Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (5) (learn more)

Overview

Brief Summary

Biology

Argalis are highly gregarious animals, found in large single-sex herds that may number up to 100 individuals (2). During the mating season, these herds come together and males will compete for access to the receptive females (2). These are often violent and the clashing of horns can be heard reverberating around the mountains (2). Around 5 months later, females give birth to a litter of 1 or 2 lambs; they separate from the main herd in order to give birth and the newborns remain hidden in the grass whilst their mother feeds (2).  These sheep graze on grasses, herbs and sedges; herds may migrate to higher elevations during the summer months in search of fresh pasture (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The argali is the largest of the wild sheep, and the males have impressive horns that are highly prized by hunters (2). Currently 9 different subspecies are recognised, which vary both in their appearance and in their range (1)(2). In general, argalis have a light brown coat with white legs and a white rump patch (4). Although both sexes have horns, those of the male are much larger and more impressive; they can be up to 13% of the males' body mass (4). The corkscrew horns wind forwards and are of a formidable weight; those of mature Altai argali (Ovis ammon ammon) males weigh 20 - 22 kg (4). Males also have a ruff of white hair around the neck and a pronounced crest along the back, which adds to their impressive appearance (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in northeastern Afghanistan, China (Gansu, Inner Mongolia, Qinghai, possibly western Sichuan, Tibet, and Xinjiang), northern India (Ladakh, Sikkim, and Spiti), eastern Kazakhstan, eastern Kyrgyzstan, Mongolia, northern Nepal (near the Chinese border), extreme northern Pakistan, Russia (Tuvan and Altai Republics in the Altai Mountains), eastern Uzbekistan, and eastern Tajikistan (Fedosenko and Blank 2005). There are no recent records of argali occurrence in Bhutan (Tschewang Wangchuck pers. comm., 2008).

Afghanistan
Argali were historically present in much of the Afghan Pamirs of the Wakhan district (Habibi 1977, Petocz 1973, Petocz et al. 1978), between the Panj (Amu Darya) and Wakhan Rivers, but were not known from elsewhere in Afghanistan during recent times. They currently occupy the western section of the Big Pamirs, most of the Little Pamirs, and are often found in the Wakhjir Valley as well (Harris and Winnie 2008, Schaller and Kang 2008). Their status in the eastern portion of the Big Pamir, where they were documented by Petocz (1978) in the early 1970s remains uncertain. They are occasionally reported from elsewhere within the Wakhan Corridor. These animals are considered to be O. a. polii.

China
Argali are distributed in most mountain ranges of Xinjiang (Yu et al. 1999), including the Altai Shan, Arjin Shan, Kara-Kunlun Shan, Pamirs, and Tian Shan and associated ranges. Some authorities consider all these argali except those in the Pamirs to be O. a. karelini; others sub-divide these into other subspecies. Within the ranges of the Tibetan Plateau, argali are distributed discontinuously and irregularly (Liu and Yin 1993, Schaller 1998, Schaller et al. 2007, Harris 2007). Although present in ranges from the Himalaya to the Qilian Shan in Gansu, argali on the Tibetan Plateau appear to be rare where temperatures are exceedingly low, winter snows deep, and/or precipitation amounts too low to support grass (Harris 2007). However, relatively healthy populations occur in the Qilian and Kunlun Mountains of Gansu and Qinghai (although from written accounts, argali are rare in the drier, western portions of the Kunlun Shan [Feng 1990, G. Schaller, unpublished data, 2001]). Chinese sources report the species as present in extreme western Sichuan (Wang 2002) but recent documentation of this is weak. Most authors consider argali on the Tibetan Plateau (including the Qilian Shan in Gansu) O. a. hodgsoni, although some Chinese authors consider O. a. hodgsoni limited to southern Tibet, and consider argali north of that to be O. a. dalailamae. Argali are patchily distributed in Inner Mongolia (Bu et al. 1998). They are historically known from parts of Shaanxi and Ningxia Provinces (in the Helan Shan, which forms Ningxia’s western border with Inner Mongolia), but recent records suggest that they no longer occurs in either of these provinces (Liu Zhensheng, Gong Minghao pers. comm., 2008). These animals are variously described as O. a. darwini or O. a. jubata.

India
Within India, argali are restricted to the eastern plateau of Ladakh, a nearby area in Spiti (Himachal Pradesh), and, separately, in northern Sikkim adjacent to Tibet (Fox and Johnsingh 1997, Bhatnagar 2003, Ul-Haq 2003, Namgail et al. 2004). Indian biologists consider these animals O. a. hodgsoni.

Kazakhstan
In Kazakstan, argali (usually considered O.a. collium) are present in the Kazakhshiy and Melkosopoachnik regions, north of Lake Balkash, in the northeastern part of the country. Small populations are also present in the Kara-Tau Mountains (O. a. nigrimontana, although Shakula 2000 raised doubts about the validity of this subspecies), and the ranges of the West Tian Shan, both north and west of Almaty (Weinberg et al. 1997). O. severtzovi historically inhabited the Beltau Mountains and eastern portions of the Aktau range (Ishunin 1970), but the subspecies is believed to be extirpated from Kazakhstan (N. Beshko pers. comm.).

Kyrgyzstan
In Kyrgyzstan, argali are present along the eastern quarter of the country toward the Chinese border from Kazakhstan in the north to Tajikistan in the south, as well as along portions of the eastern Tian Shan toward the Uzbek border (Fedosenko and Blank 2005). Animals in southern southeastern Kyrgyzstan are usually considered O. a. polii; some authorities consider those in northern Kyrgyzstan O. a. karelini, but geographic and morphological separation remains unclear.

Mongolia
Argali are distributed widely, but patchily across a large portion of Mongolia. Historically, argali occurred in disjunct populations across all, but eastern Mongolia, in areas with rolling hills, mountains, rocky outcrops, canyons, and plateaus (Amgalanbaatar and Reading 2000, 2003, Reading et al. 2001). Argali appear to be expanding their distribution in eastern Mongolia, but contracting and becoming even more fragmented in western Mongolia (Mallon et al. 1997, Amgalanbaatar and Reading 2000, Amgalanbaatar et al. 2002a, 2002b, Clark et al. 2006). Large areas formerly occupied by argali in western Mongolia now lack the species. The species current distribution includes portions of the Altai, Trans-Alai, Gobi-Altai, Khangai, Khentie, and Khovsgol Mountain ranges, as well as isolated areas in the Gobi Desert (Amgalanbaatar et al. 2002b, Clark et al. 2006). More specifically, isolated populations exist in the mountains of the Mongolian Altai and Gobi Altai Mountains, primarily the western and southern Khangai Mountains, near the source of the Arsain River in the Khovsgol Mountains, and the southernmost Khentii Mountains. Other populations persist patchily in the Dzungarian Gobi Great Gobi, Trans-Altai Gobi, Alashan Gobi, Middle Gobi, and eastern Gobi (Bannikov 1954, Dulamtseren 1970, Sokolov and Orlov 1980, Reading et al. 1997, 2001, Amgalanbaatar et al. 2002a, 2002b, Fedosenko and Blank 2005, Clark et al. 2006)).

Nepal
Argali (usually considered O. a. hodgsoni) are known from the Damodar Kunda area of Mustang District, bordering Tibet (Shrestha et al. 2005). They may also persist in the Dolpo region, north of the Dhualagiri Range (Wegge and Oli 1997).

Pakistan
Argali in Pakistan are known only from Khunjerab National Park (KNP) and environs, including the Khunerab, Kilik, and Mintaka passes with China (Hess et al. 1997, Khan and Khan, n.d.). It is unknown whether argali (considered O. a. polii) use the mountains separating these areas from Afghanistan’s Wakhan Corridor to the west.

Russia
Argali were formerly found in Zabaikal, Kuray, and the South-Chuya ranges and the Ukok plateau (Weinberg et al. 1997). More recently, they are known only from Tuva and Altai Republics (Weinberg et al. 1997, Paltsyn 2001, Maroney 2004). Russian authorities considered these O. a. ammon.

Tajikistan
Argali are present through most of the eastern third of Tajikistan (Luschekina 1994, Weinberg et al. 1997, Schaller and Kang 2008), from the border with Xinjiang, China west to Langar in the south and Sarez Lake in the north. Authors agree that all argali in Tajikistan are O. a. polii.

Uzbekistan
O. ammon severtzovi was previously distributed over a wide area of Uzbekistan from the northeastern part of the Pamiro-Alaya mountain range rhought the low mountains of the Kyzylkum Desert. Historically, it occupied the mountains of Nuratau, Aktau, Koratau, Malguzar east of Turkenstanski in Pistalitau, Tamdytau, Bukantua, Kuldjuktau, and other low ranges in the Kyzylkum Desert (Ishunin 1970, N. Beshko pers. comm.). Today, the majority of animals surviving are restricted to the higher mountains of Nuratau, primarily with the Nuratinski Strictly Protected Area, north of Samarkand (Uzbekistan). Very small populations persist in the western Aktau, Tamdytau, and Malguzar Ranges (N. Beshko pers. commun.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Argali sheep are found in mountainous areas in central Asia above 1000 m. This species has a wide range with several localized subspecies recognized. The range of the argali sheep covers the Irtysh River and Altrai Mountains in Siberia, south to the Himalayas in Tibet. It stretches to cover the land west to the Oxus river near Afghanistan, and eastward to the Mongolian plateau.

Biogeographic Regions: palearctic (Native )

  • Clark, J. 1970. The Great Arc Of The Wild Sheep. Norman: University of Oklahoma Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Afganistan, China, India, Kazakhstan, Kyrgyzstan, Mongolia, Nepal, Pakistan, Russia, Tajikistan, Uzbekistan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Argalis are found throughout central Asia; the subspecies are confined to different areas, ranging from O. a. severtzovi in Uzbekistan to the west and the Altai argali (O. a. ammon) in Mongolia to the east (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Ovis ammon is the largest of the world’s sheep, weighing in between 60 and 185 kg. Shoulder height is between 90 and 125 cm. Horns are a prominent feature on these animals. They have a corkscrew shape with rounded combat edges. Males and females both have horns, although the horns of females are smaller. The male’s horns can be up to 190 cm in length, measured along the coil.

The coloration of the argali sheep is two-toned with a dark band running laterally along the belly, separating the dark brown upper half from the pale hair below. Argali sheep have a distinct, light rump patch and pale face. Males generally have a light colored neck. The coat is shed twice yearly, with the summer coat being darker and the winter coat having a longer hair length.

Range mass: 60 to 185 kg.

Average mass: 160 kg.

Range length: 120 to 190 cm.

Average length: 180 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Argali inhabit mountains, steppe valleys and rocky outcrops (Reading et al., 1997; Schaller 1998; Amgalanbaatar and Reading, 2000; Harris 2007); they also occur in open desert habitats at the south-eastern end of its range (Reading et al., 2003; Tserenbataa et al., 2004; Reading et al., 2005). Argali are sensitive to deep snow, particularly if forage is limiting; often migrating from high mountain habitats during winter, but are present all year round at lower elevations in the Gobi desert (Reading et al., 2005). Most argali live on alpine grasslands between 3,000-5,500 m, often descending lower in winter (particularly if snow accumulates to more than a few cm). In some areas, (e.g., Gobi desert of southern Mongolia, Karaganda area of Kazakhstan), they live in lower elevation, semi-arid areas. They generally avoid forested areas (except in Kazakhstan, where they are presumed to occupy forests because of displacement from preferred habitats, Fedonsenko and Blank 2005). They prefer to occupy open areas with a gentle slope; females generally occupy steeper (cliff) terrain following lambing. Argali feed on grasses, sedges, and some herbs and lichens, and they regularly drink from open springs and rivers. Where sympatric with blue sheep they are more likely to occur in grass-dominated communities compared to the sedge-dominated communities occupied by blue sheep. Argali are gregarious and live in groups from 2-150 individuals. Wolves (Canis lupus) are their primary natural predator. Gestation is about 160 days, and females give birth to one offspring (twins are occasionally reported in the literature, but documentation is poor). Mothers separate from the herd to give birth and remain alone with her offspring for several days. Females are sexually mature at 2 years, while males may not sexually mature until 5 years. Maximum life-span is 10-13 years (Fedosenko and Blank 2005).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Argali sheep usually occupy the same areas for the duration of their lives. They are found at upper elevations on steep slopes above 1000 m. Adult males are larger and faster than females, and do not have as great a need to avoid predators. They therefore choose prime vegetative habits that are more exposed than are those chosen by females and young rams. During summertime as food becomes available, higher elevations are chosen by all animals.

The landscape of central Asia is vast and mostly open. Mountains have been worn down by erosion and huge sloping hills remain, allowing a great range of visibility for the animals which live there. Vegetation is dominated by grasses, with very few trees present on the landscape.

Range elevation: 1000 to 6000 m.

Average elevation: 3000 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: mountains

  • Geist, V. 1991. On the taxonomy of giant sheep (Ovis ammon Linnaeus, 1766). Canadian Journal of Zoology, 69: 706-723.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Argalis are found in mountainous areas between 1,300 and 6,100 metres above sea level (2), where there are dry alpine habitats (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The landscape inhabited by these sheep is free of trees, but plentiful in food easily and efficiently digested. Argali sheep are herbivorous and feed on grasses, herbs, and sedges. Females and young rams feed in higher altitude terrain with diminished food quality. These feeding locations provide easy escape protection from predators. Adult males feed in lower terrain with higher food quality and use fast, sustained running to evade predators.

Argali sheep are grazers that have adapted to survive in an arid, windy and extreme climate of their high altitude home.

Plant Foods: leaves; seeds, grains, and nuts

Primary Diet: herbivore (Folivore , Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Threatened Vertebrate Associates in the Hindu Kush Alpine Meadow Ecoregion

The Hindu Kush alpine meadow has an expanse of some 10,900 square miles, situated in northeastern Afghanistan and northern Pakistan. Most of the lands lie within the Hindu Kush Mountain Range in  the altitude bracket between 3000 to 4000 meters, and correspondingly most of the precipitation is in the form of snow. This ecoregion is classified within the Montane Grasslands and Shrublands biome.

This ecoregion manifests a low rate of vertebrate endemism; however there are ten special status mammals found here, ranging from the status of Endangered to Near Threatened. The Hindu Kush alpine meadow ecoregion consists of higher elevation terrain of moderate to severe slopes. Vegetation is often sparse or almost lacking, with resulting pastoral usage of low intensity grazing of goats and sheep in some areas. Soils are largely leptosols, but many areas are covered by large expanses of rock outcrop or rocky scree. In the limited areas of arable soils, wheat is sometimes farmed, although growing of opium poppies is the only cash crop. Most of the water available for plant and animal life is supplied by snowmelt. The Helmand River, Afghanistan's largest watercourse, represents the chief catchment within the ecoregion, with headwaters rising in the Hindu Kush Range, and eventual discharge to the endorheic Sistan Basin.

Special status mammals found in the Hindu Kush alpine meadow are: the Near Threatened argali (Ovis ammon), the Vulnerable Asiatic black bear (Ursus thibetanus), the Near Threatened European otter (Lutra lutra), the Near Threatened leopard (Panthera pardus), the Endangered markhor (Capra falconeri), the Near Threatened mountain weasel (Mustela altaica), the Near Threatened Schreiber's long-fingered bat (Miniopteris schreibersi), the Endangered snow leopard (Uncia uncia), the Near Threatened striped hyena (Hyaena hyaena) and the Endangered Moschus leucogaster. Special status birds in the Hindu Kush alpine meadow are represented by the Endangered Egyptian vulture (Neophron percnopteris).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan and World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Ecosystem Roles

Argali sheep play a role in plant succesion, because their feeding habits allow grasses to flourish over sedges. This species is also a very important prey item for endangered snow leopard populations.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Argali sheep stay in areas inaccessible to predators, such as high on hills or on steep embankments with good viewpoints.

Due to their large size, Argali sheep are poor jumpers and do not usually jump as an escape techniwque, although this is a more common practice in the smaller females and young animals. Powerful long legs help these sheep run over all types of terrain.

To avoid predation all animals in a herd move together and stay with group. If an Argali sheep is alone, it will sometimes remain motionless in the hope of being overlooked by a predator. Using the horns for defense is very uncommon.

Predators of Argali sheep are wolves, snow leopards, and leopards. They have also been heavily hunted by humans.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Ovis ammon is prey of:
Homo sapiens
Canis lupus
Panthera pardus
Uncia uncia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

These sheep communicate with hissing through the nostrils or grunts from the throat. Communication is important for mother and young and is based on visual, oral and scent confirmations. Also, communication through scent glands is not well understood but thought to be important for sexual signaling. Males can smell females that are fertile and ready to mate. Distinctive pelage can be a lon-sidtance visual signal to other sheep of where other herds are. This information can be used by the sheep when deciding to avoid or join other groups.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

During the first 4 months before weaning, young lambs rapidly put on body weight and increase in size. Muscle tone and coordination are further developed during nursing. Until about age two social skills are learned. A one year old could mate physiologically but does not have necessary social skills. Social skills are important since sheep are very social animals and spend their entire lives in groups. By age 5 an Argali sheep is fully mature. A sheep lives on average for about 10 years with some rams living up to 20 years.

(Nowak 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of Argali sheep is on average 10 to 13 years. Predators and extreme climatic conditions kill older sheep, so maximum lifespan is seldom achieved. Males can generally live longer than females.

Range lifespan

Status: wild:
1 to 20 years.

Average lifespan

Status: wild:
10-13 years.

Typical lifespan

Status: wild:
7 to 11 years.

Average lifespan

Status: wild:
10 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 16.8 years (captivity) Observations: In the wild these animals live up to 13 years (Bernhard Grzimek 1990). One wild born specimen was about 16.8 years old when it died in captivity (Richard Weigl 2005). Males may be sexually mature at 1.5 years of age, but do not normally breed until they are much older.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating is polygynandrous; numerous matings can occur in a season between many partners. A dominant male will mate with numerous females and will herd harems during the rut. Females will mate with numerous males if the opportunity arises. Such an opportunity may arise when the dominance among males changes or when a female leaves a herd to join another group.

Mating System: polygynandrous (promiscuous)

Reproductive habits of the world’s largest sheep can be quite extreme. Huge rams weighing 180 kg run head first into each other while in rut. They smash their horns together in intense combat designed to determine dominance relationshipes between males. Dominant males then mate with mature females in estrous.

Females are sexually mature at 2 years of age and males by 5 years. This differnce makes sense, because the males must grow so much larger than the females before they can breed.

The rut occurs in autumn and early winter, ensuring that lambs are born in the late spring. Females are fertile about every three weeks in the fall until they are impregnated.

Gestation lasts for 150 to 180 days. Females give birth to one or two lambs. Females separate from the herd to give birth and remain separated for a few days. During this time, the lamb lays motionless while the mother grazes. Lambs are precocial at birth, and can stand. Still, gaining body mass quickly is essential for survival.

A ewe can reproduce in her first year, although the majority of females wait for their second year. Females can produce young successfully for up to eight years.

After a lamb is a few months old, the relationship between mother and lamb ends. Lambs are wenaed around four months of age. Lambs usually form their own social groups.

Breeding interval: These sheep breed once per year.

Breeding season: Mating occurs in the autumn and early winter.

Range number of offspring: 1 to 2.

Range gestation period: 5.17 to 5.33 months.

Average gestation period: 8.5 months.

Range weaning age: 4 to 5 months.

Average weaning age: 4 months.

Average time to independence: 5 months.

Range age at sexual or reproductive maturity (female): 1 to 2 years.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous

Average birth mass: 3400 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
823 days.

Mothers care for young for about 4 months before weaning. Young sheep nurse before weaning, receiving milk high in fat protein and antibodies to help add body mass and sustain health and vitality. During nursing, young lambs also receive bacteria needed for ruminant digestion.

Males do not participate in care of the young.

Parental Investment: pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ovis ammon

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGATTATTTTCAACCAACCACAAAGATATCGGCACCCTTTACCTTCTATTTGGTGCCTGAGCTGGCATAGTAGGAACCGCCTTAAGCCTACTAATTCGCGCCGAACTAGGCCAACCCGGAACTCTACTCGGAGATGACCAAATCTACAACGTAATTGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCTATTATGATCGGTGGATTCGGCAACTGACTAGTCCCTCTGATAATTGGAGCCCCTGACATAGCATTTCCTCGGATAAATAACATAAGCTTTTGACTTCTTCCCCCATCTTTCCTGTTACTCTTAGCATCCTCTATGGTCGAGGCCGGAGCAGGAACAGGTTGAACCGTGTACCCTCCTCTAGCAGGCAACCTAGCCCATGCAGGAGCCTCGGTAGATCTAACTATTTTTTCCCTACACCTGGCAGGTGTCTCCTCAATTCTAGGAGCCATTAATTTTATTACAACTATTATTAATATAAAACCCCCCGCAATATCACAGTATCAAACCCCCTTATTTGTATGATCTGTACTAATTACCGCCGTACTACTCCTTCTCTCACTTCCTGTATTAGCAGCTGGCATCACAATATTACTAACGGACCGAAACCTAAATACAACCTTTTTTGACCCAGCAGGAGGAGGAGACCCTATCCTATACCAACACCTATTCTGATTCTTTGGGCACCCTGAAGTATATATTCTTATTTTACCTGGGTTTGGAATAATCTCCCATATTGTGACTTACTATTCAGGAAAAAAAGAACCATTCGGGTACATAGGAATAGTATGAGCCATAATATCAATTGGGTTTCTAGGATTTATTGTATGAGCCCATCATATATTCACAGTCGGAATAGACGTCGATACACGGGCTTACTTCACATCAGCTACTATAATTATTGCCATCCCAACAGGAGTAAAAGTATTCAGTTGACTAGCAACGCTTCATGGGGGTAATATCAAATGATCTCCTGCTATAATATGAGCCCTAGGTTTCATCTTTCTTTTCACAGTCGGAGGCTTAACCGGAATTGTTCTAGCCAACTCCTCCCTTGACATTGTCCTCCACGACACATATTACGTAGTAGCTCATTTCCACTACGTATTATCAATAGGAGCTGTATTTGCTATTATAGGAGGATTTGTACATTGATTTCCTCTATTCTCAGGCTATACTCTTAATGATACGTGAGCCAAAATCCACTTTGCAATTATATTTGTAGGTGTTAACATGACTTTCTTTCCACAACATTTCCTAGGATTATCCGGTATACCACGACGATACTCTGATTATCCAGACGCATATACAATATGAAACACTATCTCATCTATAGGCTCATTTATCTCACTAACAGCAGTAATACTAATAATTTTCATCATCTGAGAAGCATTTGCATCTAAACGAGAAGTCCTAACTGTAGACCTAACCACAACAAACCTAGAATGACTAAACGGATGTCCTCCGCCATATCACACATTTGAAGAACCCACATATGTTAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ovis ammon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Harris, R.B. & Reading, R.

Reviewer/s
Harris, R. & Festa-Bianchet, M. (Caprinae Red List Authority)

Contributor/s
Subbotin, A. & Mukhina-Kreuzberg, E.

Justification
Listed as Near Threatened because this species is believed to be in significant decline (but probably at a rate of less than 30% over three generations, taken at 24 years) due to poaching and competition with livestock, making the species close to qualifying for Vulnerable under criterion A2de..

History
  • 1996
    Vulnerable
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed: except where threatened

Status: Threatened
Date Listed: 06/23/1992
Lead Region: Foreign (Region 10) 
Where Listed: Kyrgyzstan, Mongolia, Tajikistan


Population detail:

Population location: Entire except Kyrgyzstan, Mongolia, and Tajikistan
Listing status: E

Population location: Kyrgyzstan, Mongolia, and Tajikistan
Listing status: T

For most current information and documents related to the conservation status and management of Ovis ammon , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The IUCN classifies the entire species O. ammon as vulnerable. Sport hunting has been damaging to the species, with the lure of attaining a trophy from the world’s largest sheep. Since the nineteenth century, hunting has removed this species from some of its former range. O. ammon longer present in northeastern China, southern Siberia and parts of Mongolia.

Overall numbers of individuals and dispersal have declined. Recent problems for this species include habitat loss due to competition with domestic livestock and humans encroaching.

It is interesting to note that the threats to O. ammon can also be threats to the populations of their predators, such as snow leopards, which depend greatly on a stable supply of these sheep for their own diet.

US Migratory Bird Act: no special status

US Federal List: endangered

CITES: appendix i; appendix ii

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU - A2cde) on the IUCN Red List 2002 (1), and listed on Appendix II of CITES (3). Subspecies: Altai argali (Ovis ammon ammon) classified as Vulnerable (VU - A2cde, C1); Kazakhstan argali (O. a. collium) classified as Vulnerable (VU - A2cde, C1); Gobi argali (O. a. darwini) Endangered (EN - C1); Tibetan argali (O. a. hodgsonii) Vulnerable (VU - A2cde); Northern Chinese argali (O. a. jubata) Critically Endangred (CR - C2a); Tien Shan argali (O. a. karelini) Vulnerable (VU - A2cde, C1+2a); Kara Tau argali (O. a. nigrimontana) Critically Endangered (CR - C2b); Marco Polo argali (O. a. polii) Vulnerable (VU - A2cde, C1); Kyzylkum sheep (O. a. severtzovi) Endangered (EN - A2cde, C2b) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Afghanistan
There is no comprehensive population estimate for argali in Afghanistan. In the early 1970s, Petocz et al. (1978) accounted for approximately 1,260 argali in the Pamirs (including both Big and Little Pamir segments), from which they estimated a total abundance of about 2,500. During their survey in autumn 2004 (primarily of the Little Pamir), Schaller and Kang (2008) tallied 624 argali (87% of which were in the Little Pamir), and speculated that the total number in the Wakhan might be 1,000. Some of the argali tallied in the Little Pamir may periodically cross into Tajikistan, and thus possibly be counted within surveys there. Harris and Winnie (2008) estimated that they observed 120-210 individual argali in the western segment of the Big Pamir in November-December 2007. Eight-five individuals (all males) had been encountered by B. Habib in the Wakhjir Valley near the Chinese border in July of 2007, which likely were not part of the Big Pamir counts. Efforts to refine a population estimate for Big Pamir argali are currently underway, using DNA microsatellites extracted from fecal samples.

China
Wang et al. (1997) put forward estimates of 29,000-36,000 for O. a. hodgsoni alone (in Tibet, Qinghai, and southeastern Xinjiang; although Wang [1998] subsequently wrote that such an estimate was probably a “significant overestimate”), with an additional 2,100-2,800 O. a. darwini (in Inner Mongolia), 600-700 O. a. jubata (in Inner Mongolia), 8,000-11,000 O. a. karelini (in the Tian Shan), 2,000-3,000 O. a. polii (in the Pamirs), and some additional O. a. ammon (in northern Xinjiang near the Mongolia border). This would suggest an estimate during the early 1990s of 41,700-53,500 argali in China. Later, as part of a nationwide attempt to generate numerical estimates for wildlife, Yu estimated the total number of argali in China to be between 23,298 and 31,910 (Yu Yuqun, Northwest Institute of Endangered Species, Xian, personal communication, 2004). Both of these estimates were extrapolations based on density estimates from limited areas, and neither was associated with sufficient explanation to asses their accuracy. Given the tendency for density estimates to be taken from areas known to have the densest concentrations and to use models that are usually biased high (Harris and Burnham 2001), these estimates are more likely to be biased high than low.

On the Tibetan plateau, Schaller (1998) considered that “…the total number of Tibetan argalis could be as low as 7,000”. For the Tibetan Autonomous Region, Liu and Yin (1993) estimated 5,000 argali. For Gansu, in a letter to the US Fish and Wildlife Service dated May 17, 1991, Wang Zhangyun of China’s CITES Management Office suggested that there were as many as 20,000 argali in this province alone. In Qinghai, Zheng (2003) estimated a total population for Qinghai of 3,588. Earlier, Zheng and Zhu (1990) had estimated a population size of 665 (with a 95% confidence interval of 245) within selected study sites totaling approximately 600 km² of the Bu’erhanbuda Shan portion of the Kunlun Shan (based on 18 groups observed).

There are at least four written estimates of argali abundance in the Hashiha’er International Hunting Area of Gansu encompassing the northern slopes of the Danghenan Shan and the nearby Yemanan Shan in Subei County, Gansu. A provincial survey from 1990 estimated 1,452 argali (with unspecified confidence limits of 831-2,073; Gao Jun, Gansu Wildlife Protection Bureau, Lanzhou, unpublished data), an internal report of unclear origin estimated 1,525 (with confidence limits of 990—2,060; Zhao Lianghong, Subei International Hunting Area, unpublished data), Liu et al. (2000) cited a mean density figure of 0.482 (which is higher than either of the 2 density estimates underlying the above abundance estimates, and which equates to an abundance estimate of 4,479), and Liu (2001) estimated a population of 3,294 within Yanchiwan township (which roughly equates with the Hashiha’er hunting area boundary). All of these estimates relied on some variation of ground-based distance sampling, but in no case were sampling methods described, although Liu (2001) revealed that his density estimate was based on a sample size of 6, and the total number of animals observed was 60. A brief survey in April 1999 suggested that all these estimates were biased high (R. Harris, unpublished data). In an adjacent hunting area in Aksai county, Gansu, the 1990 provincial population estimate was 1,545 (with confidence limits of 1,127—1,963; Gao Jun, unpublished data), and the density estimate from Liu et al. (2000) suggested a population size of 3,879. In contrast, ~ 1-month-long surveys in both 2000 and 2003 with KIHA staff, focusing on what was believed to be the best argali habitat, documented 204-255 individual argali, and although some were no doubt missed, Harris et al. (2005) concluded that it was highly unlikely that the total population exceeded 500.

In Xinjiang, no estimates are available specifically for the Tian Shan or Altai Mountains (although estimates for the former are in the thousands, for the latter in the hundreds). In Taxkorgan County where Xinjiang shares the Pamir range with Tajikistan and Afghanistan, Schaller et al. (1987) documented only 87 argali and believed the population to be rather small. However, a later survey (Schaller and Kang 2008) yielded documentation of 851 argali in the Taxkorgan Nature Reserve and 1,448 argali north of it. In a separate survey during the same year (2005), Gong et al. (2007) surveyed selected drainages within Taxkorgan Nature Reserve, tallying 433 argali. Based on the area sampled and assumptions about suitable habitat, they extrapolated an estimate of 1,500-1,700 argali within the Reserve. No population estimates are available for argali in Inner Mongolia, but most populations appear to be isolated and small (Wang and Schaller 1996, Bu et al. 1998, Wang 1998).

Due to the lacking of consistent trend monitoring, population trends in China are largely unknown. A population monitored periodically over 12 years in Yeniugou, in the Kunlun Mountains south of Golmud in Qinghai apparently declined (Harris and Loggers 2004); no marked difference in abundance was noted in a population monitored in Aksai, Qilian Mountains in Gansu (Harris et al. 2005).

India
Argali are very rare in Sikkim (Sharma and Lachungpa 2003), and only occasionally move into the Spiti area of Himachal Pradesh from adjacent Ladakh (Pandey 2003). Fox and Johnsingh (1997) estimated that about 200 remained in Ladahk. Namgail (2004) counted 127 in a ~500 km² study area in the Gya-Miru Wildlife Sanctuary and adjacent Tsokar Basin in spring 2003. Adding unpublished recent reports of an additional 120-140 argali elsewhere in Ladakh, he concluded that there might be slightly more than 200 argali in the Ladakh. Namgail (2004) cautioned against interpreting these later numbers as an increase of the 200 estimated earlier by Fox and Johnsingh (1997).

Kazakhstan
Sources are currently unavailable from which an estimate of the total abundance of argali in Kazakhstan might be inferred. Weinberg et al. (1997) estimated 8,000 to 10,000 in the northeastern distribution (of the putative subspecies O. a. collium), i.e., the Karaganda area, with perhaps 250 in the Kara Tau Mountains, and an unknown number in the West Tian Shan. Fedosenko (1999b) reported that Smirnov (1965, not seen) had estimated 16,000 argali in Karaganda during the early 1960s, but that later estimates in the 1970s and 1980s had put the number at 7,000 or even 5,000. A helicopter survey in November 1991 resulted in an estimate of 9,717 Karaganda argali, but whether this was a direct count or an extrapolation was not made clear by Fedosenko (1999b). Fedosenko (1999b) quotes R. Baidavletov as assuming a total abundance of 13,500 in the Karaganda area, including 6,500 in Karaganda oblast, 2,100 in Semipalatinsk oblast, 4,300 and the remainder in other oblasts as of the early 1990s. Magomedov et al. (2003) report tallying 449 individuals within a survey area of 1,544 km² in the upper course of the Baralbas River of Karaganda and Semipalatnisk, but declined to extrapolate this figure to areas not surveyed. Recent surveys in Kazakhstan revealed a disappointing picture of argali status (A. Subbotin pers. comm., 2008). Uncontrolled killing by those who carry firearms appeard to be common; local militia and customs officials had come to areas inhabited by argali and killed dozens with gun-machines. In the Kara-Tau Mountains, Shakula (2000) believed that the population could have been as low as 100 animals.

Kyrgyzstan
There is little consensus regarding the abundance of argali in Kyrgyzstan. Luschekina (1994) counted 565 individuals in the western part of the Kokshalatau range in summer 1993. Based on these counts plus older, unpublished counts, she extrapolated an estimate of 6,000 argali in northeastern Kyrgyzstan. Magomedov et al. (2003) surveyed 190 km of transects in a similar area during spring 2002, tallying 717 argali. Weinberg et al. (1997) reported “no more than 2,000” argali in Tian Shan (which may have included parts of Kazakhstan), and estimates of from 9,900 to 16,000 in the Pamir and Tian Shan of putative O.a. polii subspecies (which included parts of Tajikistan). Weinberg et al. (1997) believed argali in both the Tian Shan and Pamirs were declining. According to Fedosenko (1999b), aerial surveys conducted during winters 1990 and 1991 tallied 5,493 argali, and estimated a total population of approximately 8,000 in the early 1990s. Fedosenko and Blank (2005) reported estimates of argali in Kygzystan as 10,000-12,000 in the Pamir and 5,000 in the Tian Shan, but without citing sources or methods. Based on extrapolations from counts in Aksai, Arpa-Naryn, Dzhety-Oguz, and Issyk-Kul oblasts, Kyrgyz government surveys have estimated approximately 15,900 argali in 2006, slightly lower than in previous years, and down from an estimated 26,000 in 2003.

Mongolia
No rigorous population estimates exist for Mongolia nation-wide. The Mongolian Academy of Sciences has conducted a few country-wide surveys; however, the methods used do not permit accurate population estimation. Alternatively, they do provide some measure of population trends because similar methods were used. The methods involved several teams of biologists driving and hiking in areas known to at least historically contain populations of argali sheep and discussions with local people and local government officials in these areas. These surveys yielded round number estimates (lacking measures of precision) of 40,000 in 1970, 50,000 in 1975, 60,000 in 1985, and between 13,000-15,000 in 2001 (Dulamtseren 1970, Amgalanbaatar et al. 2002b, Zahler et al. 2004, Clark et al. 2006, Mongolian Academy of Sciences, unpubl. Data). Reading et al. 1997 suggested that no more than 20,000 argali inhabited Mongolia in 1994. The 2001 Academy of Sciences survey suggested that approximately 10,000 – 12,000 argali inhabited the Gobi Region of Mongolia (roughly corresponding to the range of O. a. darwini) and 3,000 – 5,000 argali inhabited the Altai Region (roughly the range of O. a. ammon in Mongolia). It is difficult to gauge the accuracy of these figures given the methods and data provided in government reports, but on regional distribution data, it does appear that argali continue to decline in western and central Mongolia, while populations in eastern Mongolia appear to be expanding. Argali populations in southern Mongolia appear to be relatively stable. Probably no more than a few thousand Altai argali (O. a. ammon) persist in Mongolia, while several thousand Gobi argali (the putative O. a. darwini) inhabit a growing range in the south and east.

Nepal
No estimates of the number of argali in Nepal exist; it is likely to be a small number (Shrestha et al 2005).

Pakistan
Animals using the Khunjerab area of Pakistan may also use the Chinese side; the number of animals occurring in Pakistan remains unknown, but is likely to be small, possibly less than 100 (Hess et al. 1997). In 2002 or 2003, Khan and Khan (n.d.) report observing 34 argali. These authors also provide qualitative evidence of a general decline in argali abundance in the area.

Russia
In the mid-1990s, Weinberg et al. (1997) estimated that between 450-700 argali occurred in the Altai Mountains of southern Russia, distributed among numerous subpopulations none of which exceed 50 animals. Paltsyn (2001) reports counts of 80-85 argali within Altaisky Zapovednik (speculating that 100-110 individuals may have existed), 150-160 in headwaters of rivers of Sailugem Ridge (south of the Zapovednik, near the Mongolian border), and 40-45 individuals along the slopes of Chikhachev’s Ridge in the Tuvan Republic.

Tajikistan
Numerous figures have been put forward for the total number of argali in Tajikistan; all suffer from methodological problems of one sort or another. Luschekina (1994) reported that helicopter surveys conducted in 1991 tallied 9,415 animals, with the estimated total in Tajikistan being 9,900-10,300. Density was highest in the eastern-most section, near the border with China where “engineering” works limited human access. Fedosenko (1999a), based on local information in the Saluistyk River area, believed this estimate to be slightly low, asserting that population size in the early 1990s was 11,500-12,000. Based on poaching records and political events within Tajikistan at the time, Fedosenko (1999a) hypothesized a decline to about 9,500-10,000 during the mid-1990s. Fedosenko (1999a) reported tallying 4,948 argali in southeastern portions of Tajikistan in 1999 where he had tallied only 1,242 in 1995, and concluded that the population in Tajikistan had increased to 13,000-14,000. Other estimates during the 1990s by K. Kasirov (quoted by Schaller 2003) were in the 8,000-9,000 range. Magomedov et al. (2002, 2003) surveyed 900 km of transects during late February and early March 2002 in southeastern Tajikistan, estimating that they tallied 5,951 individual argali. Extrapolations from these counts (based on poorly documented assumptions) yielded an estimate of 14,500 argali within southern and eastern study areas, and 39,900 for all of Tajikistan (their surveys evidently took place where Luschekina [1994] and Fedosenko [1999a] had earlier postulated this highest densities in Tajikistan). Schaller and Kang (2008) tallied 1,528 argali in summer 2003 within selected census blocks totaling 1,977 km² (and in winter 2005, counted 2,200 animals within their South Alichur block in Murgab). Schaller and Kang (2008) declined to project an estimate for all of Tajikistan, but believed that the 13,000-14,000 estimated by Fedosenko (1999a) was “of the correct order of magnitude”.

Uzbekistan
Within Nuratinski Strictly Protected Area (SPA) of the Nuratau Mountains, about 1,200-1,300 argali survive. Outside of the protected area the Nuratau Mountains supports about 250-300 argali, of which ~150-200 occur in western Nuratau and 100 individuals occur in eastern Nuratau and the Koitash Range. Under 100 argali remain in the Tamdytau and Aktau Ranges. A few individuals may persist in the Malguzar Range near the Zaaminsk SPA. Therefore, a total of under 1,800 Severtzov’s argali persist in Uzbekistan, of which 90% occur in the Naratau Range (N. Beshko pers. commun.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The main threats are over-hunting and poaching (for meat); competition, displacement and possibly disease transmission by domestic livestock; and habitat loss. In general, argali appear to be extremely intolerant of human disturbance (Fedosenko 1999, Namgail 2004, Maroney 2006, Namgail et al. 2007, Harris 2007, Schaller and Kang 2008.) These threats appear to vary little among argali populations, even though habitats vary.

In Afghanistan, poaching is generally considered to be a continuing threat to argali, the presidential ban on hunting notwithstanding. Weapons are not uncommon in Afghanistan.

In China, poaching has been considered to be a substantial threat (Wang et al. 1997, Schaller 1998). In the mid-1990s however, a nationwide effort to confiscate guns from pastoralists substantially reduced the weaponry available for poaching. This, together with continued efforts to publicize the national law prohibiting killing protected species, appears to have reduced poaching during the last decade or so. At the same time however, efforts to regularize and sedentarize pastoralists generally increased habitat conflicts, because pastoralists typically intensified their use of productive grasslands preferred by argali, thus displacing them (Harris 2007).

Some of the strongest data suggesting interference competition from livestock as a limiting factor for argali comes from Ladakh, India, where Namgail et al. (2007) documented a group of argali shifting their habitat preference toward escape terrain and away from preferred foraging areas when livestock were present.

As elsewhere, livestock grazing and poaching were considered the principal limiting factors to argali in Kazakhstan by Fedosenko (1999b). There is general consensus that habitat conditions for argali improved after Kyrgyzstan’s independence in 1991, due to the collapse of the state-supported livestock sector and consequent reduction in grazing pressure in the Tian Shan and Pamirs (Farrington 2005). It is unclear whether relatively low livestock density near the Chinese border will continue. Poaching and competition with livestock are also considered threats in Kyrgyzstan (Weinberg et al. 1997). After independence in 1991, the number of domestic sheep herded into argali habitat declined dramatically, which likely had a beneficial effect. However, since 2000 there have been informal reports that livestock numbers have again risen.

The main threat facing argali in Mongolia is poaching for subsistence (meat) and increasingly for their horns, which are increasingly being used as substitute horn in traditional Chinese medicine (Mallon et al. 1997, Reading et al. 1997, 1998, 1999, 2001, Amgalanbaatar 2002b). Also important are the impacts from local, nomadic pastoralists who displace argali, whose livestock feed on the same forage as argali, and whose dogs chase and even kill argali (Mallon et al. 1997, Reading et al. 1997, 1998, 2003, 2005, Wingard 2005, Amgalanbaatar et al. 2006). More minor and localized threats include unsustainable trophy hunting (Amgalanbaatar 2002a, Zahler et al. 2004, Wingard and Zahler 2006) and habitat loss resulting from rapidly increasing resource extraction (i.e., mining) (Reading et al. 1998, 1999, 2001, 2005). Subsistence poaching by miners general represents a greater threat than actual mining activities, but this may change as the number of mines continues to grow rapidly. These threats remain important due to poor or non-existence law enforcement throughout most of the range of the species in Mongolia. Very little money from trophy hunting currently supports conservation activities in Mongolia (Amgalanbaatar et al. 2002a, Wingard and Zahler 2006).

In Pakistan, in addition to disturbance from livestock (grazing in Khunjerab remains legal; Knudsen 1999, Khan and Khan, n. d.), increased access to the area through the Karakoram Highway is believed to have increase poaching pressure (Hess et al. 1997).

Unlike in Mongolia, domestic livestock herds in the Russian Altai were reported has having declined during the 1990s (Paltsyn 2001), providing a potential opportunity for expansion of the protected area network in the Altai-Sayan area.

In Uzbekistan, poaching represents the main threat facing Severtzov’s argali, which continues to occur even within protected area (N. Beshko pers. comm.). The second major threat to Severtzov’s argali is a loss of habitat and competition with domestic livestock for forage. Finally, inbreeding and harsh climatic conditions represent threats for the very small, isolated populations in the Aktau, Tamdytau, and Malguzar Mountains (N. Beshko pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Argalis are threatened throughout their range but some subspecies are in a far worst situation than others. Habitat loss caused by the introduction of domestic sheep is perhaps the most pertinent threat to their survival (2). Hunters have traditionally valued the magnificent horns and hunting affects population numbers throughout their range (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Argali are included on Appendix II of CITES, excepting the subspecies O. a. nigrimontana and O. a. hodgsonii, which are included on Appendix I. The United States Endangered Species Act lists argali as endangered, except in Mongolia, Kyrgyzstan, and Tajikistan, where they are listed as threatened. (Threatened classification allows for importation of trophies from legally taken argali in those countries under specifically-authorized permits from the U.S. Fish and Wildlife Service. Permits for importation of trophies are generally not authorized for taxa listed as Endangered).

Afghanistan
A trophy hunting program for argali in the Big Pamir operated from ~ 1966-1978, but was discontinued following the Soviet occupation of Afghanistan, and to date, has not been re-established. Under this program, livestock grazing in high elevation habitats favoured by argali during summer was effectively prohibited, and poaching by local pastoralists reduced. However, domestic livestock grazing was concentrated on argali winter ranges, with the result that the overall effect on argali habitat of the hunting program was unclear (Petocz et al. 1978). All hunting in Afghanistan was banned by order of President Hamid Karzai in 2006. There do not, however, appear to be serious effort so to enforce the ban. In 2009. argali were officially-listed as a Protected Species in Afghanistan, strictly prohibiting all hunting and trading of this species within the country. There are currently no protected areas within the distribution of argali in Afghanistan, although plans exist to establish one or more in the Big and Little Pamir areas. Land management regulations or restrictions in any such future protected areas are not yet known.

China
Argali are classified as a Category II “key species” under the Chinese National Wildlife Law of 1988. As such, permits to take argali must be obtained from province-level authorities. In practice, only the trophy hunting programs have procured permits to take argali under this legislation (Harris 2007).

Argali occur in a number of Chinese nature reserves. In Xinjiang, they occur in occur in at least six nature reserves in Xinjiang (Du and Zhang 2006), including Arjin Shan, Kalamaili, Source of the 2 Altai Rivers (Altai mountains), West Tian Shan, Hami Shan (Tian Shan range) and Taxkorgan (Pamirs). On the Tibetan Plateau, argali occur in the 247,120 km² Qiangtang Reserve in Tibet and the 83,000 km² Kekexili Reserve in Qinghai, as well as in scattered populations within the Sanjiangyuan Nature Reserve in Qinghai (Schaller et al. 2007). In Gansu, argali occur in Yanchiwan Nature Reserve, and may occur in the Qilian Nature Reserve. Nature reserve designation in China does not necessarily preclude habitat conflicts, as grazing, mining, and other activities often take place.

A number of trophy hunting areas have been established with argali as the focal species. Hunting areas in Xinjiang include Baicheng, Bu’erjin, Fuyun, Hami, Hejing, Qiemo, Tacheng, Tashiku’ergan, and Tulufan counties; in Gansu in Aksai and Subei counties (Subei’s consisted of two distinct areas, the Hashiha’er area in the Qilian Mountains and the Mazong Shan area in the Gobi Desert abutting Mongolia). In addition, two hunting areas in Qinghai Province, focusing primarily on blue sheep, have argali populations: Dulan (within separate townships, Balong and Gouli) and Maduo counties. One hunting area in Inner Mongolia (Yabulei) contains argali. Hunting areas in China have generally succeeded in reducing poaching and in generating some local enthusiasm for argali, but have not yet succeeded in treating habitat conflicts (Harris and Pletscher 2002, Harris 2007).

India
Argali are listed as a threatened species by the Government of India and are fully protected under Jammu and Kashmir’s Wildlife Act of 1978 (Fox and Johnsingh 1997). Poaching appears to have declined in recent years (Namgail 2004), but has evidently not been accompanied by an increase in argali. Little has been done to address the likely deleterious effects of displacement increasing numbers of livestock on argali in Ladakh. Argali are rare but present in Khangchengzonga National Park in Sikkim (Sharma and Lachungpa 2003).

Kazakhstan
Fedosenko (1999b) considered that some of the hunting concessions in Karaganda oblast protected argali well. Between 1990 and 2000, 75 argali rams were shot in the Karaganda area, and the approximately $900,000 earned was used for scientific studies, according to Fedosenko (1999b). However, Fedosenko (1999b) also believed that trophy hunting was having deleterious effects on breeding behavior and resultant productivity of females, and recommended a reduction in the yearly offtake quota. Trends in habitat conflicts with domestic livestock in Kazakhstan have not been well documented.

Kyrgyzstan
A research and conservation plan for argali was approved by the government of the Kyrgyz republic on April 7, 2004 (Krygyz Republic 2004), but it is unclear if it has proceeded, and if so, what results have been achieved. In February 2006, the United State Department Fish and Wildlife Service suspended their program of issuing import permits to US hunters taking argali in Kyrgyzstan, pending receipt of additional information on the status of the taxon there (M. Carpenter, USFWS pers. comm., 2006). Issuing permits was partially reinstated in 2007, with 10 permits allowed.

Mongolia
Argali sheep are protected as “Rare” under the 2001 revision (Mongolian Government Act No. 264) of the 2000 Mongolian Law on Animals (Wingard and Odgerel 2002). General hunting of argali has been prohibited since 1953, and is the species is further protected as “Rare” under the 1995 Mongolian Hunting Law (Wingard and Odgerel 2002). Argali are included in Appendix II of CITES (UNEP-WCMC, 2006), with an export quota of 80 hunting trophies with horns and 44 skins and horns in 2005. Altai argali (O. a. ammon) were listed as Rare” in both the 1987 and 1997 Mongolian Red Books, and the species was upgraded to “Endangered” in Mongolia in the most recent nationwide assessment (Clark et al. 2006). Approximately 14% of the species’ range in Mongolia occurs within federal protected areas, including Altai Taivan Bogd National Conservation Park (NCP), Gobi Gurvan Saikhan NCP, Great Gobi Strictly Protected Area (SPA) sections A and B, Ikh Nart NR, Khokh Serkh SPA, Khoredal Saridag SPA, Khustai Nuruu NCP, Myangan Ugalzat Nature Reserve (NR), Sielkhem Uul NCP, Tsagaan Shuvuut SPA, Tsambagarav Uul NCP, and Turgen Uul SPA (Amgalanbaatar et al. 2002b). Small populations likely occur in other federal and provincial (aimag) or county (soum) protected areas as well.

Although protected from general hunting, trophy hunters can purchase licenses. Under the Mongolian Hunting Fee Law of 1995, revenue generated from argali trophy hunting is divided among the federal government’s general funds (70%), the local province (20%), and the hunting organization (10%); specifically, US$ 18,000 for O. a. ammon trophies and US$ 9,000 for O. a. darwini trophies is allocated to local and federal governments (Wingard and Odgerel 2002). Ostensibly this money should benefit local people, government agencies, and help implement important conservation actions for argali and the ecosystems they inhabit, but unfortunately, little of this money makes it back to local people or to the conservation of the species (Amgalanbaatar and Reading, 2000, Amgalanbaatar et al., 2002a, Wingard and Zahler 2006). Indeed, because local governments generally receive no additional revenue from trophy hunting (the federal government simply reduces payments to local governments that receive trophy hunting permits), many local governments are actively establishing protected areas to prevent future hunting (Amgalanbaatar et al. 2002a). Recent reforms to Mongolian trophy hunting practices have led to proposals for community-based wildlife management programmes (Amgalanbaatar et al. 2002a). Initial efforts by WWF-Mongolia, the Argali Wildlife Research Center, Denver Zoological Foundation, and local governments stalled; however, after initiation of a Global Environment Facility Project in the region and no progress has been made in recent years.

WWF and the Ministry of Nature and Environment organised a workshop on ‘Conservation of Argali in Mongolia’ in 2000 that resulted in a Argali Conservation Management Plan in 2002. However, this plan has not yet been adopted by the government and is not being implemented.

Mongolia’s Argali Wildlife Research Centre, Denver Zoological Foundation, and Mongolian Academy of Sciences cooperate on a number of conservation and research projects, including an interdisciplinary research and conservation project in Ikh Nart Nature Reserve, Dornogobi Aimag in cooperation with the Dalanjargal Soum Administration. That work, begun in the late 1990s, has resulted in several publications (e.g., Amgalanbaatar and Reading 2000, 2003, Reading et al. 2001, 2003, 2005; Amgalanbaatar et al., 2002a; 2002b, 2006; Tserenbataa et al. 2004, Wingard 2005), development of ecotourism to support conservation, a broad conservation education program, and active conservation management of the reserve by the Dalanjargal Soum Administration.

Additional conservation measures are desperately required in Mongolia. Clark et al. (2006) outlined the following:

• Implement the recommendations outlined in the Argali Conservation Management Plan.
• Improve enforcement of existing legislation that would help conserve argali.
• Enhance conservation management in protected areas where argali are found at high population densities, and increase the capacity of protected areas personnel and other environmental law enforcement officers.
• Work to improve the livelihoods of local communities in areas where argali are protected by local initiatives and re-initiate community-based approaches to argali conservation (Amgalanbaatar et al. 2002a).
• Develop public education programmes to raise awareness of the status of and threats to the species.
• Continue ecological research, monitor population trends, and study the impacts of threats, including work in the Altai and Khangai Mountains to complement research occurring in the Gobi Desert.
• Implement the recommendations from the Mongolian Wildlife Trade Workshop as outlined in Wingard and Zahler (2006).

Major revisions to argali trophy hunting practices in Mongolia as outlined in Amgalanbaatar et al. (2002a) could generate substantial revenue for conservation and ensure that local people benefit, greatly benefitting argali conservation. However, the barriers to changing the way trophy hunting is managed and implemented in Mongolia are formidable.

Pakistan
Working with local people in the Khunjerab area toward mutually agreeable conservation solutions has been a contentious issue for many years. Successful resolution of competing claims with concerns for the interests of argali will ultimately be beneficial for conservation.

Russia
Argali are listed in the Red Data Book of the Russian Federation, and hunting is legally banned; it is unclear how effective this legal protection is. Argali occur in the Altaisky Zapovednik, but most argali in the Russian Federation are outside of protected areas. Both Weinberg et al. (1997) and Paltsyn (2001) suggested expanding the area under protected area status in the area. Weinberg et al. (1997) suggested that the eastern portion of Sailguem Ridge near the Mongolian border could be a possible new protected area, as well as in the upper reaches of the Chagan-Burgazy River. Paltsyn (2001) noted that WWF has become a long-term program to promote sustainable development in the Altai-Sayan region, which could have benefits for argali.

Tajikistan
Argali occur in Pamir National Park (26,000 km²), and the Zorkul Zapovednik (870 km²), although neither protected area is fully functional (Schaller and Kang 2008). Trophy hunting began in 1987, the same year that local hunting was prohibited (Fedosenko 1999b). Quotas for trophy hunts have recently been 40-60/year (Schaller and Kang 2008), up from ~ 20/year in the late 1980s and early 1990s (Fedosenko 1999b). There are reports that additional animals are sometimes sold beyond the official quotas. Some hunting concessions actively protect argali and limit disturbance, others do not (Schaller 2003).

Sources disagree on the status of argali in Tajikistan. Protection from excessive human mortality and human disturbance appears to be strong in the southeastern corner of the country; somewhat less so in other portions of argali range (Schaller 2003). Argali have generally benefited from the substantial reduction in domestic livestock grazing in the high-elevation Pamirs following Tajikistan’s independence in 1991 (Fedosenko 1999a). However, poaching, by pastoralists, military, and border guards, may have increased since that time – perhaps in part due to the civil war of the mid 1990s -- and is only partly controlled by hunting concessions (Schaller 2003). Trophy hunts represent a substantial source of revenue that could be used for argali conservation; this appears to be occurring in some hunting concessions within Tajikistan, but not in others (Schaller 2003).

Uzbekistan
Severtzov’s argali are protected with the Nuratinski SPA and a few individuals possibly survive in the Zaaminsk SPA. The species is included in the Red Book of Uzbekistan and protected from general hunting, although limited trophy hunting is permitted and occurs irregularly. Unfortunately, little law enforcement to prevent poaching occurs outside of the protected areas. Strong anti-poaching activities, expansion of the Nuratinski SPA, and would help conservation efforts. Support for anti-poaching and pasture improvement efforts are crucial.

A captive breeding program for Severtzov’s argali occurs just outside Nuratinski SPA to supplement the wild population and provide animals for trophy hunters. Unfortunately, this facility is relatively small, has limited resources, and occasionally releases breeding males for trophy hunters. Nevertheless, this program demonstrates that, captive propagation is possible and could aid in restoring animals to portions of their range where protection from poaching and over-grazing occurs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

It is possible that the sustainable management of hunting could offer some hope to the conservation of certain populations of argali (5). Although controversial, this practice increases the value of the species to local people, protects habitat and with careful monitoring the revenue obtained can be ploughed back into conservation (5). Two of the most at-risk subspecies, O. a. hodgsonii and O. a. nigrimontana, are listed on Appendix I of the Convention on International Trade in Endangered Species (CITES) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

O. ammon negatively affects humans by competing with livestock for grazing lands. But mostly Argali sheep are in remote areas not used by domestic livestock. It is more likely that the domestic sheep raised by humans have negatively affecte Argali sheep, pushing them into more remote, lower quality habitats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

O. ammon benefits humans by providing meat and hair for native subsistence hunters. The clothing made from this animal's hair, as well as the food it provides, can be essential for survival.

Sport hunters enjoy trophy killing the world’s largest sheep. The lure of largest sheep has become a goal for many hunters willing to pay any cost for such a trophy. Revenue is raised on tourism and expedition costs, helping local peoples by providing an important source of currency.

In recent years ecotourism has increased, bringing even more financial gains to the region.

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Argali

For the Village Development Committee in Nepal, see Argali, Palpa.

The argali, or the mountain sheep (species Ovis ammon) is a wild sheep that roams the highlands of Central Asia (Himalaya, Tibet, Altay).

Description[edit]

It is the largest species of wild sheep. The North American bighorn sheep may approach comparable weights but is normally considerably outsized by the argali. Argali stand 85 to 135 cm (3 to 4 ft) high at the shoulder and measure 136 to 200 cm (4 to 7 ft) long from the head to the base of the tail. The female, or ewe is the smaller sex by a considerable margin, sometimes weighing less than half as much as the male, or ram. The ewes can weigh from 43.2 to 100 kg (95 to 220 lb) and the rams typically from 97 to 182 kg (214 to 401 lb), with a maximum reported mass of 216 kg (476 lb). The Pamir argali (also called Marco Polo sheep, for they were first described by that traveler), O. a. polii, is the largest race on average, regularly measuring more than 180 cm (5.9 ft) long without the tail, and is less sexually dimorphic in body mass than most other subspecies. The argali has relatively the shortest tail of any wild goat-antelope or sheep, with reported tail lengths of 9.5–17 cm (3.7–6.7 in).

The general coloration varies between each animal, from a light yellow to a reddish-brown to a dark grey-brown. Argali or nyan from the Himalayas are usually relatively dark, whereas those from Russian ranges are often relatively pale. In summertime, the coat is often lightly spotted with a salt-and-pepper pattern. The back is darker than the sides, which gradually lighten in color. The face, tail and the buttocks are yellowish-white. The male has a whitish neck ruff and a dorsal crest and is usually slightly darker in color than the female. Males have two large corkscrew horns, some measuring 190 cm (6.2 ft) in total length and weighing up to 23 kg (51 lb). Males use their horns for competing with one another. Females also carry horns, but they are much smaller, usually measuring less than 50 cm (20 in) in total length.

Subspecies and classification[edit]

Currently, 9 subspecies of argali are recognized:[2]

  • Altai argali, O. a. ammon
  • Karaganda argali, O. a. collium
  • Gobi argali, O. a. darwini
  • Tibetan argali, O. a. hodgsoni
  • North China argali, O. a. jubata
  • Tian Shan argali, O. a. karelini
  • Kara Tau argali, O. a. nigrimontana
  • Marco Polo argali, O. a. polii)
  • Severtzov argali, O. a. severtzovi

Some sources classify mouflon as Ovis ammon musimon, but DNA testing has not supported this. Several subspecies of argali have been genetically tested for mtDNA and one study found the subspecies O. a. ammon, O. a. darwini and the urial subspecies, O. vignei bochariensis grouped closely, while the subspecies O. a. collium and O. a. nigrimontana grouped with the urial subspecies O. vignei arkal.[3]

Range and habitat[edit]

Argali range from central Kazakhstan in the west to the Shansi Province in China in the east and from the Altai Mountains in the north to the Himalayas to the south. They are a species of mountainous areas, living from elevations of 300 to 5,800 m (980 to 19,030 ft). In protected areas, the species generally prefers gently sloping areas with soft broken terrain, although ewes with lambs often take up residence in more precipitous areas, characterized by canyons and jagged rocks. In areas where they are extensively hunted (such as Kazakhstan), they are more likely to be found in forested areas. In parts of China and Russia where they compete for resources with numerous domestic stock, argali more regularly take up residence in precipitous, jagged areas. Argali may search for regions in the mountains where snow cover is not heavy during the winter, following winds that blow snow off the earth. Rams are generally found at higher elevations more regularly than females and stay at higher elevations longer during the winter.[2]

Life history[edit]

Argalis live in herds typically numbering between two and 150 animals, segregated by sex, except during breeding season. Most populations show large numbers of adult females, constituting more than half of a local population, against around 20% adult males and a further 20% young argali. Some rams are solitary, but most are seen in small herds numbering between three and 30 individuals. Females and their young live in larger groups, regularly up to 92 individuals and exceptionally to 200 animals. Migrating herds, especially males, have been reported. Most migration appear to be related to seasonally decreased food sources, though an overabundance of biting insects (especially gadflies), severe drought or fires, poaching by humans, and large numbers of domestic livestock may also trigger movements. With their long legs, herds can travel quickly from place to place. Argali tend to live at higher elevations during the summer.[2]

Argali reach breeding maturity at two to three years of age. Rutting may occur from October to mid-January, generally lasting longer in lower elevations. In rutting herds, both rams and ewes attack others of their own sex, exerting dominance by ramming each other with their horns. Although such groups engage in lamb-like play, the combat of a pair of mature males is a serious business. The rams slam into each other, with their fore legs up in the air, exerting enough force to be heard up to 800 m (2,600 ft) away. Often, the older males (over six years of age), which are also often the largest, end up the dominant ones and younger males are chased off once the ewes are in estrus. Once dominance is established, the top rams begin approaching ewes and smell their urine to determine their receptiveness. The ram then repeatedly approaches the ewe and forceably mounts her. Mating commences around two to three weeks after the rutting begins. Rams may remain in the company of ewes for up to two months after the rutting period is complete.[2]

The gestation period lasts a little over 165 days. Births occur in late March or April, with a variable number of females being barren. Most subspecies give birth to a single lamb, though in some races, twins are not uncommon and even as many as five have been born at once. At birth, the lambs weigh 2.7–4.6 kg (6.0–10.1 lb). The newborn lamb and mother ewe stay around where the birth occurs overnight and, on the next day, both usually walk together. Lambs often play in groups, jumping up and down together, sometimes being joined by their mothers. Weight gain is often quite fast and the lambs may weigh 10 times their birth weight by their first birthday. Females often attain their maximum mass by two years of age, but males appear to continue to grow larger and heavier in their third and fourth years. Milk teeth develop around three months of age, with a full set of teeth developing by around six months. By the time their teeth develop, lambs are capable grazers, but the ewes continue nursing them from August to May of the following year. Most argali live five to 10 years, but are capable of living 13 years in the wild.[2]

Adult argali eat 16–19 kg (35–42 lb) of food a day. The vegetation preferred by the species varies based on elevation and area. In higher elevations, they predominantly eat grasses, sedges, and forbs. At midelevation habitats, they more regularly feed on bushes and mesophyte grasses. In the lowest ranges and the spurs of deserts, grasses and sedges again predominate, but often of different species than the high-elevation ones. In north-central Kazakhstan, sprouts, leaves, flowers, and fruits are significant to the diet all year, whereas they appear to be a rare dietary supplement over the rest of the range. Water is needed by argali, which is rarely a problem for animalss living at high elevation, where melting snow and small waterways are regularly encountered. In drier climes, argali may travel several kilometers in search of water. When available, argali readily consume saline soil.[2]

Although they are locally sympatric with Siberian ibex, the two species have differing habitat and pasture preferences, reducing likely competition. In Tibet, the argali must regularly compete with other grazing species for pasture, including Tibetan antelope, bharal, Thorold's deer and wild yaks. Competition is most serious with livestock, especially domestic yak and domestic sheep, with which argali are frequently forced to intermingle and from which they often catch diseases and parasites. The main predator of argali are gray wolves, which often exploit harsh winter conditions (such as deep snow) to capture the wild sheep, though they can and do take specimens of any age or condition year around. Where not locally extirpated, snow leopards and leopards are also predators of argali of any age. Eurasian lynx and wolverines may seldom kill argali to at least the size of winter-weakened ewes. Red foxes and domestic dogs (largely those kept by sheep-herders) will prey on lambs. Cinereous vultures, lammergeiers and golden eagles have been observed circling herds of ewes with lambs in a possibly predatory manner and remains of argali lambs have been observed in golden eagle nests. Smaller predators, such as raptorial birds and smaller mammalian carnivores, are attacked by mother ewes, but in the presence of larger predators, the ewes quickly run away with the lambs following them.[2]

Status[edit]

Argali are considered an endangered or threatened species throughout their entire range, due largely to habitat loss from overgrazing of domestic sheep and hunting. As the world's largest sheep, the lure to gather a trophy specimen is strong among sports-hunters. They are hunted for both their meat and their horns, used in traditional Chinese medicine, and poaching continues to be a major (and difficultly managed) problem. Argali have been extirpated from northeastern China, southern Siberia, and parts of Mongolia. Populations of predators such as gray wolves and snow leopards have appeared to have been negatively affected by the scarcity of argali.[4]

In Pakistan-administered Kashmir it is listed as an endangered species.[citation needed]

References[edit]

  1. ^ Ovis ammon (Argali). IUCN Red List of Threatened Species. Version 2012.1.
  2. ^ a b c d e f g Alexander K. Fedosenko and David A. Blank Ovis ammon. Mammalian Species, No. 773, (July 15, 2005), pp. 1–15
  3. ^ Hiendleder S, Kaupe B, Wassmuth R, Janke A (May 2002). "Molecular analysis of wild and domestic sheep questions current nomenclature and provides evidence for domestication from two different subspecies". Proceedings of the Royal Society B: Biological Sciences 269 (1494): 893–904. doi:10.1098/rspb.2002.1975. PMC 1690972. PMID 12028771. 
  4. ^ ADW: Ovis ammon: INFORMATION. Animaldiversity.ummz.umich.edu (2003-12-16). Retrieved on 2012-08-23.

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!