Overview

Brief Summary

Biology

Adults are solitary, although the home ranges of males and females overlap extensively (7). Females reach sexual maturity at two to three years and the mating season runs from early January to mid-March, when long-drawn-out wailing calls can be heard echoing amongst the cliffs (7). Litter size is usually two to three cubs, which are born with black spots (7), and become independent from their mother at over two years old (3). Most active at dawn and dusk, snow leopards are opportunistic predators capable of killing prey up to three times their own weight (3). Their prey consists mainly of wild sheep and goats, although livestock will also be taken, especially if wild prey has been depleted (3). These cats will kill an average of one large animal twice a month (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

This beautiful cat is a white to smokey-grey colour, with yellow tinged fur and patterned dark-grey to black rosettes and spots (6). The snow leopard has many adaptations for its cold habitat; long body hair and thick, woolly belly fur, large paws and a well-developed chest and enlarged nasal cavity that warms the cold air as it is breathed in (6). The long, thick tail is almost a metre in length and is used for balance and as added insulation when wrapped around the body and face at rest (6). The short forelimbs and long hind limbs enable this leopard to be particularly agile in its steep and rugged habitat (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Snow Leopard is restricted to the high mountains of Central Asia, with core areas including the Altai, Tian Shan, Kun Lun, Pamir, Hindu Kush, Karakorum and Himalayan ranges. (McCarthy et al. 2003). Ecological regions were defined in a workshop as Altai-Sayan, Trans-Altai Alashan Gobi, Tian Shan, Pamir, Hindu-Kush, Karakorum, Himalayas, HengduanMountains, and Tibetan Plateau (Williams 2008).

Based on elevational analysis, Hunter and Jackson (1997) estimated potential range at over 3 million km, with much of this in Mongolia and the Tibetan plateau of China, although it is unclear to what extent snow leopards use much of the flatter parts of the plateau (R. Jackson pers. comm. 2008). There was evidence of snow leopard occupation in 1.83 million km, and only about 550,000 km was considered to be good habitat (Hunter and Jackson 1997, McCarthy et al. 2003). Williams (2006) used historical data to improve mapping of potential range, but there remains a significant lack lack of information about current snow leopard status across much of its known and potential distribution.

In an attempt to improve knowledge of Snow Leopard distribution and status, a conservation planning conference held in Beijing in March 2008 brought together experts from 11 of the 12 range countries. The conference was able to map specific and local knowledge about snow leopard range and determine Snow Leopard Conservation Units, areas which are the most important for conserving Snow Leopards over the long-term. The process highlighted areas where knowledge of Snow Leopard status is strong and where it is lacking, and resulting maps now provide biologists and conservationists with a more strategic approach to Snow Leopard conservation and research (Williams 2008).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Snow leopards inhabit the mountain ranges of Central Asia stretching from northwestern China to Tibet and the Himalayas.

Biogeographic Regions: palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Central Asia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Extremely fragmented populations are found in the harsh, remote, mountainous areas of central Asia, with the majority of snow leopards located in the Tibetan region of China (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Base fur color ranges from light gray to smoke gray, shading to white on the belly. The head, neck, and lower limbs are covered with solid spots, while the rest of the body is covered with "rosettes," large rings that often enclose smaller spots. The fur is very thick, one inch long on the back, two inches long on the tail, and three inches long on the belly. Characteristically, the tails are extremely long in comparison to other cats, measuring almost as long as the body. They use the tail both for balance and covering their body, nose, and mouth during times of sub-zero temperatures. Also characteristic of snow leopards are the very large and furry paws, functioning both as snow shoes and padding against sharp rocks.

Head and body length is 1000 to 1300 mm, tail length is 800 to 1000 mm.

Range mass: 25 to 75 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Snow Leopards are closely associated with the alpine and sub-alpine ecological zones, favoring steep terrain well broken by cliffs, ridges, gullies, and rocky outcrops (McCarthy et al. 2003). However, in Mongolia and Tibet they may occupy relatively flat or rolling terrain as long as there is sufficient hiding cover (Jackson et al. in press) In the Sayan mountains of Russia and parts of the Tien Shan range of China, they are found in open coniferous forest, but usually avoid dense forest. They generally occur at elevations of 3,000-4,500 m, except for at their northern range limit, where they are found at lower elevations (900-2,500 m) (McCarthy et al. 2003). Low temperatures and high aridity makes its habitat among the least productive rangeland systems in terms of graminoid biomass, with prey populations consequently occurring at relatively low densities (Jackson et al. in press).

The cat’s principal natural prey species are bharal or blue sheep (Pseudois nayaur) and ibex (Capra sibirica) whose distribution coincides closely with snow leopard range. Snow leopards also prey on marmot (Marmota spp), pika (Ochotona spp.), hares (Lepus spp.), small rodents, and game birds. Considerable predation is reported on domestic livestock. Annual prey requirements are estimated at 20 to 30 adult blue sheep, with radio-tracking data indicating such a kill every 10 to 15 days. A solitary leopard may remain on a kill for up to a week (Jackson et al. in press)

Snow Leopard home ranges overlap widely between the sexes, and are reported to vary from 10 to 40 km² in relatively productive habitat in Nepal (Jackson and Ahlborn 1989). By comparison, home ranges are considerably larger (140 km² or greater) in Mongolia, where terrain is relatively open and ungulate prey densities lower (McCarthy et al. 2005). Densities range from 0.1 to 10 or more individuals per 100 km² (Jackson et al. in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Snow leopards live in mountain steppes and coniferous forest scrub at altitudes ranging from 2000 to 6000 meters. In the summer they frequent alpine meadows and rocky areas, and in the winter they may follow prey into forests below 1800 meters.

Terrestrial Biomes: forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Snow leopards are generally found at elevations between 3,000 to 4,500 meters in steep terrain broken by cliffs, ridges, gullies and rocky outcrops (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Their prey includes wild sheep, wild boar, hares, mice, deer, marmots, and other small mammals. They also feed on domestic livestock. Prey is either attacked or ambushed. Snow leopards attack usually from a distance up to fifteen meters and feed initially on the chest, lower abdomen, or thigh.

Animal Foods: mammals

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Uncia uncia preys on:
Pseudois nahura
Bos grunniens
Cervus albirostris
Hemitragus jemlahicus
Ovis ammon
Pseudois nayaur

Based on studies in:
Tibet (Montane)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
18.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.2 years (captivity) Observations: In zoos, these animals can live up to 21.2 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating occurs between December and March, and most births occur after 100 days of gestation. The young are born in a rocky shelter lined with the mother's fur for warmth. The litter can include from one to five young, with the average two or three. The infants are blind for about nine days. After three months they start to follow the mother for food and are dependent on her for at least the next year. Sexual maturity is reached at the age of two years.

Range number of offspring: 1 to 4.

Average number of offspring: 2.04.

Range gestation period: 98 to 103 days.

Range weaning age: 48 to 180 days.

Average birth mass: 475 g.

Average number of offspring: 2.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Parental Investment: altricial ; post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Uncia uncia

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1873-08|NC_010638|Uncia uncia| AACCGCTGACTATTTTCAACCAATCACAAAGATATTGGAACTCTTTACCTTCTATTTGGCGCCTGAGCTGGTATGGTGGGGACTGCTCTC---AGTCTCTTAATCCGAGCCGAGCTGGGTCAACCTGGCACACTGCTAGGGGAT---GACCAGATTTATAATGTAGTCGTCACCGCCCATGCTTTTGTAATAATCTTCTTTATAGTGATGCCTATTATAATTGGAGGGTTTGGAAACTGATTAGTCCCATTAATA---ATCGGGGCCCCCGATATAGCATTCCCTCGAATGAATAATATGAGTTTCTGACTCCTCCCCCCGTCTTTCCTGCTTTTGCTCGCATCATCTATGGTAGAGGCTGGGGCGGGGACTGGGTGGACAGTATACCCGCCTCTAGCCGGCAACCTAGCTCATGCAGGAGCATCCGTAGACCTA---ACTATTTTCTCACTACACTTGGCAGGTGTCTCCTCAATCTTAGGCGCTATTAATTTTATTACTACTATTATTAATATAAAACCCCCTGCTATATCCCAGTATCAAACACCTCTATTTGTCTGATCGGTCTTAATCACTGCTGTATTACTACTCCTATCGCTGCCAGTTTTAGCAGCA---GGCATCACTATGCTACTGACAGATCGAAATCTGAACACCACATTTTTTGACCCCGCTGGAGGAGGGGATCCTATCTTATATCAACACTTATTCTGATTTTTCGGTCACCCAGAAGTCTACATTTTAATTTTACCCGGGTTTGGAATGATTTCACATATTGTCACCTATTACTCAGGTAAAAAA---GAACCTTTTGGCTACATGGGAATAGTTTGAGCTATAATATCAATTGGCTTTCTGGGCTTTATCGTATGGGCCCATCACATGTTTACTGTGGGGATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Uncia uncia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Panthera uncia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C1

Version
3.1

Year Assessed
2008

Assessor/s
Jackson, R., Mallon, D., McCarthy, T., Chundaway, R.A. & Habib, B.

Reviewer/s
Nowell, K., Breitenmoser-Wursten, C., Breitenmoser, U. (Cat Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Endangered under C1. Snow Leopards are suspected to have declined by at least 20% over the past two generations (16 years) due to habitat and prey base loss, and poaching and persecution. Losses to poaching were most severe in the former Russian republics in the 1990s (Koshkarev and Vyrypaev 2000, McCarthy et al. 2003, Theile 2003). While conditions have improved there (T. McCarthy pers. comm. 2008), poaching and illegal trade is likely to continue in large parts of snow leopard range given growing demand from China. Over-stocking of the fragile high-altitude grasslands with livestock is widespread throughout snow leopard range, leading to declines in the wild prey base, and an increase in retributive killing when snow leopards turn to livestock (McCarthy et al. 2003, Jackson et al. in press).

The global Snow Leopard population is estimated at 4,080-6,590 (McCarthy et al. 2003: Table II). IUCN Guidelines (IUCN 2006) define population as the number of mature individuals, defined as “individuals known, estimated or inferred to be capable of reproduction.” While in general this refers to all reproductive-age adults in the population, the Guidelines also “stress that the intention of the definition of mature individuals is to allow the estimate of the number of mature individuals to take account of all the factors that may make a taxon more vulnerable than otherwise might be expected.” Two factors which increase felid vulnerability to extinction are their low densities (relative to other mammals, including their prey species) and relatively low recruitment rates (where few animals raise offspring which survive to join the breeding population, which has been documented in a number of felid populations). Low densities means that relatively large areas are required for conservation of viable populations; it has long been recognized that many protected areas are too small to conserve viable snow leopard populations (Nowell and Jackson 1996, Jackson and Hunter 1997, McCarthy et al. 2003). Low recruitment rates also require larger populations and larger areas to conserve viable populations, as well as mortality reduction in non-protected areas to maintain population size through connectivity. The IUCN Guidelines advise that “mature individuals that will never produce new recruits should not be counted.” Low recruitment rates indicate that fewer adults than would be expected produce new recruits. Defining population size as the total estimated number of reproductive age adults in the taxon would also not take into account that many occur in subpopulations which are too small or too threatened for long-term viability. Instead, the number of mature individuals is defined as equivalent to the estimated effective population size.

Effective population size (Ne) is an estimator of the genetic size of the population, and is generally considered representative of the proportion of the total adult population (N) which reproduces itself through offspring which themselves survive and reproduce. Ne is usually smaller than N, and based on four felid demographic studies, it is roughly estimated at 50% (Nowell et al. 2007). The global snow leopard effective population size is suspected to be fewer than 2,500 (50% of the total population, or 2,040-3,295).

History
  • 2002
    Endangered
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Conservation Status

The main threat to snow leopards is hunting for their fur. Snow leopard pelts are considered a trophy, and poaching for the luxurious pelts continues to be a threat to the existence of this species. Black market pelts are found in central Asian bazaars and a full length coat, consisting of six to ten full body skins, can cost around $60,000. In 1981, the International Snow Leopard Trust was created in Seattle as a non-profit corporation working on conservation of the snow leopard and its mountain habitat.

There are approximately 500 leopards in 150 zoos world-wide. Many zoos are involved in a snow leopard species survival project, a coordinated breeding program among zoos. The goal of this project is to maintain a genetically sound population in hope that these animals may someday be released into the wild. Other methods of conservation include habitat protection, captive breeding, stiff penalties for those harming them, and public education.

US Federal List: endangered

CITES: appendix i; appendix ii

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 03/28/1972
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Uncia uncia, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List (1). Listed on Appendix I of CITES (4) and Appendix II on the Convention on Migratory Species (the CMS or Bonn Convention) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Snow Leopard Survival Strategy (McCarthy et al. 2003, Table II) compiled national snow leopard population estimates, updating the work of Fox (1994). Many of the estimates are acknowledged to be rough and out of date, but the total estimated population is 4,080-6,590, as follows:

Afghanistan: 100-200?
Bhutan: 100-200?
China: 2,000-2,500
India: 200-600
Kazakhstan: 180-200
Kyrgyzstan: 150-500
Mongolia: 500-1,000
Nepal: 300-500
Pakistan: 200-420
Russia: 150-200
Tajikistan: 180-220
Uzbekistan: 20-50

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Major threats to the Snow Leopard include prey base depletion, illegal trade, conflict with local people, and lack of conservation capacity, policy and awareness. The Snow Leopard Survival Strategy assessed primary threats by region as follows (McCarthy et al. 2003):

Himalayan region (Tibetan Plateau and other southern China, India, Nepal and Bhutan): reduction of natural prey due to competition with livestock, killing of snow leopards in retribution for livestock depredation, lack of trans-boundary cooperation, military activity, and human population growth or poverty.

Karakhorum and Hindu Kush (Afghanistan, Pakistan and southwest China): habitat degradation and fragmentation, reduction of natural prey due to illegal hunting, killing of snow leopards in retribution for livestock depredation, lack of effective law enforcement, lack of institutional capacity and awareness among local people and policy makers, and human population growth or poverty.

Commonwealth of Independent States and western China (Uzbekistan, Tajikistan, Kyrgyzstan, Kazakhstan, Xinjiang province of China): reduction of natural prey due to illegal hunting, poaching snow leopards for trade in hides or bones, lack of trans-boundary cooperation, military activity, and human population growth or poverty.

Northern range (Russia, Mongolia, and Altai and Tien Shan ranges of China): poaching snow leopards for trade in hides or bones, lack of appropriate policy and effective enforcement, lack of institutional capacity and awareness among local people and policy makers, and human population growth or poverty.

Snow Leopard habitat undergoes extensive agro-pastoral land use, both within and outside protected areas. Conflict with local communities over livestock depredation is amongst the most important threats to the species its range.
The inherently low wild ungulate density in the snow leopard’s range, owing to relatively low primary productivity, is further exacerbated by prey declines due to hunting for meat and competition with livestock. A declining prey base reduces habitat quality for snow leopards and escalates livestock depredation. Competition with livestock for forage is one of the most widespread causes of prey base decline (Jackson et al. in press); reduction of the wild prey base because of hunting by people is also significant in parts of snow leopard range (McCarthy et al. 2003).

Snow Leopards are capable of killing all domestic animals except perhaps for fully-grown male yak. Although herders take steps to reduce the risk of depredation (Jackson et al. in press), livestock populations are a locally abundant food source for snow leopards and make up to 58% of their diet in some areas. The relative abundance of livestock vs. wild prey is a reasonable predictor of the level of livestock depredation by snow leopards (Bagchi and Mishra 2006).

Snow Leopards are killed in retribution for livestock depredation, but also for commercial purposes, and poaching for illegal trade represents a significant threat. Pelts appear to be the main snow leopard produce in demand, but there is also evidence of demand for live animals for zoos and circuses. Other body parts found in trade include bones (used especially in Chinese medicine as a substitute for tiger bone), as well as claws, meat and sexual organs of male cats (Theile 2003). Illegal trade increased in the 1990s in the economically depressed, newly independent Central Asian states that emerged from dissolution of the Soviet Union (Koshkarev 1994, Koshkarev and Vyrypaev 2000). Illegal trade appears to be increasing rapidly with China’s growing economic power, for example, in neighbouring Mongolia (Wingard and Zahler 2006). In Afghanistan, a new market has emerged which is difficult to police due to ongoing military conflict (Habibi 2004).

The general lack of awareness at both local and national levels for the need to conserve wildlife and especially predators, further hinders conservation efforts. Up to a third of the snow leopard’s range falls along politically sensitive international borders, complicating trans-boundary conservation initiatives. Military conflict is taking place across much of the snow leopard's range, causing immense damage to wildlife through direct loss of species and destruction of habitat, losses to landmines, the demands of displaced peoples for food and fuel, and the encouragement of trade in wildlife (Jackson et al. in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The natural prey of the snow leopard have been systematically hunted out of many areas of the high central Asian mountains and leopard numbers have declined as a result (3). Big cats often turn to domestic stock as an alternative source of food and this can incite retaliation from local farmers (3). Snow leopard fur was once highly prized in the international fashion world and around 1,000 pelts were traded a year in the 1920's (3). A further threat to this species comes from the increasing demand for bones for traditional Oriental medicine (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Included on CITES Appendix I (as Uncia uncia). Is legally protected from hunting by national legislation across most of its 12 range states (McCarthy et al. 2003). Afghanistan has recently afforded the Snow Leopard legal protection, after listing the species on the country’s first Protected Species List in 2009. This bans all hunting and trading of Snow Leopards within Afghanistan.

The Snow Leopard Survival Strategy (McCarthy et al. 2003) recommends the following conservation measures:

  • Grazing management and livestock husbandry: promote livestock grazing practices that reduce impacts on native wildlife, especially large ungulates; promote husbandry practices which reduce livestock vulnerability to snow leopard predation and improve efficiency and yield;
  • Financial incentives for communities to conserve snow leopards (Mishra et al. 2003): including wildlife-based ecotourism (e.g., snow leopard treks: Snow Leopard Conservancy 2008), cottage industry (e.g., village-made handicrafts: Snow Leopard Trust 2008), and well-structured ungulate trophy hunting programs;
  • Improve conservation education and awareness among a variety of stakeholders, from local communities to national governments to an international audience.

Theile (2003) recommends the following measures to reduce the threats of poaching and illegal trade:

  • Strengthen national legislation and conservation policies by filling gaps in range state legislation to prohibit the hunting, killing, possession, sale and trade of Snow Leopards, including all body parts and derivatives, at local regional and national levels; offering legal assistance and advice to governments; mete out sufficient deterrent penalties to law-breakers, and consider "whistle-blower" policies to provide incentives to report illegal activities;
  • Strengthen law enforcement capacity by tightening controls along known trade routes, and at markets and border crossings; improve inter-agency cooperation and intelligence sharing; establish anti-poaching teams to detect and deter illegal killing; carry out regular monitoring of major markets and trade centres; and improve technical capacity through training;
  • Strengthen international cooperation to enforce trade bans through adherence to CITES resolutions (e.g., Res. Conf. 12.5) (Nowell 2007).

The Snow Leopard Network (SLN 2008) unites individuals and organizations (including the International Snow Leopard Trust, the Snow Leopard Conservancy, and others) for coordination, cooperation and information sharing. An International Conference on Range-wide Conservation Planning for Snow Leopards held in Beijing, China in March 2008 identified important areas for Snow Leopard conservation (Snow Leopard Conservation Units) and provided a framework for the development of national action plans. Four countries have existing national action plans (Mongolia, Pakistan, Nepal and Russia: McCarthy et al. 2003), and India has developed Project Snow Leopard, a national governmental program for Snow Leopard conservation, although it has not been adequately funded (Anonymous 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Snow leopards are protected throughout most of their range and international trade is banned by their listing on Appendix I of the Convention on International Trade in Endangered Species (CITES) (5). The International Snow Leopard Trust and the Snow Leopard Conservancy are the world's two leading organizations dedicated specifically to conserving this endangered cat (6) (8). Both organisations have developed a multifaceted approach to the conservation of this species; involving research and data storage, educational initiatives, community-based conservation, and the protection of livestock to prevent retributive killing of snow leopards (6) (8). Local people are involved in various initiatives and there are plans to link fragmented populations by habitat corridors (3), which may improve the chances of the long-term survival of this secretive and critically endangered cat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Snow leopards occasionally kill domestic animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Snow leopards are important members of healthy, Himalayan ecosystems. Their presence indicates healthy wild ecosystems that are valuable for ecotourism and many other ecosystem services.

Positive Impacts: body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Snow leopard

The snow leopard (Panthera uncia or Uncia uncia) is a moderately large cat native to the mountain ranges of Central Asia[4]. The classification of this species has been subject to change and is still classified as Uncia uncia by MSW3 as of 2000[5] and CITES Appendix I[6]. However with more recent genetic studies[7][8] the snow leopard is now generally considered as Panthera uncia and classified as such by IUCN[9]. Classically, two subspecies have been attributed however genetic differences between the two have not been settled. The snow leopard remains on the endangered species list classified as C1.[10]

Snow leopards occupy alpine and subalpine areas generally 3,350 and 6,700 metres (10,990 and 22,000 ft)[11] above sea level in Central Asia. The Snow Leopard Survival Strategy (McCarthy et al. 2003, Table II) compiled national snow leopard population estimates, updating the work of Fox (1994). Many of the estimates are acknowledged to be rough and out of date, but the total estimated population is 4,080-6,590.[12] However, the global snow leopard effective population size (those likely to reproduce) is suspected to be fewer than 2,500 (50% of the total population, or 2,040-3,295).[13]

Snow leopards are smaller than the other big cats but, like them, exhibit a range of sizes, generally weighing between 27 and 55 kg (60 and 120 lb), with an occasional large male reaching 75 kg (170 lb) and small female of under 25 kg (55 lb).[14][15] Body length ranges from 75 to 130 centimetres (30 to 50 in), with the tail adding a further 80 to 100 cm (31 to 39 in) to that length.[16][17] These cats stand about 60 cm (24 in) at the shoulder.[18]

Snow leopards have long thick fur, and their base color varies from smoky gray to yellowish tan, with whitish underparts. They have dark gray to black open rosettes on their body with small spots of the same color on their heads and larger spots on their legs and tail. Unusually among cats, their eyes are pale green or gray in color.[16][17]

Snow leopards show several adaptations for living in a cold mountainous environment. Their bodies are stocky, their fur is thick, and their ears are small and rounded, all of which help to minimize heat loss. Their paws are wide, which distributes their weight better for walking on snow, and have fur on their undersides to increase their grip on steep and unstable surfaces; it also helps to minimize heat loss. Snow leopards' tails are long and flexible, helping them to maintain their balance, which is very important in the rocky terrain they inhabit. Their tails are also very thick due to storage of fats and are very thickly covered with fur which allows them to be used like a blanket to protect their faces when asleep.[17][19]

The snow leopard has a short muzzle and domed forehead, containing unusually large nasal cavities that help the animal breathe the thin, cold air of their mountainous environment.[16]

The snow leopard cannot roar, despite possessing partial ossification of the hyoid bone. This partial ossification was previously thought to be essential for allowing the big cats to roar, but new studies show that the ability to roar is due to other morphological features, especially of the larynx, which are absent in the snow leopard.[20][21] Snow leopard vocalizations include hisses, chuffing, mews, growls, and wailing.

Contents

Naming and etymology

Ounce

Both the Latinised genus name, Uncia, and the occasional English name "ounce" are derived from the Old French once, originally used for the European lynx. "Once" itself is believed to have arisen by back-formation from an earlier word "lonce" – the "L" of "lonce" was construed as an abbreviated "le" ("the"), leaving "once" to be perceived as the animal's name. This, like the English version "ounce", became used for other lynx-sized cats, and eventually for the snow-leopard.[22][23]

The snow leopard is also known in its native lands as shan (Ladakhi), irves (Mongolian: ирвэс), waawrin prraang (Pashto: واورين پړانګ), bars or barys (Kazakh: барыс [ˈbɑrəs]), ilbirs (Kyrgyz: Илбирс ) and barfani chita - "snow cheetah" (Urdu).

According to the American Heritage Dictionary, the origin of the word panthera is unknown. A folk etymology derives the word from the Greek πάν pan- ("all") and thēr ("beast of prey") because they can hunt and kill almost everything. It has also been proposed that it comes ultimately into Greek from a Sanskrit word meaning "the yellowish animal" or "whitish-yellow".[3] The Greek word πάνθηρ, pánthēr, referred to all spotted Felidae generically.

Taxonomy and evolution

Closeup of a male snow leopard

The snow leopard was first described by Schreber in 1775, in the Kopet-Dag Mountains in Turkmenistan and Iran. In the past, many taxonomists included the snow leopard in the genus Panthera, together with the other largest extant felids, but later it was placed in its own genus, Uncia. It was thought not to be closely related to the Panthera or other extant big cats. However, recent molecular studies place the species firmly within the genus Panthera, its closest relative being the tiger (Panthera tigris).[24][25] MSW3 still refers to the snow leopard as Uncia uncia but the more recent IUCN classifies it as Panthera uncia.[26][27] The Cat Classification Task Force, with the goal to propose on behalf of the Cat Specialist Group and the IUCN Red List Unit, and based on the best science and expert knowledge presently available, is currently working on an updated and practical classification of the Felidae, including genera, species and subspecies with the most likely distribution ranges of the respective taxa .[28]

A few subspecies have been proposed for animals living in different geographical regions. With the possible exception of U. u. baikalensis-romanii, which requires further evaluation, these subspecies were generally not considered valid.[3] The Handbook of the Mammals of the World recognizes two subspecies: U. u. uncia, from central Asia north-eastwards to Mongolia and Russia; and U. u. uncioides in western China and the Himalayas.[29]

Biology and behavior

In summer, snow leopards usually live above the tree line on mountainous meadows and in rocky regions at an altitude from 2,700 to 6,000 m (8,900 to 20,000 ft). In winter, snow leopards come down into the forests to an altitude of around 1,200 to 2,000 m (3,900 to 6,600 ft). Snow leopards prefer broken terrain and can travel without difficulty in snow up to 85 centimetres (33 in) deep, although snow leopards prefer to use existing trails made by other animals.[16]

The snow leopard leads a largely solitary life, although mothers may rear cubs in dens in the mountains for extended periods.

An individual snow leopard lives within a well-defined home range, but does not defend its territory aggressively when encroached upon by other snow leopards. Home ranges vary greatly in size. In Nepal, where prey is abundant, a home range may be as small as 12 km2 (5 sq mi) to 40 km2 (15 sq mi) and up to five to ten animals are found here per 100 km2 (40 sq mi); whereas in habitats with sparse prey, an area of 1,000 km2 (400 sq mi) supports only five of these cats.[20]

Like other cats, snow leopards use scent marks to indicate their territory and common travel routes. These are most commonly produced by scraping the ground with the hind feet before depositing urine or scat, but they also spray urine onto sheltered patches of rock.[16]

Snow leopards are crepuscular, being most active at dawn and dusk.[17] They are known for being extremely secretive and well camouflaged.

Hunting and diet

Showing teeth at Taronga Zoo, Australia

Snow leopards are carnivores and actively hunt their prey. Like many cats, they are also opportunistic feeders, eating whatever meat they can find, including carrion and domestic livestock. They can kill animals three to four times their size, such as the Bharal, Himalayan Tahr, Markhor and Argali, but will readily take much smaller prey such as hares and birds.[19] They are capable of killing most animals in their range with the probable exception of the adult male Yak. Unusually among cats, snow leopards also eat a significant amount of vegetation, including grass and twigs.[16]

The diet of the snow leopard varies across its range and with the time of year, and depends on prey availability. In the Himalayas, it preys mostly on bharals (Himalayan blue sheep) but in other mountain ranges such as the Karakoram, Tian Shan, and Altai, its main prey consists of Siberian ibex and argali, a type of wild sheep, although this has become rarer in some parts of the snow leopard's range.[17][30] Other large animals eaten include various types of wild goats and sheep (such as markhors and urials), other goat-like ruminants such as Himalayan tahr and gorals, plus deer, boars, and langur monkeys. Smaller prey consists of marmots, woolly hares, pikas, various rodents, and birds such as the snow cock and chukar.[17][19][30][31]

Considerable predation of domestic livestock occurs[32] which brings it into direct conflict with humans. Herders will kill snow leopards to prevent them from taking their animals.[19] The loss of prey animals due to over grazing by domestic livestock, poaching and defense of livestock are the major drivers for the decreasing population of Panthera uncia. Snow leopards have not been reported to attack humans, and appear to be among the least aggressive of all the big cats. As a result, they are easily driven away from livestock; they readily abandon their kills when threatened and may not even defend themselves when attacked.[16]

Snow leopards prefer to ambush prey from above, using broken terrain to conceal their approach, and can leap as far as 14 meters (46 ft).[33] They will actively pursue prey down steep mountainsides, using the momentum of their initial leap to chase animals for up to 300 metres (980 ft). They kill with a bite to the neck, and may drag the prey to a safe location before feeding. They consume all edible parts of the carcass, and can survive on a single bharal for two weeks before hunting again. Annual prey needs appears to be 20-30 adult blue sheep.[16][34]

Reproduction and life cycle

Snow Leopard cubs at the Cat Survival Trust, Welwyn, UK.

Snow leopards are unusual among large cats in that they have a well-defined birth peak. They usually mate in late winter, marked by a noticeable increase in marking and calling. Snow leopards have a gestation period of 90–100 days, so that the cubs are born between April and June. Oestrus typically lasts from five to eight days, and males tend not to seek out another partner after mating, probably because the short mating season does not allow sufficient time. Paired snow leopards mate in the usual felid posture, from 12 to 36 times a day.[16]

The mother gives birth in a rocky den or crevice lined with fur shed from her underside. Litter sizes vary from one to five cubs, but the average is 2.2. The cubs are blind and helpless at birth, although already with a thick coat of fur, and weigh from 320 to 567 grams (11 to 20.0 oz). The eyes open at around seven days, and the cubs can walk at five weeks and are fully weaned by 10 weeks.[16] Also when they are born they have full black spots and turn into rosettes as they grow up.[citation needed]

The cubs leave the den at around two to four months of age, but remain with their mother until they become independent after around 18–22 months. Once independent, they may disperse over considerable distances, even crossing wide expanses of flat terrain to seek out new hunting grounds. This likely helps reduce the inbreeding that would otherwise be common in their relatively isolated environment. Snow leopards become sexually mature at two to three years, and normally live for 15–18 years, although in captivity they can live for up to 21 years.[16]

Ecology

Distribution

A snow leopard at the Toronto Zoo

The snow leopard is currently restricted to Asia in Bhutan, China, India, Kazakhstan, Kyrgyzstan, Nepal, Pakistan, Russia, Tajikistan, and Uzbekistan.[35][36]

Its geographic distribution runs from the Hindu Kush in eastern Afghanistan and the Syr Darya through the mountains of Pamir Mountains, Tian Shan, Karakoram, Kashmir, Kunlun, and the Himalaya to southern Siberia, where the range covers the Russian Altai mountains, Sayan, Tannu-Ola mountains and the mountains to the west of Lake Baikal. In Mongolia, it is found in the Mongolian and Gobi Altai and the Khangai Mountains. In Tibet it is found up to the Altyn-Tagh in the north.[17][19][37]

Conservation status

There are numerous agencies working to conserve the snow leopard and its threatened mountain ecosystems. These include the Snow Leopard Trust, the Snow Leopard Conservancy, the Snow Leopard Network, the Cat Specialist Group and the Panthera Corporation. These groups and numerous national governments from the snow leopard’s range, non-profits and donors from around the world recently worked together at the 10th International Snow Leopard Conference in Beijing. Their focus on research, community programs in snow leopard regions and education programs are aimed at understanding the cat's needs as well as the needs of the villagers and herder communities affecting snow leopards' lives and habitat.[38][39]

Population and protected areas

Snow leopard at zoo d'Amnéville, France, showing the thickly furred tail
Snow leopard

The total wild population of the snow leopard was estimated at only 4,080 to 6,590 individuals by McCarthy, et al., 2003 (see table below). Many of these estimates are rough and outdated.[1]

In 1972, the International Union for Conservation of Nature (IUCN) placed the snow leopard on its Red List of Threatened Species as globally "Endangered"; the same threat category was applied in the assessment conducted in 2008.

There are also 600-700 snow leopards in zoos around the world.[40]

Range CountryHabitat Area
(km2.)
Estimated
Population[1]
Afghanistan50,000100-200?
Bhutan15,000100-200?
China1,100,0002,000-2,500
India75,000200-600
Kazakhstan50,000180-200
Kyrgyzstan105,000150-500
Mongolia101,000500-1,000
Nepal30,000300-500
Pakistan80,000200-420
Tajikistan100,000180-220
Uzbekistan10,00020-50
Snow leopard in the San Diego Zoo.

Protected areas:

Much progress has been made in securing the survival of the Snow Leopard, with Snow Leopards being successfully bred in captivity. The animals usually give birth to two to three cubs in a litter, but can give birth to up to seven in some cases.

A "surprisingly healthy" population of Snow Leopards has been found living at 16 locations in the isolated Wakhan Corridor in northeastern Afghanistan giving rise to hopes for survival of wild Snow Leopards in that region.[45]

Relationships with humans

Snow leopard in film and television

The first documentary on snow leopards was made by Hugh Miles, named Silent Roar - In Search of the Snow Leopard.

Planet Earth has a segment on snow leopards. The series took some of the first video of snow leopards in the wild and also featured a snow leopard hunting a markhor.[46]

Nisar Malik, a Pakistani journalist, and cameraman Mark Smith (who had worked on the Planet Earth segment) spent a further 18 months filming snow leopards in the Hindu Kush for the BBC film Snow Leopard - Beyond the Myth.[47]

Snow leopard in heraldry

Snow leopards have symbolic meaning for Turkic people of Central Asia, where the animal is known as irbis or bars, so it is widely used in heraldry and as an emblem.

The snow leopard (in heraldry known as the ounce) (Aq Bars) is a national symbol for Tatars and Kazakhs: a snow leopard is found on the official seal of the city of Almaty, and a winged snow leopard is found on Tatarstan's coat of arms. A similar leopard is featured on the coat of arms of North Ossetia-Alania. The Snow Leopard award was given to Soviet mountaineers who scaled all five of the Soviet Union's 7000m peaks. In addition, the snow leopard is the symbol of the Girl Scout Association of Kyrgyzstan.

References

  1. ^ a b c Jackson, R., Mallon, D., McCarthy, T., Chundaway, R.A. & Habib, B. (2008). Panthera uncia. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 9 October 2008.
  2. ^ "Uncia Gray, 1854". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=183810. Retrieved December 14, 2011. 
  3. ^ a b Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 548. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000269. 
  4. ^ http://www.snowleopard.org/catfactsclassroom/catfacts/habitatandrange
  5. ^ http://www.bucknell.edu/msw3/browse.asp?s=y&id=14000269
  6. ^ http://www.cites.org/eng/app/appendices.php
  7. ^ http://www.iucnredlist.org/apps/redlist/details/22732/0
  8. ^ http://www.catsg.org/catnews/02_webarchive/news-nr48-2008/content-nr48-2008.htm#Article%2002
  9. ^ http://www.iucnredlist.org/apps/redlist/details/22732/0
  10. ^ http://www.iucnredlist.org/apps/redlist/details/22732/0
  11. ^ The Role of Incentive Programs in Conserving the Snow Leopard, CHARUDUTT MISHRA1,2, PRISCILLA ALLEN1, TOM McCARTHY,M. D. MADHUSUDAN, AGVAANTSERENGIIN BAYARJARGAL1, HERBERT H. T. PRINS. doi:10.1111/j.1523-1739.2003.00092.x, Conservation Biology Volume 17, Issue 6, pages 1512–1520, December 2003
  12. ^ http://www.carnivoreconservation.org/files/attente/pdfs/slss_big.pdf
  13. ^ http://www.iucnredlist.org/apps/redlist/details/22732/0
  14. ^ Boitani, Luigi, Simon & Schuster's Guide to Mammals. Simon & Schuster/Touchstone Books (1984), ISBN 978-0-671-42805-1
  15. ^ [1] (2011).
  16. ^ a b c d e f g h i j k Sunquist, Mel; Sunquist, Fiona (2002). Wild cats of the World. Chicago: University of Chicago Press. pp. 377–394. ISBN 0-226-77999-8. 
  17. ^ a b c d e f g "Snow Leopard Fact Sheet". Snow Leopard Trust. 2008. http://www.snowleopard.org/external_files/media/Snow-Leopard-Fact-Sheet.pdf. Retrieved 2008-10-23. 
  18. ^ http://www.snowleopard.org/catfactsclassroom/catfacts/physicalfeatures
  19. ^ a b c d e "Snow Leopard profile". National Geographic. 2008. http://animals.nationalgeographic.com/animals/mammals/snow-leopard.html. Retrieved 2008-10-23. 
  20. ^ a b Nowak, Ronald M. (1999). Walker's Mammals of the World. Johns Hopkins University Press. ISBN 0-8018-5789-9. 
  21. ^ Weissengruber, GE; G Forstenpointner, G Peters, A Kübber-Heiss, and WT Fitch (September 2002). "Hyoid apparatus and pharynx in the lion (Panthera leo), jaguar (Panthera onca), tiger (Panthera tigris), cheetah (Acinonyx jubatus) and domestic cat (Felis silvestris f. catus)". Journal of Anatomy. Anatomical Society of Great Britain and Ireland. pp. 195–209. doi:10.1046/j.1469-7580.2002.00088.x. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1570911. Retrieved 2007-05-20. 
  22. ^ Allen, Edward A (1908). "English Doublets". Publications of the Modern Language Association of America 23 (new series 16): 214. http://www.archive.org/stream/publications23modeuoft#page/214/mode/1up. 
  23. ^ Oxford English Dictionary, Oxford University Press. 1933: Ounce
  24. ^ Davis, B.W.; Li G., Murphy W.J (2010 Jul). "Supermatrix and species tree methods resolve phylogenetic relationships within the big cats, Panthera (Carnivora: Felidae)". Molecular Phylogenetic Evolution (56): 64–76. doi:10.1016/j.ympev.2010.01.036. PMID 20138224. 
  25. ^ http://www.iucnredlist.org/apps/redlist/details/22732/0
  26. ^ http://www.iucnredlist.org/apps/redlist/details/22732/0
  27. ^ Johnson, W.E.; Eizirik, E., Pecon-Slattery, J., Murphy, W.J., Antunes, A., Teeling, E. & O'Brien, S.J. (6 January 2006). "The Late Miocene radiation of modern Felidae: A genetic assessment". Science 311 (5757): pp73–77. doi:10.1126/science.1122277. PMID 16400146. http://www.sciencemag.org/cgi/content/abstract/311/5757/73. Retrieved 2008-10-24. 
  28. ^ http://www.catsg.org/catnews/20_cat-news-website/home/index_en.htm
  29. ^ Wilson DE, Mittermeier RA (eds) (2009) Handbook of the Mammals of the World. Vol. 1. Carnivores. Lynx Edicions, Barcelona
  30. ^ a b Jackson, Rodney; Hunter, Don O. (1996). "Snow Leopard Survey and Conservation Handbook Part III" (pdf). Snow Leopard Survey and Conservation Handbook. Seattle, Washington, & Fort Collins Science Center, Colorado, US: International Snow Leopard Trust & U.S. Geological Survey. pp. 66. http://www.snowleopardconservancy.org/pdf/SL_Survey_Cons_Handbook_Part_3.pdf. Retrieved 2009-03-14. 
  31. ^ unknown (2004). "Conservation of the Snow Leopard in Nepal" (pdf). Seattle, US: The Snow Leopard Network. pp. 2. http://www.snowleopardnetwork.org/bibliography/dscs92.pdf. Retrieved 2009-03-14. 
  32. ^ http://www.iucnredlist.org/apps/redlist/details/22732/0
  33. ^ "Animal Bytes: snow leopard". San Diego Zoo. 2007. http://www.sandiegozoo.org/animalbytes/t-snow_leopard.html. Retrieved 2007-05-05. 
  34. ^ http://www.iucnredlist.org/apps/redlist/details/22732/0
  35. ^ http://www.carnivoreconservation.org/files/attente/pdfs/slss_big.pdf
  36. ^ http://www.iucnredlist.org/apps/redlist/details/22732/0
  37. ^ Mammals of the Soviet Union. Vol III: Carnivores (Feloidea).
  38. ^ Theile, Stephanie "Fading footprints; the killing and trade of snow leopards" TRAFFIC International, 2003
  39. ^ Foreign Correspondent, "Cats in the Clouds", Australian Broadcasting Corporation, 2009. Retrieved 27 June 2009.
  40. ^ "Population and Protections". Snow Leopard Trust. 2008. http://www.snowleopard.org/catfactsclassroom/catfacts/population/document_view. Retrieved 2008-07-03. 
  41. ^ UNESCO World Heritage Centre Nanda Devi and Valley of Flowers National Parks. Brief Description. Retrieved 27 November 2006.
  42. ^ Snow Leopard Conservancy. 2006. Training park managers in the conservation of snow leopards. Retrieved 27 November 2006.
  43. ^ UNESCO World Heritage Center. Sagarmatha National Park: Brief Description. Retrieved 27 November 2006.
  44. ^ Snow Leopard Network. 2005. Camera Trapping of Snow Leopards in the Muzat Valley. Retrieved 27 November 2006.
  45. ^ "Snow Leopards found in Afghanistan." Ben Farmer. The Telegraph, Saturday 16 July 2011. [2]
  46. ^ http://www.bbc.co.uk/pressoffice/pressreleases/stories/2006/02_february/01/earth_firsts.shtml
  47. ^ http://www.bbc.co.uk/programmes/b008mcdq
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!