Overview

Brief Summary

Biology

The clouded leopard has amazing tree climbing abilities, indeed in Malaysia its local name actually means 'branch-of-a-tree tiger' (4). It has been seen running head-first down tree trunks, climbing about on the underside of branches, and hanging upside down by its hind feet with the tail providing balance (6). The ability to climb trees allows it to forage for food in the canopy although it mainly uses the tree branches for resting. This species also swims well and has been found on small islands off the mainland in the past (6). It hunts by day or night, either stalking its prey on the ground or by ambushing it from the trees (7). It was originally thought that the long canines were for preying on large ungulates, though recent studies show that it feeds mainly on primates, birds, small mammals, porcupines, deer, and wild boar, as well as domestic livestock (5). These leopards are believed to be solitary animals except during the breeding season, when the males seek out the females (2), though little is known about their biology due to their elusiveness and so most information comes from captive individuals (7). The gestation period is between 86 and 93 days, and the female bears between one and five cubs, each weighing around 150 – 280 grams (4). Born with much darker side markings than the adults they are nursed for up to five months and achieve independence at nine months (7). It is not known how long the clouded leopard lives for in the wild, but captive individuals have lived for up to seventeen years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Smithsonian Channel Video: Ghost Cat: Saving the Clouded Leopard (Full Episode)
Public Domain

 

Supplier: Katja Schulz

Trusted

Article rating from 2 people

Average rating: 1.0 of 5

Comprehensive Description

Description

The clouded leopard is named after the distinctive 'clouds' on its coat - ellipses partially edged in black, with the insides a darker colour than the background colour of the pelt (4). The base of the fur is a pale yellow to rich brown, making the darker cloud-like markings look even more distinctive (5). The limbs and underbelly are marked with large black ovals, and the back of its neck is conspicuously marked with two thick black bars (6). The clouded leopard is about the size of a small Labrador retriever with a body length of up to 90 cm, an intermediate size between the large and small cats of the world (4). It does, however, have an exceptionally long tail for balancing, which can be as long as the body itself, thick with black ring markings (2). In proportion to its body size it also has the largest canines of all the cats, a feature that has earned this cat the reputation of being the 'modern day sabre-tooth' (5). Well adapted to forest life, the clouded leopard also has relatively short legs and broad paws which make it excellent at climbing trees and creeping through thick forest (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The clouded leopard is found from the Himalayan foothills in Nepal through mainland Southeast Asia into China (Nowell and Jackson 1996). The clouded leopard historically had a wide distribution in China, south of the Yangtze, but recent records are few, habitat is fast disappearing, illegal hunting of this species has been prolific and its current distribtution in China is poorly known (Wozencraft et al. 2008). The clouded leopard is extinct on the island of Taiwan (Anon. 1996). It still occurs marginally in Bangladesh: Khan (2004) reported that local people still see clouded leopards in the mixed-evergreen forests of the northeastern and southeastern parts of the country.

The clouded leopards of Sumatra and Borneo were recently diagnosed as a separate species Neofelis diardi (Buckley-Beason et al. 2006, Kitchener et al. 2006, Eizirik et al. submitted), the Sundaland clouded leopard. Sundaland refers to the Malay peninsula and the islands of Sumatra, Borneo and Java. Clouded leopards do not occur on Java. Because of limited samples from Peninsular Malaysia, it is unclear which species of clouded leopard occur here - on the basis of a single skin, Kitchener et al. (2006) ascribed Peninsular Malayasia to the mainland clouded leopard, but indicated that more samples were needed for confirmation.

The map shows range within forest cover (European Commission, Joint Research Centre, 2003) to reflect patchiness caused by deforestation upon recommendation of the assessors (IUCN Cats Red List workshop 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Clouded leopards, Neofelis nebulosa, are found south of the Himalayas in Nepal, Bhutan, and some areas of northeastern India. Myanmar, southern China, Taiwan, Vietnam, Laos, Cambodia, Thailand, and mainland Malaysia make up the southern parts of its geographic range. Three subspecies are recognized, occupying different regions within the range. Neofelis nebulosa nebulosa is found from southern China to mainland Malaysia; Neofelis nebulosa brachyura formerly lived in Taiwan but is now probably extinct; and Neofelis nebulosa macrosceloides is found from Myanmar to Nepal. Until recently, Neofelis diardi was classified as a subspecies of Neofelis nebulosa, but researchers studying molecular evidence now consider it to be a separate species. Neofelis diardi inhabits the islands of Borneo and Sumatra.

Biogeographic Regions: oriental (Native )

  • Sunquist, M., F. Sunquist. 2002. Wild Cats of the World. Chicago: University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The clouded leopard is found in tropical and sub-tropical forests from India, South China, Burma, and Indochina to Sumatra and Borneo (5). Despite this wide distribution, it actually has a very low population and is very thinly dispersed (5). The clouded leopard's total effective population size is estimated at below 10,000 mature breeding individuals; no subpopulation contains more than 1,000 mature breeding individuals (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Southeastern and south-central Asia, Taiwan

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Physical Description

The distinctive cloud-shaped markings of their coats make clouded leopards unmistakable. The fur is marked with elliptical blotches of a darker color than the background and the posterior edge of each blotch is partially framed in black. The blotches sit on a background field that varies from yellowish brown to dark gray. The muzzle is white and solid black spots mark the forehead and cheeks. The ventral side and limbs are marked with large, black ovals. Two solid black bars run from behind the ears along the back of the neck down to the shoulder blades and the bushy, thick tail is ringed in black. In juveniles, lateral spots are solid, not clouded. These will change by the time the animal is approximately six months old.

Adults usually weigh between 18 and 22 kilograms and stand at 50 to 60 centimeters at the shoulder. The head-body length is between 75 and 105 centimeters, and the tail length is between 79 and 90 centimeters, which is nearly as long as the body itself. There is no marked sexual dimorphism in clouded leopards, although females are slightly smaller. The legs are relatively short compared to other felids, with the hind limbs being longer than the fore limbs. The ankles have a wide range of motion and the feet are large and padded with retractile claws. As in other members of the family Felidae, the radius and the ulna are not fused, which allows for greater independence of motion. Clouded leopards have a digitigrade stance.

The skull is long and narrow compared to other felids and has well-developed crests to support the jaw muscles. Clouded leopards have the longest canine teeth relative to head and body size of any of the felids; canines can reach four centimeters or longer. A wide diastema lies between the premolars and canines, and individuals are often missing their first premolar.

The nose pad is pink and sometimes has small black spots, and the ears are short and round. The iris of the eye is usually brownish yellow or grayish green, and the pupils contract into vertical slits.

Range mass: 11 to 23 kg.

Average mass: 18-22 kg.

Range length: 123 to 200 cm.

Average length: 154-195 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • The Clouded Leopard Project. 2008. "About the Clouded Leopard" (On-line). The Clouded Leopard Project: Supporting Clouded Leopard Conservation and Research. Accessed March 26, 2009 at http://cloudedleopard.org/default.aspx?link=about_main.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The clouded leopard is intermediate in size between large and small cats, with wild females from Thailand weighing 11.5 (Austin and Tewes 1999) to 13.5 kg (Grassman et al. 2005), and males 16 (Grassman et al. 2005) to 18 kg (Austin and Tewes 1999). Its coat is patterned with distinctive large cloud shaped markings, its canines are exceptionally elongated, as is its tail - for a large cat, the clouded leopard is highly arboreal (Sunquist and Sunquist 2002). They are strongly associated with forest habitat, particularly primary evergreen tropical rainforest, but there are also records from dry and deciduous forest, as well as secondary and logged forests. They have been recorded in the Himalayas up to 2,500 m and possibly as high as 3,000 m. Less frequently, they have been found in grassland and scrub, dry tropical forests and mangrove swamps (Nowell and Jackson 1996). Radio-tracking studies in Thailand have showed a preference for forest over more open habitats (Austin et al. 2007).

A study in Thailand's Phu Khieu National Park found that clouded leopards preyed upon a variety of arboreal and terrestrial prey, including hog deer, slow loris, bush-tailed porcupine, Malayan pangolin and Indochinese ground squirrel (Grassman et al. 2005). Other observations include mainly primate prey, but also muntjac and argus pheasant (Nowell and Jackson 1996). Clouded leopards are primarily nocturnal, with crepuscular activity peaks (Grassman et al. 2005, Austin et al. 2007).

Two radio-telemetry studies in different parks in Thailand have found that adult male and female clouded leopards had similar home range sizes between 30-40 km² in size (95% fixed kernel estimators), with smaller intensively used core areas of 3-5 km² (Grassman et al. 2005, Austin et al. 2007). While both studies found substantial home range overlap between males and females, as is typical of most felids, Grassman et al. (2005) also found that the ranges of their two radio-collared males overlapped by a significant amount (39%). Although both studies found similar home ranges, clouded leopards in Phu Khieu National Park travelled approximately twice the average daily distance (average 2 km) than clouded leopards in Khao Yai National Park (Grassman et al. 2005, Austin et al. 2007).

Clouded leopards may occur at higher densities where densities of the larger cats, tigers and leopards, are lower (Lynam et al. 2001, Grassman et al. 2005, Rao et al. 2005).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Clouded leopards occupy tropical forests at elevations up to 3000 meters. They are highly arboreal, using trees primarily for resting and also for hunting. However, they spend more time hunting on the ground than was originally believed. Sightings of clouded leopards occur most often in primary evergreen tropical forest but they have also been sighted in other habitats, such as secondary forest, logged forest, mangrove swamp, grassland, scrub land, dry tropical forest, and coastal hardwood forest.

Range elevation: 0 to 3000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest ; mountains

Wetlands: swamp

  • IUCN. 1996. "Clouded Leopard, Neofelis nebulosa" (On-line). IUCN/SSC Cat Specialist Group. Accessed March 21, 2009 at http://www.catsg.org/catsgportal/cat-website/20_cat-website/home/index_en.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

These shy and elusive cats are usually associated with tropical forests, but they also make use of other habitats. They have been seen in primary and secondary logged forest as well as grassland and scrub, mangrove swamps and even dry tropical forest (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Little is known about the feeding behavior of clouded leopards. Like other felids, they are strict carnivores. They are also solitary hunters, preying on birds, fish, monkeys, deer, and rodents. Prey species include argus pheasant, stump-tailed macaque, slow loris, silvered leaf monkey, sambar, hog deer, Indian muntjac, lesser mouse-deer, wild boar, bearded pig, Malayan pangolin, Indochinese ground squirrel, Asiatic brush-tailed porcupine, and masked palm civet. They have also been known to kill domestic animals, including calves, pigs, goats, and poultry. Fish remains have been found in the excrement of wild clouded leopards. Clouded leopards kill prey with a bite to the back of the neck, which snaps the spine. They pull flesh off of the carcass by stabbing the meat with its incisors and large canines and then abruptly jerking the head back.

Animal Foods: birds; mammals; fish

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Clouded leopards are one of the top predators in their range, especially where tigers and leopards are absent. They play a role in controlling populations of prey species, which effectively limits the impact which these populations have on the ecosystem. For example, by preying on cervids and keeping population size low, clouded leopards prevent excessive stress on plant populations. Like all other mammals, clouded leopards can be hosts for many internal parasites, as well as ectoparasites. Internal parasites found in the feces of clouded leopards include liver flukes (Dicrocoeliidae), intestinal flukes (Echinostomatidae), Paragonimus westermanni, Gnathostoma spinigerum, pseudophyllid cestodes (Pseudophyllidea), cyclophyllidean tapeworms (Mesocestoididae, Hymenolepididae, Taeniidae), Toxoplasma gondii, Mammomonogamus, Toxascaris, Oncicola, Sarcocystis, and Giardia. Many of these parasites are probably acquired from prey species. Ectoparasites of clouded leopards include several tick species: Amblyomma testudinarium, Haemaphysalis asiatica, Haemaphysalis hystricis, Haemaphysalis semermis, Rhipicephalus haemaphysaloides, and Ixodes granulatus.

Commensal/Parasitic Species:

  • Patton, S., A. Rabinowitz. 1994. Parasites of Wild Felidae in Thailand: A Coprological Survey. Journal of Wildlife Diseases, 30(3): 472-475.
  • Grassman, L., N. Sarataphanab, M. Tewesa, N. Silvyac, T. Nakanakratad. 2004. Ticks (Acari: Ixodidae) Parasitizing Wild Carnivores in Phu Khieo Wildlife Sanctuary, Thailand. Journal of Parasitology, 90(3): 657-659.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The main predators of clouded leopards are humans, who use dogs to track and corner them. For this reason, clouded leopards avoid humans and they are rarely found near human settlements. Clouded leopards share much of their range with tigers and leopards. In these shared areas clouded leopards seem to have a more arboreal and nocturnal lifestyle. The reason for this is undocumented, but researchers suspect that tigers and leopards kill clouded leopards to eliminate competition. Therefore, clouded leopards are more active at night and spend more time in trees to avoid these large predators. Their patterned coat serves as camouflage when they are stalking their prey and attempting to remain hidden from other predators.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like other felids, clouded leopards have keen vision as well as good senses of smell and hearing. Captive clouded leopards mark their territories by clawing trees, urine spraying, scraping, and head rubbing, all of which are typical scent-marking behaviors. Vocalizations made by captive animals are characteristic of members of the family Felidae, which include growling, mewing, hissing, and spitting. Clouded leopards do not purr, but they do make a low-intensity snorting noise called “prusten” when they have friendly interactions with other individuals. Clouded leopards, tigers, snow leopards, and jaguars are the only felids that use this type of vocalization. They also have a long moaning call that can be heard across distances. The purpose of this call is unknown, but observers think it is a form of communication between animals in different territories, perhaps as a mating call or to warn other cats away from their territory. Clouded leopards also have vibrissae on their muzzles, which detect tactile stimuli, especially at night.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average lifespan of wild clouded leopards is estimated to be 11 years. Individuals in zoos have been recorded living up to 17 years, with the average between 13 and 15 years. For wild clouded leopards, hunting or habitat destruction by humans limits lifespan. Clouded leopards also share parts of their geographic range with larger predators that kill potential competitors, such as tigers or leopards. Clouded leopards may spend a significant amount of time in trees for this reason. Studies have not been conducted regarding diseases that may limit the lifespan of clouded leopards. The number of deaths by other clouded leopards also remains unknown.

Average lifespan

Status: wild:
11 years.

Range lifespan

Status: captivity:
17 (high) years.

Average lifespan

Status: captivity:
13-15 years.

Average lifespan

Status: wild:
11 years.

Typical lifespan

Status: captivity:
17 (high) days.

Average lifespan

Status: captivity:
13-15 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.8 years (captivity) Observations: One captive specimen lived 19.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Reproduction

Reproduction

All that is known about the mating behavior of clouded leopards comes from observations of captive animals. This lack of knowledge concerning wild mating behavior has made it extremely difficult to breed these animals in captivity. Arranged mating encounters at zoos often conclude with aggression between the two individuals, and the male often kills the female with a bite to the back of the neck. For this reason, many experts believe that compatibility between a male and female is important for productive matings. The most successful matings have occurred between a male and female that were raised together from only a few weeks of age. However, researchers do not believe that clouded leopards are monogamous in the wild. In zoos, mating usually occurs between December and March, but it can occur at any time throughout the year. Because clouded leopards occupy tropical habitats, breeding may be less seasonal in the wild. The mating pair copulates many times over the course of several days. The male typically grasps the female with a bite to the back of the neck before an intromission, and the female vocalizes once the intromission occurs. In the wild, clouded leopards use elevated areas to deliver a long moaning call that travels well. This call is suspected to be a mating call, but it may be a territorial call instead.

The gestation period for captive clouded leopards normally lasts between 88 and 95 days, although it can last anywhere from 85 to 109 days. Females most often give birth to two kittens per pregnancy, but litters of one to five kittens have been documented as well. Kittens are born with the large spots that are characteristic of their adult counterparts, but these spots are solid black until approximately six months of age. A newborn kitten weighs between 140 and 280 grams, depending on the size of the litter. Kittens first open their eyes between two and eleven days of age. Clouded leopard kittens begin walking at 20 days of age, and they can climb trees as early as six weeks old. They start to consume flesh between 7 and 10 weeks old, and they are weaned shortly thereafter at 10 to 14 weeks. It has been reported that clouded leopard kittens are able to kill chickens at 10 weeks old. At zoos, clouded leopard kittens are typically taken away from their mothers to be hand-reared but, in the wild, kittens normally stay with their mothers for about ten months. Little is known about the interbirth interval of female clouded leopards. The length of time between births for captive cats has ranged from 10 to 16 months. Clouded leopards in captivity arrive at sexual maturity between 20 and 30 months of age, with the average being 23 to 24 months.

Breeding interval: The length of time between matings for captive cats has ranged from 10 to 16 months.

Breeding season: In captivity, breeding usually occurs between December and March, but it can occur year round.

Range number of offspring: 1 to 5.

Average number of offspring: 2.

Range gestation period: 85 to 109 days.

Average gestation period: 88-95 days.

Range birth mass: 140 to 280 g.

Range weaning age: 10 to 14 weeks.

Average time to independence: 10 months.

Range age at sexual or reproductive maturity (female): 20 to 30 months.

Average age at sexual or reproductive maturity (female): 23-24 months.

Range age at sexual or reproductive maturity (male): 20 to 30 months.

Average age at sexual or reproductive maturity (male): 23-24 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average number of offspring: 2.

After mating, male and female clouded leopards separate, and the male does not take part in the rearing of offspring. The gestation period is typically between 88 and 95 days. The female does not appear pregnant until the third trimester, at which time her abdomen and nipples become larger. When the kittens are born, the mother licks them to keep them clean and warm. She continues to clean them until they learn to do so themselves. It is unknown where a female keeps her young while she is hunting, but she probably hides them in dense vegetation. Females produce milk for the kittens, which is their sole source of nutrition until they are between 7 and 10 weeks old. They are completely weaned when they are between 10 and 14 weeks of age. Until they are approximately 10 months old, the mother continues to provide them with prey while they grow and learn to hunt for themselves. At this age, they leave their mothers to find their own territories.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

  • Sunquist, M., F. Sunquist. 2002. Wild Cats of the World. Chicago: University of Chicago Press.
  • Kitchener, A. 1991. The Natural History of the Wild Cats. Ithaca, New York: Cornell University Press.
  • Turner, A. 1997. The Big Cats and Their Fossil Relatives. New York: Columbia University Press.
  • The Clouded Leopard Project. 2008. "About the Clouded Leopard" (On-line). The Clouded Leopard Project: Supporting Clouded Leopard Conservation and Research. Accessed March 26, 2009 at http://cloudedleopard.org/default.aspx?link=about_main.
  • IUCN. 1996. "Clouded Leopard, Neofelis nebulosa" (On-line). IUCN/SSC Cat Specialist Group. Accessed March 21, 2009 at http://www.catsg.org/catsgportal/cat-website/20_cat-website/home/index_en.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neofelis nebulosa

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0704-06|NC_008450|Neofelis nebulosa| AACCGCTGACTATTTTCAACTAACCATAAAGATATTGGAACTCTTTACCTTTTATTTGGCGCTTGGGCCGGTATAGTAGGGACTGCTCTT---AGTCTTTTAATTCGAGCTGAGCTGGGTCAACCTGGCACGCTACTAGGGGAT---GACCAGATTTATAATGTAGTCGTCACTGCTCATGCCTTCGTAATAATCTTTTTTATAGTAATACCCATTATGATTGGAGGGTTTGGAAACTGACTGGTCCCATTAATA---ATTGGGGCCCCCGACATAGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTTCCTCCGTCTTTCCTACTTTTGCTCGCATCGTCTATAGTAGAGGCCGGGGCAGGAACTGGGTGGACAGTGTACCCGCCCCTAGCCGGCAATCTGGCCCATGCAGGAGCATCTGTAGACTTG---ACTATCTTTTCACTACATCTAGCGGGTGTTTCCTCTATCCTGGGCGCTATTAATTTTATTACTACTATTATTAATATAAAACCTCCTGCCATATCTCAATACCAAACACCACTATTTGTCTGATCAGTCTTAATCACTGCTGTATTACTGCTTTTATCACTGCCAGTTCTAGCAGCA---GGTATTACTATGCTACTGACAGATCGAAATTTAAATACTACATTTTTCGACCCTGCTGGGGGAGGGGACCCTATCCTATATCAACACTTATTCTGGTTTTTCGGTCATCCAGAGGTTTATATTTTAATTTTACCCGGGTTTGGAATAATTTCACATATCGTCACCTACTACTCCGGTAAAAAA---GAGCCTTTTGGCTATATGGGAATGGTTTGAGCTATAATGTCAATTGGCTTTCTGGGCTTTATCGTATGAGCTCACCATATGTTTACTGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Neofelis nebulosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
C1+2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Sanderson, J., Khan, J.A., Grassman, L. & Mallon, D.P.

Reviewer/s
Nowell, K., Breitenmoser-Wursten, C., Breitenmoser, U. (Cat Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
The clouded leopard is forest-dependent, and its habitat is undergoing the world's fastest regional deforestation rates (over 10% in the past ten years: FAO 2007). There are high levels of illegal trade in its skin and bones (Nowell 2007). Its total effective population size is suspected to be fewer than 10,000 mature individuals, with no single population numbering more than 1,000 (IUCN Cats Red List Workshop 2007).

History
  • 2002
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Little is known about the population status of clouded leopards because actual population estimates are difficult to obtain. The chief threat for clouded leopard populations is habitat loss due to deforestation for agricultural purposes. Humans hunt clouded leopards for their pelts and teeth, as well as for use in traditional medicine and culinary trades. In a survey conducted by the IUCN in 1991 in southeastern China, clouded leopard pelts were common on the black market. The Taiwanese purchase most clouded leopard products and the Taiwanese subspecies of clouded leopards (Neofelis nebulosa brachyura) is thought to be extinct as a result. Trade of clouded leopard products has been prohibited by CITES since 1975. Laws now protect clouded leopards over the majority of their range. Hunting is strictly prohibited in Bangladesh, Brunei, China, India, Indonesia, Malaysia, Myanmar, Nepal, Taiwan, Thailand, and Vietnam; hunting is regulated in Laos. The IUCN lists clouded leopards as vulnerable, and they are also listed under the U.S. Endangered Species Act, which prohibits the trade of any part of the animal in the United States. Still, prohibition of hunting of clouded leopards does not necessarily decrease demand and pelts have been reported on sale in urban markets in Myanmar, Laos, Vietnam, Cambodia, Nepal, and Thailand. Clouded leopards face persecution by farmers who feel that their livestock is at risk. Populations have been fragmented by deforestation, increasing the susceptibility of the entire species to infectious disease and natural catastrophic events. Efforts have been made in Nepal, Malaysia, and Indonesia to establish national parks in order to sustain populations of clouded leopards. Unfortunately, due to their elusive nature and dense forest habitats, data on the numbers actually surviving in parks are limited and possibly inaccurate.

US Federal List: endangered

CITES: appendix i

State of Michigan List: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Neofelis nebulosa , see its USFWS Species Profile

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Status

Classified as Vulnerable (VU C2a(i)) on the IUCN Red List 2002 (1) and is listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Population

Population
The clouded leopard is most strongly associated with primary tropical forest which is rapidly disappearing across its range (Nowell and Jackson 1996), and clouded leopard skins have been observed in large numbers in illegal wildlife trade in Southeast Asia (Nowell 2007). Increasing use of camera traps has helped to better document its distribution and recent research efforts should help improve understanding of its population status (Grassman et al. 2005, Austin et al. 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Clouded leopards prefer closed forest (Grassman et al. 2005, Austin et al. 2007), and their habitat in Southeast Asia is undergoing the world's fastest deforestation rate (1.2-1.3% a year since 1990: FAO 2007).

The clouded leopard is hunted for the illegal wildlife trade - large numbers of skins have been seen in market surveys, and there is also trade in bones for medicines, meat for exotic dishes and live animals for the pet trade. Wild animals are likely the primary source, but there is also some illegal trade from captive animals (Nowell 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Deforestation resulting from commercial logging and the growth of human settlements is thought to be the foremost threat to this species, (7). Not only does deforestation remove the clouded leopard's own shelter and habitat, but it reduces the number of prey species (4). As humans have increasingly encroached on their habitats, these leopards have been known to prey on livestock which puts them at risk of being killed by the owners (2). Another major threat is the hunting of this cat for its beautiful pelt and decorative teeth as well as its bones, which are prized in the traditional Asian medicinal trade (6). Clouded leopards have even featured on the menu of restaurants in Thailand and China which cater to wealthy Asian tourists (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Included on CITES Appendix I and protected by national legislation over most of its range (Nowell and Jackson 1996). Hunting is banned in Bangladesh, Brunei, Cambodia, China, India, Indonesia, Malaysia, Myanmar, Nepal, Taiwan, Thailand, and Viet Nam, and hunting regulations apply in Lao PDR (Nowell and Jackson 1996). It occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The clouded leopard is generally protected under game laws and fully protected in parks and reserves, but there is not enough knowledge about wild populations to draw firm conclusions about the success of these conservation measures. The Formosan clouded leopard of Taiwan, (N. nebulosa brachyurus) a subspecies of Neofelis is thought to be extinct, and is an indication of the possible fate of clouded leopards elsewhere (2). Captive breeding programmes were initially unsuccessful due to the small gene pool available in captive as well as wild individuals (2). In addition, there has been high incidence of males killing females in captivity (5). The Clouded Leopard Species Survival Plan (SSP) recognised these problems and in the late 1990s set up the Thailand Clouded Forest Foundation to research the behaviour of these cats and improve captive management and artificial reproduction (8). In 1998, 22 compatible pairs were given breeding recommendations and from January 1998 to August 2001, a total of 52 births occurred from 12 pairs (8). These results are positive, but there are still problems of reduced genetic diversity among the captive leopards and the small numbers of breeding individuals, which the Foundation is trying to address (8). The clouded leopard's survival depends on these conservation measures. It is hoped that one day we can attribute the rare sightings of this beautiful leopard to its elusive nature rather than diminishing numbers (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

As agricultural lands continue to encroach on clouded leopard habitat, incidences of clouded leopard attacks on livestock have increased. Clouded leopards prey on calves, goats, pigs, and poultry. Villagers use poison to kill predators such as clouded leopards.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Clouded leopards have been hunted extensively for their pelts, which may be bought on the wildlife black market. The smuggling of skins from mainland China has increased as the demand for clouded leopard pelts in Taiwan has been renewed. Prior to the conversion of tribal peoples in Taiwan to Christianity, clouded leopard skins were used in ceremonies and the hunter was considered heroic for killing these animals. Today, ownership of a clouded leopard pelt is a status symbol among men in some Asian countries. Authorities have found pelts for sale in many markets throughout mainland Southeast Asia as well. Body parts, especially claws, teeth and bones, are still used in traditional medicine practices. Clouded leopard occasionally appears on menus at upscale restaurants in Asia. In addition, live animals are traded illegally as pets.

Positive Impacts: pet trade ; food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Clouded leopard

The clouded leopard (Neofelis nebulosa) is a felid found from the Himalayan foothills through mainland Southeast Asia into China, and has been classified as vulnerable in 2008 by IUCN. Its total population size is suspected to be fewer than 10,000 mature individuals, with a decreasing population trend and no single population numbering more than 1,000 adults.[2]

The Sunda clouded leopard (Neofelis diardi) found on Sumatra and Borneo is genetically distinct and considered a separate species since 2006.[3][4]

Contents

Characteristics

Close up of face

The fur of clouded leopards is of a dark grey or ochreous ground-colour, often largely obliterated by black and dark dusky-grey blotched pattern. There are black spots on the head, and the ears are black. Partly fused or broken up stripes run from the corner of the eyes over the cheek, from the corner of the mouth to the neck, and along the nape to the shoulders. Elongated blotches continue down the spine and form a single median stripe on the loins. Two large blotches of dark dusky-grey hairs on the side of the shoulders are each emphasized posteriorly by a dark stripe, which passes on to the fore leg and breaks up into irregular spots. The flanks are marked by dark dusky-grey irregular blotches bordered behind by long, oblique irregularly curved or looped stripes. These blotches yielding the clouded pattern suggest the English name of the cat. The underparts and legs are spotted, and the tail is marked by large irregular paired spots.[5]

Melanistic clouded leopards are not common. They weigh between 11.5 and 23 kg (25 and 51 lb). Females vary in head-to-body length from 68.6 to 94 cm (27.0 to 37 in), with a 61 to 82 cm (24 to 32 in) long tail. Males are larger at 81 to 108 cm (32 to 43 in) with a 74 to 91 cm (29 to 36 in) long tail.[6] Their shoulder height varies from 25 to 40 cm (9.8 to 16 in).[7]

Their legs are short and stout, with broad paws. They have exceptionally long, piercing canine teeth, the upper being about three times as long as the basal width of the socket.[5] The upper pair of canines may measure 4 cm (1.6 in) or longer.[6]

Distribution and habitat

Clouded leopards are native to Indochina, Thailand, Peninsular Malaysia, Myanmar, Bhutan, Bangladesh, India, and Nepal. They are regionally extinct in Taiwan, and occur marginally in mixed-evergreen forests of the northeastern and southeastern parts of Bangladesh.[2] In the Himalayan foothills of eastern India they have been recorded up to an altitude of 1,450 m (4,760 ft).[8] They have been reported from relatively open, dry tropical forest in Myanmar and Thailand.[9] They prefer open- or closed-forest habitats to other habitat types.[10]

In Assam, they have been observed in forests but have not been recorded in protected areas.[11] They occur in northern West Bengal, Sikkim, Arunachal Pradesh, Manipur, Meghalaya, Mizoram, Nagaland and Tripura.[12][13]

Clouded leopards were believed to be extinct in Nepal, the last published record being from 1863. But in 1987–1988 four individuals were found in the country. These findings extended their known range westward suggesting that they are able to survive and breed in degraded woodlands and scrub previously supporting moist subtropical semi-deciduous forest.[14]

Distribution of subspecies

At present, the following three subspecies are recognized:[15]

Ecology and behavior

A clouded leopard at the Feline Conservation Center, Rosamond, California

Clouded leopards are the most talented climbers among the cats. In captivity, they have been observed to climb down vertical tree trunks head first, and hang on to branches with their hind paws bent around branchings of tree limbs. They are capable of supination and can even hang down from branches only by bending their hind paws and their tail around them. When jumping down, they keep hanging on to a branch this way until the very last moment. They can climb on horizontal branches with their back to the ground, and in this position make short jumps forward. When balancing on thin branches, they use their long tail to steer. They can easily jump up to 1.2 m (3.9 ft) high.[17]

Clouded leopards have been observed to scent mark in captivity by urine spraying and head-rubbing on prominent objects. Presumably such habits are used to mark their territory in the wild, although the size of their home ranges is unknown. Like other big cats, they do not appear able to purr, but they otherwise have a wide range of vocalisations, including mewing, hissing, growling, moaning, and snorting. Apart from information stemming from observations of captive clouded leopards, little is known of their natural history and behavior in the wild. Early accounts depict them as rare, secretive, arboreal and nocturnal denizens of dense primary forest. More recent observations suggest that they may not be as arboreal and nocturnal as previously thought. They may use trees as day time rest sites but also spend a significant proportion of time on the ground. Some daytime movement has been observed suggesting that they are not strictly nocturnal but crepuscular. However, the time of day when they are active depends on their prey and the level of human disturbance.[6]

Their partly nocturnal and far-ranging behaviour, their low densities, and the fact they inhabit densely vegetated habitats and remote areas makes the censusing and monitoring of clouded leopards extremely difficult. Consequently, little is known about their behaviour and status. Available information on their ecology is anecdotal, based on local interviews and a few sighting reports.[18]

Home ranges have only been estimated in Thailand:

  • Four individuals were radio-collared in Phu Khieo Wildlife Sanctuary from April 2000 to February 2003. Home ranges of two females were 25.7 km2 (9.9 sq mi) and 22.9 km2 (8.8 sq mi), and of two males 29.7 km2 (11.5 sq mi) and 49.1 km2 (19.0 sq mi).[10]
  • Two individuals were radio-collared during a study from 1997 to 1999 in the Khao Yai National Park. The home range of one female was 39.4 km2 (15.2 sq mi), of the one male 42 km2 (16 sq mi). Both individuals had a core area of 2.9 km2 (1.1 sq mi).[19]

Little is known of the feeding ecology of clouded leopards. Their prey likely includes both arboreal and terrestrial vertebrates.[6] Pocock presumed that they are adapted for preying upon herbivorous mammals of considerable bulk because of their powerful build, the deep penetration of their bite, attested by their long canines.[5] Confirmed prey species include hog deer, slow loris, brush-tailed porcupine, Malayan pangolin and Indochinese ground squirrel.[10] Known prey species in China include barking deer and pheasants.[20] They most likely also hunt civets, birds, and domestic livestock. Captive clouded leopards also eat eggs and some vegetation.[citation needed]

Reproduction

Both males and females average 26 months at first reproduction. Estrus last 6 days in average, estrus cycle averages 30 days. After a gestation period of 93±6 days females give birth to a litter of one to five, most often three cubs.[21]

Initially, the young are blind and helpless, much like the young of many other cats, and weigh from 140 to 280 grams (4.9 to 9.9 oz). Unlike adults, the kittens' spots are "solid" — completely dark rather than dark rings. The young can see within about 10 days of birth, are active within five weeks, and are fully weaned at around three month of age. They attain the adult coat pattern at around six months, and probably become independent after around ten months. Females are able to bear one litter each year.[6]

In captivity they have an average lifespan of 11 years. One individual has lived to be almost 17 years old.[22]

Threats

Many of the remaining forest areas are too small to ensure the long-term persistence of clouded leopard populations.[18] They are threatened by habitat loss following large–scale deforestation and commercial poaching for the wildlife trade. Skins, claws and teeth are offered for decoration and clothing, bones and meat as substitute for tiger in traditional Asian medicines and tonics, and live animals for the pet trade. Few poaching incidents have been documented, but all range states are believed to have some degree of commercial poaching. In recent years, substantial domestic markets existed in Indonesia, Myanmar and Vietnam.[23][24]

In Myanmar, 301 body parts of at least 279 clouded leopards, mostly skins and skeletons, were observed in four markets surveyed between 1991 to 2006. Three of the surveyed markets are situated on international borders with China and Thailand, and cater to international buyers, although clouded leopards are completely protected under Myanmar's national legislation. Effective implementation and enforcement of CITES is considered inadequate.[25]

Conservation

A clouded leopard resting atop a tree trunk at the Toronto Zoo.

Neofelis nebulosa is listed in CITES Appendix I and protected over most of its range. Hunting is banned in Bangladesh, China, India, Malaysia, Myanmar, Nepal, Taiwan, Thailand, and Vietnam. It is not legally protected outside Bhutan's protected areas. Hunting is regulated in Laos. No information about its protection status is available from Cambodia.[21] These bans, however, are poorly enforced in India, Malaysia, and Thailand.[23]

In the United States the clouded leopard is listed as endangered under the Endangered Species Act, further prohibiting trade in the animals or any parts or products made from them.[1]

In captivity

Early captive breeding programs involving clouded leopards were met with little success, largely due to ignorance of courtship activity among these cats in the wild. Experience has taught keepers that introducing pairs of clouded leopards at a young age gives opportunities for the pair to bond and breed successfully. Introducing pairs as older adults may cause the animals such stress that the male may kill the female.[7] Modern breeding programs involve carefully regulated introductions between prospective mating pairs and take into account the requirements for enriched enclosures. Stimulating natural behaviour by providing adequate space to permit climbing minimizes stress. This, combined with a feeding program that fulfills the proper dietary requirements, has promoted more successful breeding in recent years.[citation needed]

In March 2011, two breeding females at the Nashville Zoo at Grassmere in Nashville, Tennessee gave birth to three cubs, which are being raised by zookeepers. Each cub weighed a half pound.[26] In June 2011, two cubs were born at the Point Defiance Zoo & Aquarium in Tacoma, Washington. The breeding pair was brought from the Khao Kheow Open Zoo in Thailand in an ongoing education and research exchange program.[27] Four cubs were born at the Nashville Zoo in 2012.[28]

As of December 2011, 222 clouded leopards are believed to exist in zoos.[29]

Cultural influence

The Rukai people of Taiwan consider the clouded leopard to be their spiritual ancestor who led them to their homeland.[30]

Etymology

The scientific name of the genus Neofelis is a composite of the Greek word νεο- meaning "new", and the Latin word feles meaning "cat", so it literally means "new cat."[31][32]

References

  1. ^ a b Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 545. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000222. 
  2. ^ a b c Sanderson, J., Khan, J.A., Grassman, L., Mallon, D.P. (2008). "Neofelis nebulosa". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/14519. 
  3. ^ Buckley-Beason, V.A., Johnson, W.E., Nash, W.G., Stanyon, R., Menninger, J.C., Driscoll, C.A., Howard, J., Bush, M., Page, J.E., Roelke, M.E., Stone, G., Martelli, P., Wen, C., Ling, L.; Duraisingam, R.K., Lam, V.P., O'Brien, S.J. (2006). "Molecular Evidence for Species-Level Distinctions in Clouded Leopards". Current Biology 16 (23): 2371–2376. doi:10.1016/j.cub.2006.08.066. PMID 17141620. 
  4. ^ Kitchener, A.C., Beaumont, M.A., Richardson, D. (2006). "Geographical Variation in the Clouded Leopard, Neofelis nebulosa, Reveals Two Species". Current Biology 16 (23): 2377–2383. doi:10.1016/j.cub.2006.10.066. PMID 17141621. 
  5. ^ a b c Pocock, R.I. (1939) The Fauna of British India, including Ceylon and Burma. Mammalia. – Volume 1. Taylor and Francis, Ltd., London. Pp 247–253
  6. ^ a b c d e Sunquist, M.; Sunquist, F. (2002). Wild cats of the World. Chicago: University of Chicago Press. pp. 278–284. ISBN 0-226-77999-8. 
  7. ^ a b "Felid TAG Clouded Leopard Factsheet". Smithsonian National Zoological Park. http://nationalzoo.si.edu/ConservationAndScience/AZA/FelidTAG/Species/Factsheets/clouded-leopard.cfm. Retrieved 2009-06-06. 
  8. ^ Biswas, B., Ghose, R.K., Ghosal, D.K. (1985) Progress report 2 on pilot survey of the WWF-India / Zoological survey of India collaborative project on the status survey of the lesser cats in eastern India. Zoological Survey of India, Calcutta.
  9. ^ Rabinowitz, A.R., Walker, S.R. (1991) The carnivore community in a dry tropical forest mosaic in Huai Kha Khaeng Wildlife Sanctuary, Thailand. Journal of Tropical Ecology 7: 37−47.
  10. ^ a b c Grassman Jr., L. I.,Tewes, M. E., Silvy, N. J., Kreetiyutanont, K. (2005) Ecology of three sympatric felids in a mixed evergreen forest in North-central Thailand. Journal of Mammalogy 86: 29–38.
  11. ^ Choudhury, A.U. (1992) The Clouded leopard in Assam. Oryx 27 (1): 51–53.
  12. ^ Choudhury, A.U. (1996) The clouded leopard. Cheetal 35 (1-2): 13–18.
  13. ^ Choudhury, A. U. (2003) The cats in North East India. Cat News 39: 15–19.
  14. ^ Dinerstein, E. and Mehta, J.N. (1989) The clouded leopard in Nepal. Oryx 23(4): 199–201.
  15. ^ Sunquist, M. E., Sunquist, F. (2009) Family Felidae (Cats) In: Wilson, D. E., Mittermeier, R. A. (eds.) Handbook of the Mammals of the World - Volume 1 Carnivores. Lynx Edicions in association with Conservation International and IUCN. ISBN 978-84-96553-49-1
  16. ^ Anonymous. (1996) The mystery of the Formosan clouded leopard. Cat News 24: 16.
  17. ^ Hemmer, H. (1968). Untersuchungen zur Stammesgeschichte der Pantherkatzen (Pantherinae) II: Studien zur Ethologie des Nebelparders Neofelis nebulosa (Griffith 1821) und des Irbis Uncia uncia (Schreber 1775). [Studies of the philogenetic history of the Pantherinae II: Research into the ecology of the clouded leopard and snow leopard.] Veröffentlichungen Zoologische Staatssammlung München 12:155–247.
  18. ^ a b Wilting, A., Fischer, F., Bakar, S.A., Linsenmair, K.E. (2006) Clouded leopards, the secretive top-carnivore of South-East Asian rainforests: their distribution, status and conservation needs in Sabah, Malaysia. BMC Ecology 2006, 6 (16): 1–13.
  19. ^ Austin, S. C., Tewes, M. E. (1999) Ecology of the clouded leopard in Khao Yai National Park, Thailand. Cat News 31: 17–18.
  20. ^ Feng, L., Lin, L., Zhang, L., Wang, L., Wang, B., Luo A., Yang, S., Smith, J. L. D., Luo S. J. and Zhang, L. (2008) Evidence of wild tigers in southwest China – a preliminary survey of the Xishuangbanna National Nature Reserve. Cat News 48: 4–6.
  21. ^ a b Nowell, K., Jackson, P. (1996). Clouded Leopard in: Wild Cats: status survey and conservation action plan. IUCN/SSC Cat Specialist Group, Gland, Switzerland
  22. ^ Achariyo, L.N., Mishra, Ch. G. (1981). "Some notes on the longevity of two species of Indian wild cats in captivity". Journal of the Bombay Natural History Society 78: 155. 
  23. ^ a b Nowell, K. (2007) Asian big cat conservation and trade control in selected range States: evaluating implementation and effectiveness of CITES Recommendations. A TRAFFIC Report, June 2007
  24. ^ "Clouded Leopard — Neofelis nebulosa". Defenders of Wildlife. http://www.defenders.org/wildlife_and_habitat/wildlife/clouded_leopard.php. 
  25. ^ Shepherd, C. R., Nijman, V. (2008) The wild cat trade in Myanmar. TRAFFIC Southeast Asia, Petaling Jaya, Selangor, Malaysia.
  26. ^ http://www.nashvillezoo.org/scripts/view_photo.asp?pressID=174
  27. ^ http://www.pdza.org/page.php?id=503
  28. ^ "The Nashville Zoo celebrates two sets of clouded leopard cubs". Associated Press (al.com). March 29, 2012. http://www.al.com/living/index.ssf/2012/03/the_nashville_zoo_celebrates_t.html. 
  29. ^ Musi, V. J. (2011). "Cats in Crisis". National Geographic 202 (6): foldout (between 90–91). 
  30. ^ "Cats from A to Z, The Clouded Leopard". Natural History Museum of Los Angeles County. http://www.nhm.org/cats/. Retrieved 2009-06-06. [dead link]
  31. ^ Perseus Digital Library. Greek Dictionary νεο Headword Search Result
  32. ^ Perseus Digital Library. Latin Dictionary feles Headword Search Result
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!