (A. j. heckii) is listed as Critically Endangered; see subspecies account for detailed information on northwest Africa.

Cheetah persistence in the eastern Sahara is unlikely.

Cheetahs are possibly extinct in Libya. Specimens were previously collected near the Egyptian border (northeastern part of the country), in Dahra, Sirtica (north-central), Bir Ghazal and Hamada-el-Homra (northwestern). Other records include Fezzan, Khor-el-Gifa, Gikherra (eastern), El Ftaia (near coastal area) and Mizda (Hufnagl 1972). Myers (1975) mentioned that cheetahs were noted in Niger/Libyan borders as well as Niger/Algerian borders. An inquiry with local Tuaregs suggested that the species might not longer be present in Akoukas Mountains (J.-L. Bernezat pers. comm. 2007).

In Tunisia, cheetahs were formerly reported to roam in sandy expanses south of Chott-el-Djerid, the desert areas south of Foum Tatahouine and the Grand Erg Occidental and its surroundings (Schomber and Kock 1960). There are no recent records on the species in the country which make it presumably extinct. The El-Borma region, near the Algerian boundaries, was probably among the areas where cheetahs have last been seen in 1974 and documented (Louis 1979).

As far as Egypt is concerned, data collated during the last few decades suggest that cheetahs are extremely rare, if not extinct, in the country. Osborn and Helmy (1980) provided original and literature-based records from the Matrouh Governorate and Sinai. According to Saleh et al. (2001), cheetahs became extinct from most of the Mediterranean coastal region and easily accessible inland habitats of El-Maghra and Siwa oases one decade after being widely distributed in the northern Egyptian Western Desert until the 1970s. The main reasons explaining cheetah extirpation have been attributed to extensive and uncontrolled hunting and the development of coastal lands (Saleh et al. 2001). If not completely vanished, the species is believed to be confined, with a very low density, to the Western Desert and around the Qattara Depression (Saleh et al., 2001; Hoath, 2003). Recent records from North Sinai, including one female and three cubs killed by Bedouin hunters in 1993, as well as one female seen with two cubs in November 1994, have not been verified (Hoath 2003).

In the eastern Sahel and central Africa, there is little current information:

Current cheetah distribution in most of its historic range in Sudan, Eritrea and Somalia are unknown (Anon. 1997). In Chad, although cheetahs were still present and seen occasionally in Ouadi Rime-Ouadi Achim in the 1970s (J. Newby pers. comm. 2008). A recent wildlife survey in western and central Chad, including Ouadi Rime-Ouadi Achim Faunal Reserve, conducted by the Sahelo-Saharan Interest Group in 2001, failed to detect any cheetah presence in the region (Monfort et al. 2003). In the Central Saharan (northern) part of the country, cheetahs still occur, in very low density, in and around the Ennedi Massif (J. Newby pers. comm. 2008 based on Rava’s pers. comm.). There is no information on previously reported populations in the Tibesti Mountains (Central Sahara). In southeastern Chad, cheetahs may still survive to date in Zakouma National Park (population still present in the protected area as of 2006 [N. Vanherle pers. comm. 2008]).

In central Africa, current cheetah distribution in the savanna regions of Cameroon, Central African Republic, Congo, and Democratic Republic of Congo is unknown (Marker 2002). It is considered extinct in Rwanda and Burundi, and possibly extinct in Nigeria. Rosevear (1974) underlined the paucity of positive records for Nigeria and mentioned Lake Chad, Yan Tumaki (Katsina Division) and possibly Bauchi Plateau as localities for three specimens kept in the British Museum. Happold (1987) raised the possibility of their occurrence near Cameroonian boundaries, and also in the Yankari Game Reserve (Happold 1987). Recent reports from protected area managers and wildlife traders indicate that a threatened small cheetah population may still range in restricted areas in north-centre and northeastern parts of the country (R. Ikemeh pers. comm. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Currently, the cheetah is found in sub-Saharan Africa and Northern Iran.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Records

51 records, 20 of which are tracks rather than sightings. Last seen in 1997 (Qattara).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Localized (Qattara depression and neighboring desert). AOO=63 km². EOO=136707.75 km². 4 locations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Widespread (originally all Africa, east to India; now extinct in much of its former range).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Africa to India

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

As a species, the cheetah is found in a wide distribution throughout much of sub-Saharan Africa although there are currently five African subspecies, Acinonyx jubatus hecki, A. j. jubatus, A. j. raineyi, A. j. ngorongorensis and A. j. soemmeringii, which differ in their location across the sub-continent (6).The Critically Endangered Iranian cheetah (A. j. venaticus) which inhabitated India and Southwestern Asia survives only in Iran, where there are believed to be fewer than 60 (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

In Hindi cheetah means "spotted one." The base color of the upper parts of an adult is tawny to bale bluff or grayish white, and the underparts are paler, often white. The coat is marked by round or oval black spots measuring .75 to 1.5 in. in diameter. The only exception to this is when recessive genes are inherited from both parents resulting in a more "blotchy" coat pattern. Cheetahs exhibiting this rare mutation were once thought to be a separate subspecies, but it is now known that they can appear in a litter of normal cheetahs. Only the white of the throat and the abdomen are unmarked with spots. The coat is coarse with the hair slightly longer at the nape than elswhere. The last third of the tail is marked by four to six black rings and a bushy white tuft at the very end. The tail rings are distinctive on each cheetah and enable individual identification. The cheetah has a small head with short ears, high set eyes and a black line which looks like a tear drop running from the inner aspect of each eye down to the mouth. The teeth are small and the nasal passages are large. The body resembles that of a greyhound and is slim with very long legs. An adult cheetah measures 67 to 94 cm. tall at the shoulder, and is 121 to 150 cm. in length, with an additional 70 to 81 cm. in tail length. The cheetah exhibits slight sexual dimorphism with the males being the larger sex.

The cheetah is the fastest terrestrial mammal with a speed range up to 71 mph. This top speed can only be maintained for roughly 275 meters. The cheetah moves foward roughly seven to eight meters in a single stride and completes four strides per second. Cheetah paws are less rounded and harder than most cats; this aids the cheetah in making quick turns. The claws are only semi-retractable and provide traction during running. Cheetah have reduced teeth compared to other large cats. This is perhaps because of their large nostrils, which are useful in quick air intake and do not leave room for the roots of larger teeth. Large lungs, liver, heart, and adrenals facilitate a rapid physical response. Cheetah have a long, fluid body which is streamlined over light bones. The tail acts to balance the body during quick turning. The spine functions as a spring for the back legs, which gives the cheetah added reach for each step. The black teardrops under each eye may enhance vision by minimizing glare from the sun.

Average mass: 53500 g.

Average basal metabolic rate: 61.77 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Length 112-150 cm, weight 35-65 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Cheetahs are the fastest land mammals, and catch their prey, principally small- to mid-sized ungulates, especially gazelles, in high speed chases up to 103 km per hour (29 meters per second) (Sharp 1997), over distances of hundreds of metres. Other prey include ground-dwelling birds and small mammals, such as hares. Cheetahs, unlike other African predators, rarely scavenge and do not remain long with their kills, many of which are stolen by other carnivores. Cheetahs are primarily active during the day, unlike other predators, a strategy that may help to reduce competition (Caro 1994).

Cheetahs are primarily found in open grassy habitats, but also make use of dry forest, savanna woodland, semi-desert and scrub, being absent from tropical rainforest. There are reports of cheetah at altitudes of 4,000 m on Mt Kenya (Young and Evans 1993). In the central Sahara, cheetahs occur in high mountain habitat - the Saharan mountains are hyper-arid, but still receive slightly higher rainfall than the surrounding desert. They are thus better vegetated and support small permanent waterholes and antelope populations (Nowell and Jackson 1996).

Cheetah habitat in Iran consists of desert, much of it with precipitation of fewer than 100 mm per year. The terrain ranges from plains and saltpans to eroded foothills, and rugged desert ranges that rise to an elevation of up to 2,000-3,000 m. The vegetation, if any, consists of a sparse cover of shrubs, most less than one meter tall, of the genera Salsola, Artemisia, Zygophyllum, Astragulus, Aphaxis, and others. Gazelles Gazella subgutturosa and G. bennetti were preferred prey, but they have now become scarce through over-hunting and replacement by livestock (Nowell and Jackson 1996). Opportunistic recovery of cheetah kills suggests that wild sheep Ovis orientalis, Persian ibex Capra aegagrus and Cape hares Lepus capensis are the key prey species today though none are considered optimal for cheetahs (Hunter et al. 2007).

Cheetahs have a social organization that is unique among the felids. Females are solitary or accompanied by dependent young, and males are either solitary or live in stable coalitions of two or three. Some coalitions consist of brothers, but unrelated males may also be members of the group. Unlike the coalitions formed by male lions, which remain attached to and mate with the females in a single pride, cheetah male coalitions mate with as many females as possible (Caro 1994), and females show no mate fidelity (Gottelli et al. 2007).

Female cheetahs in areas where prey is migratory (such as the Serengeti Plains) follow the herds, while male coalitions establish small territories (average 30 km²) and attempt to mate with females passing through (Durant et al. 1988; Caro 1994). However, in areas where prey is non-migratory, male and females have smaller, overlapping ranges that are similar in size (Sunquist and Sunquist, 2002). On Namibian farmlands, where prey is non-migratory, both cheetah sexes have very large home ranges (average 1,642 km²); however, intensively used core areas were just 14% of the total home range. The reasons for such large home ranges were unclear, and were apparently not the result of reduced prey availability (Marker 2002).

In comparison with other big cats, cheetahs occur at relatively low densities (10-30% of typical densities for lions, leopards, tigers and jaguars in prime habitat: Durant, 2007). On the Serengeti plains, cheetah densities range from 0.8-1.0 per 100 km², but seasonally cheetahs can congregate at densities up to 40 per 100 km² (Caro 1994). Caro (1994) attributes lower cheetah densities to interspecific competition (especially with larger species such as lions and hyenas that can kill cheetah cubs), but on Namibian farmlands, where lions and hyenas have been eradicated, cheetahs still occur at low densities (0.2 per 100 km²) (Marker 2002).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Cheetah favor areas with tall grass and shrubs. They also seek out areas with many elevated points to look for prey from.

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Open plains and savanna to semi-desert. In Egypt, known from acacia groves in the Qattara Depression, the Mediterranean coastal desert, and, historically, the sandy deserts of North Sinai.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Open, grassy savannah plains and dry bush, scrub and open forests (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The cheetah is carnivorous. The diet consists primarily of gazelles, but also includes impalas, game birds, rabbits, and the young of warthogs, kudu, hartebeest, oryx, roan, and sable. Cheetah hunt in early morning and late afternoon (diurnal). They scan the country side from a tree limb, on top of a termite mound, or even the roofs of cars of observers in order to locate prey. Once they have located an animal that has strayed some distance from the group, the cheetah tries to get within fifty yards of the intended victim before accelerating. Full sprints last roughly twenty seconds and rarely exceed one minute. Most hunts fail. If the hunt is successful, the prey is usually knocked down by the force of the cheetah's charge and then seized by its throat and strangled. Smaller prey such as rabbits are usually killed by biting through the skull. A female with cubs may make a kill every day, whereas lone adults hunt every two to five days. Cheetah eat fast because if challenged for their food, they most often lose.

Animal Foods: birds; mammals

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Nothing known about the Egyptian population. Elsewhere, chiefly hunts by day using a termite mound or similar raised area as a lookout position. Hunts by running the prey down with a burst of speed up to lOOkmph sustained for little more than half a kilometer. Diet in Egypt likely to be gazelle, hare, birds, and small mammals. Hunting is by sight. Occupies a home range that varies with food abundance and population density. In Egypt, likely to be very large. Sociability complex. Female generally solitary, except when with cubs or during mating. Young males more sociable, forming bachelor groups. Sociability in Egypt unclear given very low population. Gestation 91-95 days. Cubs in Egypt found in April/May but also November. Calls include a twittering contact call, hisses and snarls when angry, and purrs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
15.0 years.

Average lifespan

Status: captivity:
19.0 years.

Average lifespan

Status: wild:
12.0 years.

Average lifespan

Status: captivity:
17.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.5 years (captivity) Observations: One wild born male was about 20.5 years old when he died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Females are polyestrous, with an average cycle of twelve days. Fertility lasts for one to three days. Breeding occurs throughout the year. A peak birth season has been noted during March through June. Gestation lasts 90 to 95 days. The number of young born can be one to eight, but is usually three to five. At birth cubs are on average 11.8 inches long and weigh 0.6 pounds. They are gray in color and have a mantle of mane-like hair along their back. It has been postulated that this mantle helps camouflage the cubs in the grass. The mantle begins to disappear at three months, but may still be seen at 2 years of age. During the first few weeks of life the cubs are moved every few days by their mother to avoid predators. The mother must leave the cubs alone to hunt, and during these times cubs often fall victim to predators. Infant mortality rates may be as high as 90%, with a majority being killed by lions. Cubs begin to follow their mother at 6 weeks of age. Cubs are weaned at three to six months. They usually remain with their mother for 13 to 20 months, during which time she teaches them to hunt. Sexual maturity is reached at 2 years of age.

Range number of offspring: 1 to 8.

Average number of offspring: 3.7.

Range gestation period: 90 to 95 days.

Range weaning age: 120 to 150 days.

Average birth mass: 489 g.

Average number of offspring: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
456 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
456 days.

Parental Investment: altricial ; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Flexible spine increases speed: cheetah
 

The spine of the cheetah increases its running speed because its flexiblity allows longer stride lengths.

     
  "They [plains predators] have effectively lengthened their limbs by making their spine extremely flexible. At full stretch, travelling at high speed, their hind and front legs overlap one another beneath the body just like those of a galloping antelope. The cheetah has a thin elongated body and is said to be the fastest runner on earth, capable of reaching speeds, in bursts, of over 110 kph. But this method is very energy-consuming. Great muscular effort is needed to keep the spine springing back and forth and the cheetah cannot maintain such speeds for more than a minute or so." (Attenborough 1979:264)
  Learn more about this functional adaptation.
  • Attenborough, D. 1979. Life on earth. Boston, MA: Little, Brown and Company. 319 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acinonyx jubatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0593-06|NC_005212|Acinonyx jubatus| ATCCGCTGATTATTTTCAACTAATCATAAAGATATCGGTACTCTTTACCTCCTGTTTGGTGCTTGAGCTGGTATAGTAGGGACTGCTCTT---AGTCTTCTAATCCGGGCCGAACTAGGTCAACCTGGCACACTACTAGGAGAT---GATCAAATTTACAATGTAATCGTTACAGCCCATGCTTTTGTAATGATTTTCTTCATAGTTATGCCTATTATAATTGGAGGATTCGGTAACTGATTGGTCCCATTAATG---ATTGGAGCTCCTGACATAGCATTCCCCCGAATGAATAATATAAGCTTCTGGCTCCTTCCTCCCTCTTTCTTACTTCTACTCGCTTCATCTATAGTGGAGGCTGGGGCAGGGACTGGATGAACAGTGTATCCACCCCTAGCTGGCAATCTGGCTCATGCAGGAGCATCCGTAGACCTG---ACTATCTTCTCACTTCACCTAGCAGGCGTTTCTTCAATTTTAGGTGCTATTAATTTTATTACAACTATCATTAATATAAAACCCCCTGCCATATCTCAATACCAAACACCTTTGTTTGTGTGATCAGTTCTAATCACTGCAGTCCTGTTACTTCTATCACTCCCAGTTTTAGCAGCA---GGAATCACCATGTTATTAACAGATCGAAATTTAAATACCACATTCTTCGATCCTGCTGGAGGAGGAGATCCTATCTTATACCAACATCTATTCTGATTTTTTGGCCACCCAGAGGTCTACATTTTAATTCTACCCGGTTTTGGAATAATCTCGCACATTGTTACCTATTATTCAGGCAAAAAA---GAACCATTTGGTTACATGGGAATAGTTTGAGCCATAATATCAATTGGCTTCCTGGGCTTTATCGTATGAGCCCATCACATGTTTACTGTTGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acinonyx jubatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 15
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2acd;C1

Version
3.1

Year Assessed
2008

Assessor/s
Durant, S., Marker, L., Purchase, N., Belbachir, F., Hunter, L., Packer, C., Breitenmoser-Wursten, C., Sogbohossou, E. & Bauer, H.

Reviewer/s
Nowell, K., Breitenmoser-Wursten, C., Breitenmoser, U. (Cat Red List Authority) & Hoffmann, M. (Global Mammal Assessment Team)

Contributor/s

Justification
The known cheetah population is approximately 7,500 adult animals (see section Population for details). Additional areas where cheetah status is poorly known are unlikely to raise the total to over 10,000. Given Myers (1975) estimate of 15,000 cheetahs in Africa in the 1970s, a decline of at least 30% is suspected over the past 18 years (3 generations). The decline is primarily due to habitat loss and fragmentation, as well as killing and capture of cheetahs as livestock depredators, primarily, as well as for trade (IUCN Cats Red List Workshop 2007).

Subspecies in Iran (A. j. venaticus) and northwest Africa (A. j. heckii) are listed as Critically Endangered.

History
  • 2002
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Population estimates vary from 2,000 to 15,000. The World Conservation Union (IUCN) classifies the cheetah as vulnerable, with the African sub-species as endangered and the Asiatic sub-species as critically endangered. The cheetah is listed as endangered and is on Appendix 1 of CITES (Convention on International Trade in Endangered Species).

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Native, extinct?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Critically endangered.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Very rare, possibly extinct.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Acinonyx jubatus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1), and listed on Appendix I of CITES (4). Threatened Subspecies: Northwest African cheetah (A. j. hecki) and Iranian cheetah (A. j. venaticus) classified as Critically Endangered (CR) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Southern Africa is the cheetah’s regional stronghold, with a "roughly" estimated population of at least 4,500 adults (Purchase et al. 2007). This regional estimate breaks down as follows: Angola – present but unknown; Botswana – 1,800; Malawi - <25 (and probably extirpated: Purchase and Purchase 2007); Mozambique: <50; Namibia – 2,000; South Africa – 550; Zambia – 100; Zimbabwe – 400. A large proportion of the estimated population lives outside protected areas, in lands ranched primarily for livestock but also for wild game, and where lions and hyenas have been extirpated.

The number of known resident cheetahs in Eastern Africa (Ethiopia, southern Sudan, Uganda, Kenya and Tanzania) is estimated at 2,572 adults and independent adolescents. Most population estimates were derived from applying a density estimate of one adult per 100 km² to mapped resident range areas during a conservation strategy workshop, although a few are based on research. Only four of the 15 known populations were estimated to number >200 animals; the largest population (Serengeti/Maro/Tsavo in Kenya and Tanzania) is estimated at 710. It would be much smaller if unprotected lands were included. Overall, less than half of the estimated cheetah population inhabits protected areas. In addition, approximately half lives in habitat blocks which are trans-boundary, requiring international cooperation for conservation of the population. Cheetahs possibly occur over an area which is several times as large as the range of the known population (Anon. 2007).

These estimates can be compared with previous population estimates based on extensive field interviews and application of density estimates. There is rough accord for Kenya at 793 (Gros 1998) and Tanzania at 569-1,007 (Gros 2002). However, in Uganda, Gros and Rejmanek (1999) estimated 40-295 with a wider range in the Karamoja region, whereas now cheetahs have been extirpated and just 12 are estimated to persist in Kidepo National Park and surroundings (Anon. 2007).

In the remainder of Africa, there are few reliable population estimates. Cheetahs are considered extinct or possibly extinct in many countries (Marker 2002). In northwest Africa the population is probably fewer than 250 mature individuals and the subspecies A. j. heckii is listed as Critically Endangered.

In Asia cheetahs are now known to exist only in Iran, where the subspecies A. j. venaticus is estimated at 60-100 (Hunter et al. 2007) and listed as Critically Endangered.

The known cheetah population is not much greater than 7,000, and the total population is unlikely to exceed 10,000 mature individuals, thus meeting the criteria for Vulnerable. The current known population is half the 15,000 estimated by Myers (1975) from his continental status assessment. The effective population size (the estimated percentage of the population contributing to the gene pool through reproductive success) could be less than half of the total population (Kelly 2001).

While the current rate of population decline is of most concern, and the historical rate of decline has been severe (Nowell and Jackson, 1996; Ray et al. 2005), attention has also focused on the cheetah's having perhaps suffered even more extreme losses in the distant past. The cheetah species exhibits remarkably low levels of genetic diversity in comparison to other felids (O'Brien et al. 1986) (but not compared to carnivores in general: Merola 1994). This is consistent with inbreeding among a very few individuals surviving one or more catastrophic population bottlenecks in the past, with the first possibly occurring during the late Pleistocene extinctions, around 10,000 years ago, according to analysis of mitochondrial DNA (Menotti-Raymond and O'Brien 1995).

It is unclear what sort of agent could have caused such an extreme population decline in a wide-ranging species, and alternative explanations have been explored. Hedrick (1996) suggested the low levels of genetic variation could result from a very low effective population size (the estimated percentage of the population that is actually passing on its genes), and Kelly's (2001) calculations of effective population size in cheetahs of the Serengeti Plains were quite low (44% or less of the actual population). She found that only a few females contributed disproportionately to future generations by raising offspring which survived and reproduced (Kelly 2001). Genetic analysis by Gottelli et al. (2007) showed that male cheetahs, on the other hand, passed on their genes more successfully than expected. Female cheetahs mated with multiple males, many non-resident, with 43% of litters having mixed paternity. This indicates that rates of genetic loss should be lower than anticipated by Kelly (2001), and underscores the importance of cheetah mobility in their ecology and conservation.

While the causes of the cheetah's low levels of genetic variation are unclear, what is clear is that large populations are necessary to conserve it. Since cheetahs are a low density species, conservation areas need to be quite large, larger than most protected areas.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
In Eastern Africa, habitat loss and fragmentation was identified as the primary threat during a conservation strategy workshop (Anon. 2007). Because cheetahs occur at low densities, conservation of viable populations requires large scale land management planning; most existing protected areas are not large enough to ensure the long term survival of cheetahs (Durant 2007).

A depleted wild ungulate prey base is of serious concern in northern Africa (Berzins and Belbachir 2006). Cheetahs which turn to livestock are killed as pests (Claro 2003; Hamdine et al. 2003; Wacher et al. 2005). Conflict with farmers and depletion of the wild prey base are also considered significant threats in parts of Eastern Africa (Anon. 2007).

In Iran, the Asiatic Cheetah A. j. venaticus is threatened indirectly by loss of prey base through human hunting activities. In addition, most protected areas are open to seasonal livestock grazing, which potentially places huge pressure on the resident ungulate populations through disturbance and potential competition (Hunter et al. 2007). Additionally, domestic dogs accompanying the herds present a likely threat to both cheetahs and their prey (H. Ziaie pers. comm. 2008) An emerging threat is the possibility of fragmentation into discontinuous subpopulations as a result of increasing developmental pressures (mining, oil, roads, railways); this is particularly the case in Kavir N.P., currently the north-western limit of the Asiatic Cheetah's range (L. Hunter and L. Marker pers. comm.).

Conflict with farmers and ranchers is the major threat to cheetahs in southern Africa (Purchase et al. 2007). Cheetah are often killed or persecuted because they are a perceived threat to livestock, despite the fact that they cause relatively little damage. In Namibia, very large numbers of cheetahs have been live-trapped and removed by ranchers seeking to protect their livestock (from government permit records, Nowell [1996] calculated that over 9,500 cheetahs were removed from 1978-1995). While removal rates have fallen, in part due to intensified conservation and education efforts, many ranchers still view cheetahs as a problem animal, despite research showing that cheetahs were only responsible for 3% of livestock losses to predators (Marke, 2002). Although cheetah in Iran have been killed because of predation on livestock, since 2003, there has been no direct evidence of killing cheetahs (Hunter et al. 2007), though it is likely most incidents go unreported.

Cheetahs are also vulnerable to being caught in snares set for other species (Ray et al. 2005; Anon. 2007).

Another threat to the cheetah is interspecific competition with other large predators, especially lions. On the open, short-grass plains of the Serengeti, juvenile mortality can be as high as 95%, largely due to predation by lions (Laurenson 1994). However, mortality rates are lower in more closed habitats (Caro in press).

CITES allows legal trade in live animals and hunting trophies under an Appendix I quota system (annual quotas: Namibia - 150; Zimbabwe - 50; Botswana - 5). This was accepted by CITES as a way to enhance the economic value of cheetahs on private lands and provide an economic incentive for their conservation (Nowell 1996). The global captive cheetah population is not self-sustaining; cheetahs breed poorly in captivity and in 2001 30% of the captive population was wild-caught (Marker 2002). While analysis of trade records in the CITES database shows that these countries have reported almost no live exports since the late 1990s, Purchase et al. (2007) are concerned that there is a substantial illegal cross-border trade in live animals. There is also concern about illegal trade in skins, as well as capture of live cubs for trade to the Middle East (Anon. 2007). There is an increasing trade in cubs from north-east Africa into the Middle East (Amir 2005), but there is currently little trade in cubs from the Sahel region, where it was previously considered a major problem (K. de Smet pers. comm. 2007).

Cheetahs are active during the daytime and there is concern that they can be driven off their kills by tourist cars crowding around, or mothers separated from their cubs. Burney (1980) conducted a study and concluded that tourist cars did not seem to harm cheetahs, and in fact sometimes helped, as cheetah chases more often ended in a kill when there were cars around, distracting prey, providing cover from which to stalk, or otherwise waking cheetahs up to notice prey in the area. However, tourist numbers have risen sharply by then, and its potential impact on cheetahs remains a concern (Caro 1994; Anon. 2007).

The Eastern African cheetah conservation strategy (Anon. 2007) identified four sets of constraints to mitigating these threats across a large spatial scale. Political constraints include lack of land use planning, insecurity and political instability in some ecologically important areas, and lack of political will to foster cheetah conservation. Economic constraints include lack of financial resources to support conservation, and lack of incentives for local people to conserve wildlife. Social constraints include negative conceptions of cheetahs, lack of capacity to achieve conservation, lack of environmental awareness, rising human populations, and social changes leading to subdivision of land and subsequent habitat fragmentation. These potentially mutable human constraints contrast with several biological constraints which are characteristic of cheetahs and cannot be changed, including wide-ranging behaviour, negative interactions with other large carnivores, and potential susceptibility to disease.

Disease is a potential threat to the cheetah (Anon. 2007), as its reduced genetic diversity can increase a population's susceptibility (O'Brien et al. 1983). However, the most serious disease mortality thus far documented in wild cheetahs was from naturally occurring anthrax in Namibia's Etosha National Park; cheetahs, unlike other predators, do not scavenge carcasses of ungulates killed by anthrax, and thus had no built-up immunity when they preyed upon springbok sick with the disease (Lindeque et al. 1998). The cheetah's low density may offer some measure of protection against infectious disease; for example, cheetahs were not affected by an outbreak of Canine Distemper Virus in the Serengeti National Park which killed over 1/3 of the lion population. Serological surveys of cheetahs on Namibian farmland indicate some exposure and survival of the disease (Marker 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The Cheetah is endangered throughout its range, due to the loss of habitat and prey as well as direct persecution (2). Both captive and wild cheetahs have very low genetic variation and it was previously thought that this posed a severe threat to their survival; captive cheetahs have a very low successful birth rate and lack of genetic variation renders wild populations particularly vulnerable to sudden environmental change (3). However, studies have revealed that wild populations have a healthy reproductive rate and the implications of genetic similarities remain unclear. One of the major concerns today is competition with the more successful carnivores of the African plains; lions and hyenas kill cheetah cubs and also drive adults away from kills. In protected reserves where these animals are thriving, cheetahs may be under severe threat (3). Persecution by farmers because of livestock predation is an additional threat to the survival of this species (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix I of CITES and is protected under national legislation throughout most of its extant and some of its former range (Nowell and Jackson, 1996. However, a number of countries permit cheetahs to be killed in defence of life and livestock (Purchase et al., 2007). In Namibia, for example, one is permitted to retain the skin as long as the killing is reported (Nowell, 1996). Such policies may at least permit cheetah killing to be monitored.

Promotion of livestock management regimes which minimize conflict with cheetahs are an important conservation measure, pioneered by the Cheetah Conservation Fund in Namibia (Marker et al., 2003) but now being applied more widely. Elements of successful conservation management include availability of wild prey and more intensive livestock herd protection, especially using guard dogs.

The Asiatic Cheetah is protected in Iran. The main protected areas for this species include Kavir National Park, Khar Touran National Park and Naybandan Wildlife Refuge, Bafgh P.A., and Dar Anjir Wildlife Refuge. A radio-telemetry study in Iran is providing the first detailed data on cheetahs in Iran (Hunter et al. 2007).

In 2009, the Afghan Government placed this species on the country’s Protected Species List, meaning all hunting and trading of this species within Afghanistan is now illegal.

Several countries, including Namibia and Kenya, have developed national action plans or conservation strategies for cheetahs (Nowell, 1996; Durant, 2007); regional conservation strategies have been developed for Southern (Dickman et al., 2006; Anon., 2008) and Eastern Africa (Anon., 2007); and there is also a global strategy (Bartels et al., 2002). These plans call for a number of improvements in monitoring, surveys and information exchange (to better understand cheetah distribution and status); promotion of human-cheetah coexistence (to reduce conflict and develop incentives to conserve cheetahs); national land use planning (to ensure viable national cheetah populations); capacity building (to improve management); policy and legislation (to ensure legal consistency and remove loopholes) and advocacy (to raise awareness of and political commitment to cheetah conservation needs).

Several specialist networks of cheetah conservationists have been established, including the Global Cheetah Forum (affiliated with the IUCN Conservation Breeding Specialist Group) and the North African Regional Cheetah Action Group (NARCAG/OGRAN). The IUCN SSC Cat Specialist Group maintains a Cheetah Conservation Compendium with a reference library and detailed country information (www.catsg.org)

Important protected areas that represent strongholds for Cheetah populations in Africa include the Kgalagadi Transfrontier Park (South Africa, Botswana), Nxai Pan and Chobe National Parks, and Okavango Delta (Botswana), Etosha N.P. (Namibia), Liuwa Plains N.P. (Zambia), and, of course, the Serengeti N.P. (Tanzania, Kenya) (Caro in press). In West Africa, the major remaining stronghold for the species is the WAPO protected areas complex. There is a surviving population of Cheetah in the Ahaggar National Park in Algeria (Wacher et al. 2005).

However, most cheetah occur outside of protected areas (where they are often persecuted as pests), and given their need for large areas they require conservation action on a landscape scale (for example, human-wildlife conflict mitigation, zoning for land-use to maintain habitat connectivity, and wild prey restoration) (Marker, 2002; Anon., 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The cheetah is protected by law throughout its range and occurs within a number of reserves (1), although competition with lions and hyenas means that these reserves may not be the best way of conserving this species (3). In Namibia, South Africa and Zimbabwe, limited trophy hunting of cheetahs is allowed on private property, as a method of encouraging landowners to accept cheetahs on their land by enjoying the profit hunting provides (3). In Namibia, the Cheetah Conservation Fund has initiated a novel conservation programme; providing farmers with guard dogs to protect their livestock herds. To date, this scheme has led to a dramatic reduction in the number of cheetahs trapped and killed (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Cheetah have been thought to prey on domestic stock. In the past, this has led to their being hunted. Whether or not they actually prey on domestic stock is in question. Educational campaigns have commenced to educate the farmers on how to live in harmony with cheetah, and the importance of cheetah to the environment.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the past, the cheetah pelt was viewed as a status symbol of wealth, which led to their being hunted. Currently, cheetah are of economic importance for the tourism industries of the areas in which they are still found naturally. Cheetah also are of economic importance for zoos. Another way in which people profit from cheetah is through the pet industry. Hunters kill mothers and then take their offspring to be sold as pets. The infant cheetah are purchased illegally because of laws prohibiting individual ownership of wild and/or endangered animals.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cheetah

The cheetah (Acinonyx jubatus) is a large-sized feline (family Felidae) inhabiting most of Africa and parts of the Middle East. It is the only extant member of the genus Acinonyx. The cheetah achieves by far the fastest land speed of any living animal—between 112 and 120 km/h (70 and 75 mph)[3][4] in short bursts covering distances up to 500 m (1,600 ft), and has the ability to accelerate from 0 to over 100 km/h (62 mph) in three seconds.[5]

This cat is also notable for modifications in the species' paws. It is one of the only felids with semi-retractable claws, and with pads that, by their scope, disallow gripping.[6] Thus, cheetahs cannot climb upright trees, although they are generally capable of reaching easily accessible branches.

Contents

Etymology

The word "cheetah" is derived from the Sanskrit word citrakāyaḥ, meaning "variegated", via the Hindi चीता cītā.[7]

Genetics and classification

The genus name, Acinonyx, means "no-move-claw" in Greek, while the species name, jubatus, means "maned" in Latin, a reference to the mane found in cheetah cubs.

Cheetah mother with cub

The cheetah has unusually low genetic variability. This is accompanied by a very low sperm count, motility, and deformed flagella.[8] Skin grafts between unrelated cheetahs illustrate the former point in that there is no rejection of the donor skin. It is thought that the species went through a prolonged period of inbreeding following a genetic bottleneck during the last ice age. This suggests that genetic monomorphism did not prevent the cheetah from flourishing across two continents for thousands of years.[9]

The cheetah likely evolved in Africa during the Miocene epoch (26 million to 7.5 million years ago), before migrating to Asia. Recent research has placed the last common ancestor of all existing populations as living in Asia 11 million years ago, which may lead to revision and refinement of existing ideas about cheetah evolution.[10]

Cheetah at the Maasai Mara National Reserve

The now-extinct species include: Acinonyx pardinensis (Pliocene epoch), much larger than the modern cheetah and found in Europe, India, and China; Acinonyx intermedius (mid-Pleistocene period), found over the same range. The extinct genus Miracinonyx was extremely cheetah-like, but recent DNA analysis has shown that Miracinonyx inexpectatus, Miracinonyx studeri, and Miracinonyx trumani (early to late Pleistocene epoch), found in North America and called the "North American cheetah" are not true cheetahs, instead being close relatives to the cougar.[11]

Subspecies

A Tanzanian cheetah (Acinonyx jubatus raineyii)

Although many sources list six or more subspecies of cheetah, the taxonomic status of most of these subspecies is unresolved[says who?]. Acinonyx rex—the king cheetah (see below)—was abandoned as a subspecies after it was discovered that the variation was caused by a single recessive gene. The subspecies Acinonyx jubatus guttatus, the woolly cheetah, may also have been a variation due to a recessive gene. Some of the most commonly recognized subspecies include:[12]

Description

Cheetah skull
Cheetah front and hind feet, as illustrated in Pocock's The Fauna of British India, including Ceylon and Burma - Mammalia Vol 1

The cheetah's chest is deep and its waist is narrow. The coarse, short fur of the cheetah is tan with round black spots measuring from 2 to 3 cm (0.79 to 1.2 in) across, affording it some camouflage while hunting. There are no spots on its white underside, but the tail has spots, which merge to form four to six dark rings at the end. The tail usually ends in a bushy white tuft. The cheetah has a small head with high-set eyes. Black "tear marks" running from the corner of its eyes down the sides of the nose to its mouth keep sunlight out of its eyes and aid in hunting and seeing long distances. Although it can reach high speeds, its body cannot stand long distance running, because it is more suited to short bursts of speed.

The adult cheetah weighs from 35 to 72 kg (77 to 160 lb). Its total head-and-body length is from 110 to 150 cm (43 to 59 in), while the tail can measure 60 to 84 cm (24 to 33 in) in length.[13][14][15] Cheetahs are 66 to 94 cm (26 to 37 in) tall at the shoulder. Males tend to be slightly larger than females and have slightly bigger heads, but there is not a great variation in cheetah sizes and it is difficult to tell males and females apart by appearance alone. Compared to a similarly sized leopard, the cheetah is generally shorter-bodied, but is longer tailed and taller (it averages about 90 cm (35 in) tall) and so it appears more streamlined.

Some cheetahs have a rare fur pattern mutation of larger, blotchy, merged spots. Known as "king cheetahs," they were once thought to constitute a separate subspecies but are in fact African cheetahs; their unusual fur pattern is the result of a single recessive gene.[16] The "king cheetah" has only been seen in the wild a handful of times, but it has been bred in captivity.

Comparative illustration of a leopard (left) and cheetah (right)

The cheetah's paws have semi-retractable claws (known only in three other cat species: the fishing cat, the flat-headed cat and the Iriomote cat), offering extra grip in its high-speed pursuits. The ligament structure of the cheetah's claws is the same as those of other cats; it simply lacks the sheath of skin and fur present in other varieties, and therefore the claws are always visible, with the exception of the dewclaw. The dewclaw itself is much shorter and straighter than that of other cats.

Adaptations that enable the cheetah to run as fast as it does include large nostrils that allow for increased oxygen intake, and an enlarged heart and lungs that work together to circulate oxygen efficiently. During a typical chase, its respiratory rate increases from 60 to 150 breaths per minute.[8] While running, in addition to having good traction due to its semi-retractable claws, the cheetah uses its tail as a rudder-like means of steering[citation needed] to allow it to make sharp turns, necessary to outflank prey animals that often make such turns to escape.

Unlike true big cats of subfamily Pantherinae, the cheetah can purr as it inhales, but cannot roar. By contrast, the big cats can roar but cannot purr, except while exhaling. The cheetah is still considered by some to be the smallest of the big cats. While it is often mistaken for the leopard, the cheetah does have distinguishing features, such as the aforementioned long "tear-streak" lines that run from the corners of its eyes to its mouth, and spots that are not "rosettes". The thinner body frame of the cheetah is also very different from that of the leopard.

The cheetah is a vulnerable species. Of all the big cats, it is the least able to adapt to new environments. It has always proved difficult to breed in captivity, although recently a few zoos have managed to succeed at this. Once widely hunted for its fur, the cheetah now suffers more from the loss of both habitat and prey.

The cheetah was formerly considered to be particularly primitive among the cats and to have evolved approximately 18 million years ago. New research, however, suggests the last common ancestor of all 40 existing species of felines lived more recently than that—about 11 million years ago. The same research indicates the cheetah, while highly derived morphologically, is not of particularly ancient lineage, having separated from its closest living relatives (Puma concolor, the cougar, and Puma yaguarondi, the jaguarundi) around five million years ago.[11] These felids have not changed appreciably since they first appeared in the fossil record.

Morphs and variations

King cheetah

A king cheetah showing its distinctive coat pattern

The king cheetah is a rare mutation of cheetah characterized by a distinct fur pattern. It was first noted in what was then Southern Rhodesia (modern-day Zimbabwe) in 1926. In 1927, the naturalist Reginald Innes Pocock declared it a separate species, but reversed this decision in 1939 due to lack of evidence, but in 1928, a skin purchased by Walter Rothschild was found to be intermediate in pattern between the king cheetah and spotted cheetah and Abel Chapman considered it to be a color form of the spotted cheetah. Twenty-two such skins were found between 1926 and 1974. Since 1927, the king cheetah was reported five more times in the wild. Although strangely marked skins had come from Africa, a live king cheetah was not photographed until 1974 in South Africa's Kruger National Park. Cryptozoologists Paul and Lena Bottriell photographed one during an expedition in 1975. They also managed to obtain stuffed specimens. It appeared larger than a spotted cheetah and its fur had a different texture. There was another wild sighting in 1986—the first in seven years. By 1987, thirty-eight specimens had been recorded, many from pelts.

Its species status was resolved in 1981 when king cheetahs were born at the De Wildt Cheetah and Wildlife Centre in South Africa. In May 1981, two spotted sisters gave birth there and each litter contained one king cheetah. The sisters had both mated with a wild-caught male from the Transvaal area (where king cheetahs had been recorded). Further king cheetahs were later born at the Centre. It has been known to exist in Zimbabwe, Botswana and in the northern part of South Africa's Transvaal province. A recessive gene must be inherited from both parents for this pattern to appear, which is one reason why it is so rare.

Other color variations

Other rare color morphs of the species include speckles, melanism, albinism and gray coloration. Most have been reported in Indian cheetahs, particularly in captive specimens kept for hunting.

The Mughal Emperor of India, Jahangir, recorded having a white cheetah presented to him in 1608. In the memories of Tuzk-e-Jahangiri, the Emperor, says that in the third year of his reign, Raja Bir Singh Deo brought a white cheetah to show me. Although other sorts of creatures, both birds and beasts have white varieties .... I had never seen a white cheetah. Its spots, which are (usually) black, were of a blue colour, and the whiteness of the body also inclined to blue-ishness. This suggests a chinchilla mutation which restricts the amount of pigment on the hair shaft. Although the spots were formed of black pigment, the less dense pigmentation gives a hazy, grayish effect. As well as Jahangir's white cheetah at Agra, a report of "incipient albinism" has come from Beaufort West according to Guggisberg.

In a letter to "Nature in East Africa", H. F. Stoneham reported a melanistic cheetah (black with ghost markings) in the Trans-Nzoia District of Kenya in 1925. Vesey Fitzgerald saw a melanistic cheetah in Zambia in the company of a spotted cheetah. Red (erythristic) cheetahs have dark tawny spots on a golden background. Cream (isabelline) cheetahs have pale red spots on a pale background. Some desert region cheetahs are unusually pale; probably they are better-camouflaged and therefore better hunters and more likely to breed and pass on their paler coloration. Blue (Maltese or grey) cheetahs have variously been described as white cheetahs with grey-blue spots (chinchilla) or pale grey cheetahs with darker grey spots (Maltese mutation). A cheetah with hardly any spots was shot in Tanzania in 1921 (Pocock); it had only a few spots on the neck and back, and these were unusually small.

Range and habitat

There are several geographically isolated populations of cheetah, all of which are found in Africa or southwestern Asia. A small population (estimated at about fifty) survive in the Khorasan Province of Iran, where conservationists are taking steps to protect them.[17] There have also been several unconfirmed reports of Asiatic Cheetahs in the Balochistan province of Pakistan, with at least one dead animal being discovered recently.[18]

The cheetah thrives in areas with vast expanses of land where prey is abundant. The cheetah likes to live in an open biotope, such as semidesert, prairie, and thick brush, though it can be found in a variety of habitats. In Namibia, for example, it lives in grasslands, savannahs, areas of dense vegetation, and mountainous terrain.

In much of its former range, the cheetah was tamed by aristocrats and used to hunt antelopes in much the same way as is still done with members of the greyhound group of dogs.

Reproduction and behavior

A cheetah cub

Females reach maturity in twenty to twenty-four months, and males around twelve months (although they do not usually mate until at least three years old), and mating occurs throughout the year. A study of cheetahs in the Serengeti showed females are sexually promiscuous and often have cubs by many different males.[19]

Females give birth to up to nine cubs after a gestation period of ninety to ninety-eight days, although the average litter size is three to five. Cubs weigh from 150 to 300 g (5.3 to 11 oz) at birth. Unlike some other cats, the cheetah is born with its characteristic spots. Cubs are also born with a downy underlying fur on their necks, called a mantle, extending to mid-back. This gives them a mane or Mohawk-type appearance; this fur is shed as the cheetah grows older. It has been speculated this mane gives a cheetah cub the appearance of the honey badger (ratel), to scare away potential aggressors.[20] Cubs leave their mother between thirteen and twenty months after birth. Life span is up to twelve years in the wild, but up to twenty years in captivity.

Unlike males, females are solitary and tend to avoid each other, though some mother/daughter pairs have been known to be formed for small periods of time. The cheetah has a unique, well-structured social order. Females live alone, except when they are raising cubs and they raise their cubs on their own. The first eighteen months of a cub's life are important; cubs must learn many lessons, because survival depends on knowing how to hunt wild prey species and avoid other predators. At eighteen months, the mother leaves the cubs, who then form a sibling ("sib") group that will stay together for another six months. At about two years, the female siblings leave the group, and the young males remain together for life.

Territories

Males

Male cheetah marking territory

Males are often social and may group together for life, usually with their brothers in the same litter; although if a cub is the only male in the litter then two or three lone males may form a group, or a lone male may join an existing group. These groups are called coalitions. In one Serengeti, 41% of the adult males were solitary, 40% lived in pairs and 19% lived in trios.[21]

A coalition is six times more likely to obtain an animal territory than a lone male, although studies have shown that coalitions keep their territories just as long as lone males— between four and four and a half years.

Males are territorial. Females' home ranges can be very large and a territory including several females' ranges is impossible to defend. Instead, males choose the points at which several of the females' home ranges overlap, creating a much smaller space, which can be properly defended against intruders while maximizing the chance of reproduction. Coalitions will try their best to maintain territories to find females with whom they will mate. The size of the territory also depends on the available resources; depending on the part of Africa, the size of a male's territory can vary greatly from 37 to 160 km2 (14 to 62 sq mi).

Males mark their territory by urinating on objects that stand out, such as trees, logs, or termite mounds. The whole coalition contributes to the scent. Males will attempt to kill any intruders, and fights result in serious injury or death.

Females

Female cheetah and cubs in the Ngorongoro Conservation Area

Unlike males and other felines, females do not establish territories. Instead, the area they live in is termed a home range. These overlap with other females' home ranges, often those of their daughters, mothers, or sisters. Females always hunt alone, although cubs will accompany their mothers to learn to hunt once they reach the age of five to six weeks.

The size of a home range depends entirely on the availability of prey. Cheetahs in southern African woodlands have ranges as small as 34 km2 (13 sq mi), while in some parts of Namibia they can reach 1,500 km2 (580 sq mi).

Vocalizations

The cheetah cannot roar, but does have the following vocalizations:

  • Chirping: When a cheetah attempts to find another, or a mother tries to locate her cubs, it uses a high-pitched barking called chirping. The chirps made by a cheetah cub sound more like a bird chirping, and so are termed chirping, too.
  • Churring or stuttering: This vocalization is emitted by a cheetah during social meetings. A churr can be seen as a social invitation to other cheetahs, an expression of interest, uncertainty, or appeasement or during meetings with the opposite sex (although each sex churrs for different reasons).
  • Growling: This vocalization is often accompanied by hissing and spitting and is exhibited by the cheetah during annoyance, or when faced with danger.
  • Yowling: This is an escalated version of growling, usually displayed when danger worsens.
  • Purring: This is made when the cheetah is content, usually during pleasant social meetings (mostly between cubs and their mothers). A characteristic of purring is that it is realized on both egressive and ingressive airstream, as seen and heard on online video and audio.[22][23][24][25]

Diet and hunting

A cheetah strangling an impala, Timbavati Game Reserve, South Africa

The cheetah is a carnivore, eating mostly mammals under 40 kg (88 lb), including the Thomson's gazelle, the Grant's gazelle, the springbok and the impala. The young of larger mammals such as wildebeests and zebras are taken at times, and adults too, when cheetahs hunt in groups. Guineafowl and hares are also prey. While the other big cats often hunt by night, the cheetah is a diurnal hunter. It hunts usually either early in the morning or later in the evening when it is not so hot, but there is still enough light.

The cheetah hunts by vision rather than by scent. Prey is stalked to within 10–30 m (33–98 ft), then chased. This is usually over in less than a minute, and if the cheetah fails to make a catch quickly, it will give up. The cheetah has an average hunting success rate of around 50%.[8]

Running at speeds between 112 and 120 km/h (70 and 75 mph) puts a great deal of strain on the cheetah's body. When sprinting, the cheetah's body temperature quickly elevates. If it is a hard chase, it sometimes needs to rest for half an hour or more.

The cheetah kills its prey by tripping it during the chase, then biting it on the underside of the throat to suffocate it; the cheetah is not strong enough to break the necks of the four-legged prey it mainly hunts. The bite may also puncture a vital artery in the neck. Then the cheetah proceeds to devour its catch as quickly as possible before the kill is taken by stronger predators.

The diet of a cheetah is dependent upon the area in which it lives. For example, on the East African plains, its preferred prey is the Thomson's gazelle. This small antelope is shorter than the cheetah (about 53–67 cm (21–26 in) tall and 70–107 cm (28–42 in) long), and also cannot run faster than the cheetah (only up to 80 km/h (50 mph)), which combine to make it an appropriate prey. Cheetahs look for individuals which have strayed some distance from their group, and do not necessarily seek out old or weak ones.

A cheetah in pursuit of Thomson's gazelle in Ngorongoro Crater, Tanzania

Interspecific predatory relationships

Despite their speed and hunting prowess, cheetahs are largely outranked by other large predators in most of their range. Because they have evolved for short bursts of extreme speed at the expense of their power, they cannot defend themselves against most of Africa's other predator species. They usually avoid fighting and will surrender a kill immediately to even a single hyena, rather than risk injury. Because cheetahs rely on their speed to obtain their meals, any injury that slows them down could essentially be life threatening.

A cheetah has a 50% chance of losing its kill to other predators.[8] Cheetahs avoid competition by hunting at different times of the day and by eating immediately after the kill. Due to the reduction in habitat in Africa, cheetahs in recent years have faced greater pressure from other native African predators as available range declines.[citation needed]

The cheetah's mortality is very high during the early weeks of its life; up to 90% of cheetah cubs are killed during this time by lions, leopards, hyenas, wild dogs, or even by eagles. Cheetah cubs often hide in thick brush for safety. Mother cheetahs will defend their young and are at times successful in driving predators away from their cubs. Coalitions of male cheetahs can also chase away other predators, depending on the coalition size and the size and number of the predator. Because of its speed, a healthy adult cheetah has few enemies.[26]

Relationship with humans

Economic importance

Cheetah fur was formerly regarded as a status symbol. Today, cheetahs have a growing economic importance for ecotourism and they are also found in zoos. Cheetahs are far less aggressive than other felids and can be tamed, so cubs are sometimes illegally sold as pets.

Cheetahs were formerly, and sometimes still are, hunted because many farmers believe that they eat livestock. When the species came under threat, numerous campaigns were launched to try to educate farmers and encourage them to conserve cheetahs. Recent evidence has shown that cheetahs will not attack and eat livestock if they can avoid doing so, as they prefer their wild prey. However, they have no problem with including farmland as part of their territory, leading to conflict.

Taming

A tamed cheetah offered as tribute to the King of Thebes (1700 B.C.)

Ancient Egyptians often kept cheetahs as pets, and also tamed and trained them for hunting. (But not domesticated i.e., bred under human control.) Cheetahs would be taken to hunting fields in low-sided carts or by horseback, hooded and blindfolded, and kept on leashes while dogs flushed out their prey. When the prey was near enough, the cheetahs would be released and their blindfolds removed. This tradition was passed on to the ancient Persians and brought to India, where the practice was continued by Indian princes into the twentieth century. Cheetahs continued to be associated with royalty and elegance, their use as pets spreading just as their hunting skills were. Other such princes and kings kept them as pets, including Genghis Khan and Charlemagne, who boasted of having kept cheetahs within their palace grounds. Akbar the Great, ruler of the Mughal Empire from 1556 to 1605, kept as many as 1000 cheetahs.[8] As recently as the 1930s the Emperor of Ethiopia, Haile Selassie, was often photographed leading a cheetah by a leash.

Conservation status

Cheetah at the Werribee Open Range Zoo

Cheetah cubs have a high mortality rate due to predation by other carnivores, such as the lion and hyena, and perhaps genetic factors. It has been suggested that the low genetic diversity of cheetahs is a cause of poor sperm, birth defects, cramped teeth, curled tails, and bent limbs. Some biologists even believe that they are too inbred to flourish as a species.[27] Note, however, that they lost most of their genetic diversity thousands of years ago (see the beginning of this article), and yet seem to have only been in decline in the last century or so, suggesting factors other than genetics are mainly responsible.

A cheetah at the Whipsnade Zoo in Dagnall, England.

Cheetahs are included on the International Union for Conservation of Nature (IUCN) list of vulnerable species (African subspecies threatened, Asiatic subspecies in critical situation) as well as on the US Endangered Species Act: threatened species - Appendix I of CITES (Convention on International Trade in Endangered Species). Approximately 12,400 cheetahs remain in the wild in twenty-five African countries; Namibia has the most, with about 2,500. Another fifty to sixty critically endangered Asiatic cheetahs are thought to remain in Iran. There have been successful breeding programs, including the use of in vitro fertilisation, in zoos around the world.

Founded in Namibia in 1990, the Cheetah Conservation Fund's mission is to be the world’s resource charged with protecting the cheetah and ensuring its future on our planet. The organization works with all stakeholders within the cheetah’s ecosystem to develop best practices in research, education and ecology and create a sustainable model from which all other species, including people, will benefit.

The South African Cheetah Conservation Foundation has close links and assists in training and sharing program successes with other countries where cheetahs live, including Botswana, South Africa, Zimbabwe, Iran and Algeria. The organization's international program includes distributing materials, lending resources and support, and providing training through Africa and the rest of the world.

Re-introduction project in India

Cheetahs have been known to exist in India for a very long time, but as a result of hunting and other causes, cheetahs have been extinct in India since the 1940s. A captive propagation project has been proposed. Minister of Environment and Forests Jairam Ramesh told the Rajya Sabha on 7 July 2009, "The cheetah is the only animal that has been described extinct in India in the last 100 years. We have to get them from abroad to repopulate the species." He was responding to a call for attention from Rajiv Pratap Rudy of the Bharatiya Janata Party (BJP). "The plan to bring back the cheetah, which fell to indiscriminate hunting and complex factors like a fragile breeding pattern is audacious given the problems besetting tiger conservation." Two naturalists, Divya Bhanusinh and MK Ranjit Singh, suggested importing cheetahs from Africa, after which they will be bred in captivity and, in time, released in the wild.[28]

In popular culture

Notes

  1. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 532–533. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3. 
  2. ^ Bauer, H., Belbachir, F., Durant, S., Hunter, L., Marker, L., Packer, K. & Purchase, N. (2008). Acinonyx jubatus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 9 October 2008.
  3. ^ Sharp, N. C. (1994). "Timed running speed of a cheetah (Acinonyx jubatus)". Journal of Zoology, London 241 (3): 493–494. doi:10.1111/j.1469-7998.1997.tb04840.x. 
  4. ^ Milton Hildebrand (1959). "Motions of Cheetah and Horse". Journal of Mammalogy 40 (4): 481–495. doi:10.2307/1376265. JSTOR 1376265. [dead link] Although according to Cheetah, Luke Hunter and Dave Hamman, (Struik Publishers, 2003), pp. 37–38, the cheetah's fastest recorded speed was 110 km/h (68 mph).
  5. ^ Kruszelnicki, Karl S. (1999). "Fake Flies and Cheating Cheetahs". Australian Broadcasting Corporation. http://www.abc.net.au/science/k2/moments/gmis9911.htm. Retrieved 2007-12-07. 
  6. ^ http://www.cheetah.org/?nd=cheetah_facts
  7. ^ cheetah (n.d.). The American Heritage Dictionary of the English Language, Fourth Edition. http://dictionary.reference.com/browse/cheetah. Retrieved 2007-04-16. 
  8. ^ a b c d e O'Brien, S., D. Wildt, M. Bush (1986). "The Cheetah in Genetic Peril". Scientific American 254: 68–76. 
  9. ^ Young, T.P. and A.H. Harcourt (1997). "Viva Caughley!". Conservation Biology 11: 831–832. 
  10. ^ Johnson, W. E., E. Eizirik, J. Pecon-Slattery, W. J. Murphy, A. Antunes, E. Teeling, S. J. O'Brien (2006). "The Late Miocene Radiation of Modern Felidae: A Genetic Assessment". Science 311 (5757): 73–77. doi:10.1126/science.1122277. PMID 16400146. 
  11. ^ a b Mattern, M. Y., D. A. McLennan (2000). "Phylogeny and Speciation of Felids". Cladistics 16 (2): 232–253. doi:10.1111/j.1096-0031.2000.tb00354.x. 
  12. ^ Wilson, Don E.; Reeder, DeeAnn M., eds. (2005). Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3. 
  13. ^ [1] (2011).
  14. ^ Boitani, Luigi, Simon & Schuster's Guide to Mammals. Simon & Schuster/Touchstone Books (1984), ISBN 978-0-671-42805-1
  15. ^ [2] (2011).
  16. ^ [3]
  17. ^ "Asiatic Cheetah". Wild About Cats. http://www.wildaboutcats.org/asiatic.htm. Retrieved 2007-12-07. 
  18. ^ "Asiatic Cheetah". WWF-Pakistan. http://www.wwfpak.org/sc_asiaticcheetah.php. Retrieved 2007-12-07. 
  19. ^ "Scandal on the Serengeti: New light has been shed on the extent of female cheetahs' unfaithfulness to their male partners.". inthenews.co.uk. May 30, 2007. http://www.inthenews.co.uk/infocus/features/in-focus/scandal-on-serengeti-$1090967.htm. Retrieved 2007-12-07. 
  20. ^ Eaton, Randall L. (1976) A Possible Case of Mimicry in Larger Mammals. Evolution 30(4):853-856 doi 10.2307/2407827
  21. ^ Richard Estes, foreword by Edward Osborne Wilson (1991) The Behavior Guide to African Mammals. University of California Press. Page 371.
  22. ^ http://ingressivespeech.info
  23. ^ http://roberteklund.info/Wildlife.htm
  24. ^ http://purring.org
  25. ^ Eklund, Peters & Duthie (2010)
  26. ^ M. W. Hayward, M. Hofmeyr, J. O'Brien & G. I. H. Kerley (2006). "Prey preferences of the cheetah (Acinonyx jubatus) (Felidae: Carnivora): morphological limitations or the need to capture rapidly consumable prey before kleptoparasites arrive?". Journal of Zoology 270 (4): 615. doi:10.1111/j.1469-7998.2006.00184.x. http://www3.interscience.wiley.com/journal/118624020/abstract?CRETRY=1&SRETRY=0. Retrieved 2008-10-05. 
  27. ^ Gugliotta, Guy (2008-02). "Rare Breed". Smithsonian Magazine. http://www.smithsonianmag.com/science-nature/rare-breed.html. Retrieved 2008-03-07. 
  28. ^ The Times of India, Thursday, July 9, 2009, p. 11.

References

  • Great Cats, Majestic Creatures of the Wild, ed. John Seidensticker, illus. Frank Knight, (Rodale Press, 1991), ISBN 0-87857-965-6
  • Cheetah, Katherine (or Kathrine) & Karl Ammann, Arco Pub, (1985), ISBN 0-668-06259-2.
  • Cheetah (Big Cat Diary), Jonathan Scott, Angela Scott, (HarperCollins, 2005), ISBN 0-00-714920-4
  • Science (vol 311, p 73)
  • Cheetah, Luke Hunter and Dave Hamman, (Struik Publishers, 2003), ISBN 1-86872-719-X
  • Allsen, Thomas T. (2006). "Natural History and Cultural History: The Circulation of Hunting Leopards in Eurasia, Seventh-Seventeenth Centuries." In: Contact and Exchange in the Ancient World. Ed. Victor H. Mair. University of Hawai'i Press. Pp. 116–135. ISBN ISBN 978-0-8248-2884-4; ISBN ISBN 0-8248-2884-4
  • Eklund, Robert, Gustav Peters & Elizabeth D. Duthie. 2010 (third edition). An acoustic analysis of purring in the cheetah (Acinonyx jubatus) and in the domestic cat (Felis catus). Proceedings of Fonetik 2010, Lund University, 2–4 June 2010, Lund, Sweden, pp. 17–22. Download from [4] or [5].
  • Gus Mills, M. G. L. Mills, Martin Harvey (2005). African Predators. Struik. ISBN 1-77007-220-9. 
  • Gus Mills (1998). Big Cats and Other African Carnivores. Struik. ISBN 1-86825-920-X. 

Further reading

  • Caro, T. M. (1994). Cheetahs of the Serengeti Plains: group living in an asocial species. Chicago: University of Chicago Press. ISBN 0-226-09433-2. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!